Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TRIT1 Gene

Aliases for TRIT1 Gene

  • TRNA Isopentenyltransferase 1 2 3
  • Isopentenyl-Diphosphate:TRNA Isopentenyltransferase 3 4
  • IPP Transferase 3 4
  • IPTase 3 4
  • HGRO1 3 4
  • IPPT 3 4
  • MOD5 3 4
  • IPT 3 4
  • TRNA Dimethylallyltransferase, Mitochondrial 3
  • TRNA Isopentenylpyrophosphate Transferase 3
  • TRNA Isopentenyltransferase 4
  • EC 4
  • EC 63

External Ids for TRIT1 Gene

Previous GeneCards Identifiers for TRIT1 Gene

  • GC01M039720
  • GC01M039975
  • GC01M040081
  • GC01M040306
  • GC01M038425

Summaries for TRIT1 Gene

GeneCards Summary for TRIT1 Gene

TRIT1 (TRNA Isopentenyltransferase 1) is a Protein Coding gene. Diseases associated with TRIT1 include tinea pedis. Among its related pathways are Metabolism. GO annotations related to this gene include tRNA dimethylallyltransferase activity.

UniProtKB/Swiss-Prot for TRIT1 Gene

  • Catalyzes the transfer of a dimethylallyl group onto the adenine at position 37 of both cytosolic and mitochondrial tRNAs, leading to the formation of N6-(dimethylallyl)adenosine (i(6)A).

Gene Wiki entry for TRIT1 Gene

No data available for Entrez Gene Summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TRIT1 Gene

Genomics for TRIT1 Gene

Regulatory Elements for TRIT1 Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for TRIT1 Gene

39,841,022 bp from pter
39,883,511 bp from pter
42,490 bases
Minus strand

Genomic View for TRIT1 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for TRIT1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TRIT1 Gene

Proteins for TRIT1 Gene

  • Protein details for TRIT1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    tRNA dimethylallyltransferase, mitochondrial
    Protein Accession:
    Secondary Accessions:
    • A1A4X7
    • Q3T7B5
    • Q5QPK5
    • Q5QPK6
    • Q6IAC9
    • Q96FJ3
    • Q96L45
    • Q9NXT7

    Protein attributes for TRIT1 Gene

    467 amino acids
    Molecular mass:
    52725 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for TRIT1 Gene

neXtProt entry for TRIT1 Gene

Proteomics data for TRIT1 Gene at MOPED

Selected DME Specific Peptides for TRIT1 Gene

Post-translational modifications for TRIT1 Gene

  • Ubiquitination at Lys391
  • Modification sites at PhosphoSitePlus

Antibody Products

Domains for TRIT1 Gene

Protein Domains for TRIT1 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the IPP transferase family.
  • Contains 1 matrin-type zinc finger.
  • Belongs to the IPP transferase family.
  • Contains 1 matrin-type zinc finger.
genes like me logo Genes that share domains with TRIT1: view

No data available for Gene Families for TRIT1 Gene

Function for TRIT1 Gene

Molecular function for TRIT1 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
Dimethylallyl diphosphate + adenine(37) in tRNA = diphosphate + N(6)-dimethylallyladenine(37) in tRNA
UniProtKB/Swiss-Prot Function:
Catalyzes the transfer of a dimethylallyl group onto the adenine at position 37 of both cytosolic and mitochondrial tRNAs, leading to the formation of N6-(dimethylallyl)adenosine (i(6)A).

Enzyme Numbers (IUBMB) for TRIT1 Gene

Gene Ontology (GO) - Molecular Function for TRIT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003676 nucleic acid binding --
GO:0004161 dimethylallyltranstransferase activity --
GO:0005524 ATP binding IEA --
GO:0008270 zinc ion binding --
GO:0016740 transferase activity --
genes like me logo Genes that share ontologies with TRIT1: view

Animal Model Products

CRISPR Products

miRNA for TRIT1 Gene

miRTarBase miRNAs that target TRIT1

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for TRIT1

In Situ Assay Products

Flow Cytometry Products

No data available for Phenotypes , Animal Models , Transcription Factor Targets and HOMER Transcription for TRIT1 Gene

Localization for TRIT1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TRIT1 Gene

Isoform 1: Mitochondrion.
Isoform 4: Mitochondrion.
Isoform 2: Cytoplasm.
Isoform 3: Cytoplasm.
Isoform 5: Cytoplasm.

Subcellular locations from

Jensen Localization Image for TRIT1 Gene COMPARTMENTS Subcellular localization image for TRIT1 gene
Compartment Confidence
mitochondrion 3
nucleus 3
chloroplast 1
cytosol 1
plasma membrane 1

Gene Ontology (GO) - Cellular Components for TRIT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005575 cellular_component ND --
GO:0005739 mitochondrion IEA --
genes like me logo Genes that share ontologies with TRIT1: view

Pathways for TRIT1 Gene

SuperPathways for TRIT1 Gene

Superpath Contained pathways
1 Metabolism
genes like me logo Genes that share pathways with TRIT1: view

Pathways by source for TRIT1 Gene

1 KEGG pathway for TRIT1 Gene

Gene Ontology (GO) - Biological Process for TRIT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008033 tRNA processing IEA --
GO:0009058 biosynthetic process --
genes like me logo Genes that share ontologies with TRIT1: view

Drugs for TRIT1 Gene

(4) HMDB Compounds for TRIT1 Gene

Compound Synonyms Cas Number PubMed IDs
  • 1,1-Dimethyl-4-phenylpiperazinium iodide
Isopentenyl pyrophosphate
  • 3-Methyl-3-butenyl pyrophosphate
Phosphoric acid
  • Acide phosphorique (FRENCH)
  • (4-)Diphosphoric acid ion

(2) Novoseek inferred chemical compound relationships for TRIT1 Gene

Compound -log(P) Hits PubMed IDs
isopentenyladenosine 88.3 1
cytokinin 77 2
genes like me logo Genes that share compounds with TRIT1: view

Transcripts for TRIT1 Gene

Unigene Clusters for TRIT1 Gene

TRNA isopentenyltransferase 1:
Representative Sequences:

CRISPR Products

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for TRIT1

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for TRIT1 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3a · 3b ^ 4 ^ 5a · 5b · 5c · 5d ^ 6 ^ 7a · 7b · 7c ^ 8 ^ 9a · 9b ^ 10a · 10b ^ 11a · 11b ^ 12a · 12b · 12c
SP1: - - - - - -
SP2: - - - - - -
SP3: - - - - - - - -
SP4: - - - - - - - -
SP5: - - - - - - - -
SP6: - - - - - - - -
SP7: - - - - - - - -
SP8: - - - - - - - - -
SP9: - - - - - - - - -
SP10: - - - - - - - - - - -
SP11: - - - - - - - - - - -
SP12: - - - - - - - - - - - -
SP13: - - - - - - - - - - - -
SP14: - - - - - - - - - - - - -
SP15: -
SP16: - - - - - - -
SP17: - - - - - - - - - - - - - - - - -
SP18: -
SP21: - - - - - - - - - - - - - - - - - - -

Relevant External Links for TRIT1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TRIT1 Gene

mRNA expression in normal human tissues for TRIT1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues for TRIT1 Gene

This gene is overexpressed in Pancreatic juice (67.0).

Integrated Proteomics: protein expression from ProteomicsDB, MOPED, and MaxQB for TRIT1 Gene

SOURCE GeneReport for Unigene cluster for TRIT1 Gene Hs.356554

genes like me logo Genes that share expressions with TRIT1: view

Expression partners for TRIT1 Gene

* - Elite partner

Primer Products

In Situ Assay Products

No data available for mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for TRIT1 Gene

Orthologs for TRIT1 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for TRIT1 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia TRIT1 35
  • 90.72 (n)
  • 89.94 (a)
TRIT1 36
  • 90 (a)
(Canis familiaris)
Mammalia TRIT1 35
  • 90.94 (n)
  • 90.58 (a)
TRIT1 36
  • 90 (a)
(Mus musculus)
Mammalia Trit1 35
  • 87.44 (n)
  • 89.29 (a)
Trit1 16
Trit1 36
  • 89 (a)
(Pan troglodytes)
Mammalia TRIT1 35
  • 99.64 (n)
  • 99.79 (a)
TRIT1 36
  • 100 (a)
(Rattus norvegicus)
Mammalia Trit1 35
  • 86.38 (n)
  • 88.82 (a)
(Monodelphis domestica)
Mammalia TRIT1 36
  • 77 (a)
(Ornithorhynchus anatinus)
Mammalia TRIT1 36
  • 74 (a)
(Gallus gallus)
Aves TRIT1 35
  • 72.54 (n)
  • 73.78 (a)
TRIT1 36
  • 71 (a)
(Anolis carolinensis)
Reptilia TRIT1 36
  • 62 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia Str.20035 35
trit1 35
  • 66.05 (n)
  • 65.75 (a)
(Danio rerio)
Actinopterygii Dr.11495 35
trit1 35
  • 62.72 (n)
  • 62.32 (a)
trit1 36
  • 57 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP000639 35
  • 50.87 (n)
  • 45.41 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG31381 35
  • 50.43 (n)
  • 43.29 (a)
CG31381 36
  • 38 (a)
(Caenorhabditis elegans)
Secernentea gro-1 35
  • 46.89 (n)
  • 35.86 (a)
gro-1 36
  • 32 (a)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AER341W 35
  • 47.07 (n)
  • 35.88 (a)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0C07359g 35
  • 49.21 (n)
  • 36.24 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes MOD5 35
  • 46.53 (n)
  • 38.82 (a)
MOD5 36
  • 33 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons IPT2 35
  • 47.17 (n)
  • 32.66 (a)
(Oryza sativa)
Liliopsida Os01g0968700 35
  • 48.88 (n)
  • 34.74 (a)
bread mold
(Neurospora crassa)
Ascomycetes NCU10185 35
  • 45.3 (n)
  • 36.39 (a)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes tit1 35
  • 46.89 (n)
  • 37.27 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.6808 36
  • 40 (a)
Species with no ortholog for TRIT1:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TRIT1 Gene

Gene Tree for TRIT1 (if available)
Gene Tree for TRIT1 (if available)

Paralogs for TRIT1 Gene

No data available for Paralogs for TRIT1 Gene

Variants for TRIT1 Gene

Sequence variations from dbSNP and Humsavar for TRIT1 Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type MAF
rs78310238 -- 39,854,923(+) TGCAG(-/CCTCAACCTCCCAGGGCTCG)AGTCA intron-variant
rs78385773 -- 39,871,920(+) TTTTT(C/T)TGGGA intron-variant
rs78638513 -- 39,856,491(+) AGAAA(A/G)AAAAA intron-variant
rs78673047 -- 39,844,566(+) AGGTT(A/C)AAGAA reference, stop-gained
rs77906613 -- 39,859,583(+) GTCTC(A/C)AAAAA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for TRIT1 Gene

Variant ID Type Subtype PubMed ID
dgv15n27 CNV Gain 19166990
dgv49e1 CNV Complex 17122850
esv2666580 CNV Deletion 23128226

Relevant External Links for TRIT1 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TRIT1 Gene

Disorders for TRIT1 Gene

MalaCards: The human disease database

MalaCards: The human disease database.

Search for TRIT1 Gene in MalaCards »

(1) Disease for TRIT1 Gene

(1) University of Copenhagen DISEASES for TRIT1 Gene

Relevant External Links for TRIT1

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
genes like me logo Genes that share disorders with TRIT1: view

No data available for OMIM , UniProtKB/Swiss-Prot , Novoseek inferred disease relationships and Genatlas for TRIT1 Gene

Publications for TRIT1 Gene

  1. Cloning of a human tRNA isopentenyl transferase. (PMID: 11111046) Golovko A. … Nicander B. (Gene 2000) 2 3 4 23
  2. Ethnic differences in frequencies of gene polymorphisms in the MYCL1 region and modulation of lung cancer patients' survival. (PMID: 17145094) Spinola M. … Dragani T.A. (Lung Cancer 2007) 3 23 48
  3. Identification and functional characterization of the candidate tumor suppressor gene TRIT1 in human lung cancer. (PMID: 15870694) Spinola M. … Dragani T.A. (Oncogene 2005) 2 3 4
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4

Products for TRIT1 Gene

Sources for TRIT1 Gene

Back to Top
