Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TUBB8 Gene

Aliases for TUBB8 Gene

  • Tubulin Beta 8 Class VIII 2 3 4 5
  • Tubulin, Beta 8 Class VIII 2
  • HSA10p15 Beta-Tubulin 4Q 3
  • Class VIII Beta-Tubulin 2
  • Tubulin Beta-8 Chain 3
  • BA631M21.2 3
  • OOMD2 3
  • OOMD 3

External Ids for TUBB8 Gene

Previous GeneCards Identifiers for TUBB8 Gene

  • GC10M000082
  • GC10M000037
  • GC10M000093

Summaries for TUBB8 Gene

Entrez Gene Summary for TUBB8 Gene

  • The protein encoded by this gene represents the primary beta-tubulin subunit of oocytes and the early embryo. Defects in this gene, which is primate-specific, are a cause of oocyte maturation defect 2 and infertility. [provided by RefSeq, Mar 2016]

GeneCards Summary for TUBB8 Gene

TUBB8 (Tubulin Beta 8 Class VIII) is a Protein Coding gene. Diseases associated with TUBB8 include Oocyte Maturation Defect 2 and Female Infertility Due To Oocyte Meiotic Arrest. Among its related pathways are Development Slit-Robo signaling and EphB-EphrinB Signaling. Gene Ontology (GO) annotations related to this gene include GTP binding and structural constituent of cytoskeleton. An important paralog of this gene is TUBB4B.

UniProtKB/Swiss-Prot for TUBB8 Gene

  • Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain (By similarity). TUBB8 has a key role in meiotic spindle assembly and oocyte maturation (PubMed:26789871).

Additional gene information for TUBB8 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TUBB8 Gene

Genomics for TUBB8 Gene

GeneHancer (GH) Regulatory Elements for TUBB8 Gene

Promoters and enhancers for TUBB8 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH10I000076 Enhancer 0.8 Ensembl 571.3 0.0 -46 1 RB1 SIN3A ZNF2 RAD21 ZNF335 GLIS2 ZNF143 ZNF654 ZNF362 PHF21A TUBB8 GC10M000074 ZMYND11 IL9RP2
GH10I000073 Promoter 1 Ensembl 24.8 +2.5 2454 0.8 HDAC1 CTCF RB1 ZBTB7B RAD21 CTBP1 MTA3 ATF7 EZH2 PHF21A GC10M000074 TUBB8 PIR63025
GH10I000132 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 7.2 -58.6 -58621 5.2 HDGF PKNOX1 FOXA2 MLX ARID4B SIN3A DMAP1 ZNF2 ZNF48 ETS1 GC10P000136 ZMYND11 TUBB8
GH10I000087 Enhancer 0.7 ENCODE 9.7 -10.9 -10929 0.7 HDAC1 ATF1 ETV1 TEAD4 TAL1 TCF12 CTBP1 NCOR1 CBFA2T2 TRIM24 IL9RP2 ZMYND11 TUBB8 PIR51131
GH10I000612 Enhancer 1.1 Ensembl ENCODE dbSUPER 5.1 -538.1 -538117 4.3 SIX4 CLOCK NFIB NEUROD1 SIN3A ZKSCAN1 E2F1 CTBP1 GATA3 POLR2A PRR26 DIP2C TUBB8 LOC101930421 PIR32536
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TUBB8 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the TUBB8 gene promoter:

Genomic Locations for TUBB8 Gene

Genomic Locations for TUBB8 Gene
29,818 bases
Minus strand

Genomic View for TUBB8 Gene

Genes around TUBB8 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TUBB8 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TUBB8 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TUBB8 Gene

Proteins for TUBB8 Gene

  • Protein details for TUBB8 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Tubulin beta-8 chain
    Protein Accession:
    Secondary Accessions:
    • Q5SQX9
    • Q8WZ78

    Protein attributes for TUBB8 Gene

    444 amino acids
    Molecular mass:
    49776 Da
    Quaternary structure:
    • Dimer of alpha and beta chains. A typical microtubule is a hollow water-filled tube with an outer diameter of 25 nm and an inner diameter of 15 nM. Alpha-beta heterodimers associate head-to-tail to form protofilaments running lengthwise along the microtubule wall with the beta-tubulin subunit facing the microtubule plus end conferring a structural polarity. Microtubules usually have 13 protofilaments but different protofilament numbers can be found in some organisms and specialized cells.
    • Sequence=CAI16221.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305};

neXtProt entry for TUBB8 Gene

Post-translational modifications for TUBB8 Gene

  • Phosphorylated on Ser-172 by CDK1 during the cell cycle, from metaphase to telophase, but not in interphase. This phosphorylation inhibits tubulin incorporation into microtubules.
  • Some glutamate residues at the C-terminus are monoglycylated but not polyglycylated due to the absence of functional TTLL10 in human. Monoglycylation is mainly limited to tubulin incorporated into axonemes (cilia and flagella). Both polyglutamylation and monoglycylation can coexist on the same protein on adjacent residues, and lowering glycylation levels increases polyglutamylation, and reciprocally. The precise function of monoglycylation is still unclear (Probable).
  • Some glutamate residues at the C-terminus are polyglutamylated, resulting in polyglutamate chains on the gamma-carboxyl group (PubMed:26875866). Polyglutamylation plays a key role in microtubule severing by spastin (SPAST). SPAST preferentially recognizes and acts on microtubules decorated with short polyglutamate tails: severing activity by SPAST increases as the number of glutamates per tubulin rises from one to eight, but decreases beyond this glutamylation threshold (PubMed:26875866).

No data available for DME Specific Peptides for TUBB8 Gene

Domains & Families for TUBB8 Gene

Gene Families for TUBB8 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Plasma proteins
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for TUBB8 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the tubulin family.
  • Belongs to the tubulin family.
genes like me logo Genes that share domains with TUBB8: view

Function for TUBB8 Gene

Molecular function for TUBB8 Gene

UniProtKB/Swiss-Prot Function:
Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain (By similarity). TUBB8 has a key role in meiotic spindle assembly and oocyte maturation (PubMed:26789871).

Gene Ontology (GO) - Molecular Function for TUBB8 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
GO:0003924 GTPase activity IEA --
GO:0005200 structural constituent of cytoskeleton IEA --
GO:0005525 GTP binding IEA --
genes like me logo Genes that share ontologies with TUBB8: view
genes like me logo Genes that share phenotypes with TUBB8: view

Human Phenotype Ontology for TUBB8 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

Inhibitory RNA Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Animal Models , Transcription Factor Targets and HOMER Transcription for TUBB8 Gene

Localization for TUBB8 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TUBB8 Gene

Cytoplasm, cytoskeleton. Cytoplasm, cytoskeleton, spindle.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TUBB8 gene
Compartment Confidence
extracellular 5
cytoskeleton 5
cytosol 3
nucleus 1

Gene Ontology (GO) - Cellular Components for TUBB8 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005819 spindle IEA --
GO:0005856 cytoskeleton IEA --
GO:0005874 microtubule IEA --
GO:0015630 microtubule cytoskeleton IDA --
genes like me logo Genes that share ontologies with TUBB8: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for TUBB8 Gene

Pathways & Interactions for TUBB8 Gene

genes like me logo Genes that share pathways with TUBB8: view

Interacting Proteins for TUBB8 Gene

Gene Ontology (GO) - Biological Process for TUBB8 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001556 oocyte maturation IMP 26789871
GO:0007010 cytoskeleton organization IEA --
GO:0007017 microtubule-based process IEA --
GO:0007056 spindle assembly involved in female meiosis IMP 26789871
genes like me logo Genes that share ontologies with TUBB8: view

No data available for SIGNOR curated interactions for TUBB8 Gene

Drugs & Compounds for TUBB8 Gene

(1) Drugs for TUBB8 Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Guanosine triphosphate Experimental Pharma 0
genes like me logo Genes that share compounds with TUBB8: view

Transcripts for TUBB8 Gene

Unigene Clusters for TUBB8 Gene

Tubulin, beta 8 class VIII:
Representative Sequences:

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for TUBB8 Gene

No ASD Table

Relevant External Links for TUBB8 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TUBB8 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TUBB8 Gene

mRNA differential expression in normal tissues according to GTEx for TUBB8 Gene

This gene is overexpressed in Testis (x8.3) and Thyroid (x4.2).

Protein differential expression in normal tissues from HIPED for TUBB8 Gene

This gene is overexpressed in Retina (8.8), Bone marrow stromal cell (7.6), and Amniocyte (7.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for TUBB8 Gene

Protein tissue co-expression partners for TUBB8 Gene

NURSA nuclear receptor signaling pathways regulating expression of TUBB8 Gene:


SOURCE GeneReport for Unigene cluster for TUBB8 Gene:


mRNA Expression by UniProt/SwissProt for TUBB8 Gene:

Tissue specificity: Expressed at a high level in oocytes, at different stages of development.

Evidence on tissue expression from TISSUES for TUBB8 Gene

  • Nervous system(4.2)
genes like me logo Genes that share expression patterns with TUBB8: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and Phenotype-based relationships between genes and organs from Gene ORGANizer for TUBB8 Gene

Orthologs for TUBB8 Gene

This gene was present in the common ancestor of human and chimp.

Orthologs for TUBB8 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia TUBB8 33
  • 98.2 (n)
Species where no ortholog for TUBB8 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for TUBB8 Gene

Gene Tree for TUBB8 (if available)
Gene Tree for TUBB8 (if available)

Paralogs for TUBB8 Gene

Paralogs for TUBB8 Gene

genes like me logo Genes that share paralogs with TUBB8: view

Variants for TUBB8 Gene

Sequence variations from dbSNP and Humsavar for TUBB8 Gene

SNP ID Clin Chr 10 pos Variation AA Info Type
rs1057520306 pathogenic, Oocyte maturation defect 2 47,679(-) G/A coding_sequence_variant, missense_variant
rs1057520307 pathogenic, Oocyte maturation defect 2 48,870(-) CAGCGGAGTCGATGGCATGTTCA/CA 5_prime_UTR_variant, coding_sequence_variant, genic_upstream_transcript_variant, inframe_deletion, upstream_transcript_variant
rs781853492 Oocyte maturation defect 2 (OOMD2) [MIM:616780] 47,764(-) T/C coding_sequence_variant, missense_variant
rs782246853 pathogenic, Oocyte maturation defect 2 47,966(-) CCCCCC/CCCCCCC coding_sequence_variant, frameshift, intron_variant
rs782269374 Oocyte maturation defect 2 (OOMD2) [MIM:616780] 47,629(-) C/T coding_sequence_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for TUBB8 Gene

Variant ID Type Subtype PubMed ID
dgv646n100 CNV gain+loss 25217958
dgv647n100 CNV gain 25217958
dgv648n100 CNV gain 25217958
dgv649n100 CNV gain 25217958
dgv88e214 CNV gain 21293372
esv24948 CNV gain 19812545
esv2759723 CNV gain 17122850
nsv1077313 CNV duplication 25765185
nsv8592 CNV gain 18304495
nsv947724 CNV duplication 23825009

Variation tolerance for TUBB8 Gene

Residual Variation Intolerance Score: 93.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.93; 35.81% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TUBB8 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TUBB8 Gene

Disorders for TUBB8 Gene

MalaCards: The human disease database

(4) MalaCards diseases for TUBB8 Gene - From: HGMD, OMIM, ClinVar, Orphanet, Swiss-Prot, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search TUBB8 in MalaCards View complete list of genes associated with diseases


  • Oocyte maturation defect 2 (OOMD2) [MIM:616780]: An autosomal dominant infertility disorder caused by defective oocyte maturation. Oocytes are arrested at metaphase I, and have an abnormal or no detectable spindle on polarization microscopy. {ECO:0000269 PubMed:26789871, ECO:0000269 PubMed:27273344}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for TUBB8

genes like me logo Genes that share disorders with TUBB8: view

No data available for Genatlas for TUBB8 Gene

Publications for TUBB8 Gene

  1. Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos. (PMID: 27273344) Feng R … Wang L (Journal of medical genetics 2016) 3 4 58
  2. Mutations in TUBB8 and Human Oocyte Meiotic Arrest. (PMID: 26789871) Feng R … Wang L (The New England journal of medicine 2016) 3 4 58
  3. A cascade of complex subtelomeric duplications during the evolution of the hominoid and Old World monkey genomes. (PMID: 11731935) van Geel M … de Jong PJ (American journal of human genetics 2002) 3 4 58
  4. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
  5. Recruitment of the Mammalian Histone-modifying EMSY Complex to Target Genes Is Regulated by ZNF131. (PMID: 26841866) Varier RA … Vermeulen M (The Journal of biological chemistry 2016) 3 58

Products for TUBB8 Gene

Sources for TUBB8 Gene

Loading form....