Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TRIM28 Gene

Aliases for TRIM28 Gene

  • Tripartite Motif Containing 28 2 3
  • Tripartite Motif-Containing Protein 28 3 4
  • Tripartite Motif-Containing 28 2 3
  • E3 SUMO-Protein Ligase TRIM28 3 4
  • KRAB-Interacting Protein 1 3 4
  • Nuclear Corepressor KAP-1 3 4
  • KRAB-Associated Protein 1 3 4
  • RING Finger Protein 96 3 4
  • TIF1-Beta 3 4
  • KRIP-1 3 4
  • KAP-1 3 4
  • RNF96 3 4
  • TIF1B 3 4
  • KAP1 3 4
  • KRAB [Kruppel-Associated Box Domain]-Associated Protein 1 3
  • Protein Phosphatase 1, Regulatory Subunit 157 3
  • Transcriptional Intermediary Factor 1-Beta 3
  • Transcription Intermediary Factor 1-Beta 3
  • Regulatory Subunit 157 2
  • Protein Phosphatase 1 2
  • EC 6.3.2.- 4
  • PPP1R157 3
  • TF1B 3

External Ids for TRIM28 Gene

Summaries for TRIM28 Gene

Entrez Gene Summary for TRIM28 Gene

  • The protein encoded by this gene mediates transcriptional control by interaction with the Kruppel-associated box repression domain found in many transcription factors. The protein localizes to the nucleus and is thought to associate with specific chromatin regions. The protein is a member of the tripartite motif family. This tripartite motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. [provided by RefSeq, Jul 2008]

GeneCards Summary for TRIM28 Gene

TRIM28 (Tripartite Motif Containing 28) is a Protein Coding gene. Among its related pathways are Cell Cycle / Checkpoint Control and Corticotropin-releasing hormone. GO annotations related to this gene include sequence-specific DNA binding transcription factor activity and ubiquitin-protein transferase activity. An important paralog of this gene is AIRE.

UniProtKB/Swiss-Prot for TRIM28 Gene

  • Nuclear corepressor for KRAB domain-containing zinc finger proteins (KRAB-ZFPs). Mediates gene silencing by recruiting CHD3, a subunit of the nucleosome remodeling and deacetylation (NuRD) complex, and SETDB1 (which specifically methylates histone H3 at Lys-9 (H3K9me)) to the promoter regions of KRAB target genes. Enhances transcriptional repression by coordinating the increase in H3K9me, the decrease in histone H3 Lys-9 and Lys-14 acetylation (H3K9ac and H3K14ac, respectively) and the disposition of HP1 proteins to silence gene expression. Recruitment of SETDB1 induces heterochromatinization. May play a role as a coactivator for CEBPB and NR3C1 in the transcriptional activation of ORM1. Also corepressor for ERBB4. Inhibits E2F1 activity by stimulating E2F1-HDAC1 complex formation and inhibiting E2F1 acetylation. May serve as a partial backup to prevent E2F1-mediated apoptosis in the absence of RB1. Important regulator of CDKN1A/p21(CIP1). Has E3 SUMO-protein ligase activity toward itself via its PHD-type zinc finger. Also specifically sumoylates IRF7, thereby inhibiting its transactivation activity. Ubiquitinates p53/TP53 leading to its proteosomal degradation; the function is enhanced by MAGEC2 and MAGEA2, and possibly MAGEA3 and MAGEA6. Mediates the nuclear localization of KOX1, ZNF268 and ZNF300 transcription factors. In association with isoform 2 of ZFP90, is required for the transcriptional repressor activity of FOXP3 and the suppressive function of regulatory T-cells (Treg) (PubMed:23543754).

Gene Wiki entry for TRIM28 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TRIM28 Gene

Genomics for TRIM28 Gene

Genomic Location for TRIM28 Gene

Start:
58,544,091 bp from pter
End:
58,550,722 bp from pter
Size:
6,632 bases
Orientation:
Plus strand

Genomic View for TRIM28 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for TRIM28 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TRIM28 Gene

Regulatory Elements for TRIM28 Gene

Proteins for TRIM28 Gene

  • Protein details for TRIM28 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q13263-TIF1B_HUMAN
    Recommended name:
    Transcription intermediary factor 1-beta
    Protein Accession:
    Q13263
    Secondary Accessions:
    • O00677
    • Q7Z632
    • Q93040
    • Q96IM1

    Protein attributes for TRIM28 Gene

    Size:
    835 amino acids
    Molecular mass:
    88550 Da
    Quaternary structure:
    • Interacts with SETX (PubMed:23149945). Oligomer; the RBCC domain homotrimerizes and interacts with one molecule of KRAB to form the KRAB-KAP1 corepressor complex. Binding to a KRAB domain is an absolute requirement for silencing gene expression. Interacts with CEBPB and NR3C1. Interacts with a number of KRAB-ZFP proteins including ZNF10, ZFP53, ZFP68, ZNF382 and ZNF256. Interacts with NCOR1, NR3C1 and CHD3. Interacts with CEBPB (via the RING-type and PHD-type zinc fingers). Component of a ternary complex that includes TRIM28, a HP1 protein (CBX1, CBX3 OR CBX5), a KRAB domain-containing protein, and DNA. Interacts with CBX5 (via the PxVxL motif); the interaction occurs in interphase nuclei and competes for binding POGZ. Interacts with POGZ; the interaction competes for interaction with CBX5. Interacts with SETDB1; the interaction is enhanced by KAP1 sumoylation, stimulates SETB1 histone methyltransferase activity and gene silencing. Interacts (via the PHD-type zinc finger) with UBE2I; the interaction is required for sumoylation and repressor activity. Component of the TRIM28/KAP1-ERBB4-MDM2 complex involved in connecting growth factor and DNA damage responses. Interacts directly with ERBB4; the interaction represses ERBB4-mediated transcription activity. Interacts with MDM2; the interaction contributes to p53/TP53 inactivation. Component of the TRIM28/KAP1-MDM2-p53/TP53; involved in regulating p53/TP53 stabilization and activity. Interacts (via the leucine zipper alpha helical coiled-coil) with E2F1 (central region); the interaction inhibits E2F1 acetylation and transcriptional activity. Interacts with PPP1CA; the interaction dephosphorylates TRIM28 at Ser-824 and forms a complex at the p21 promoter site. Interacts with PPP1CB; the interaction is weak but is increased on dephosphorylation at Ser-824. Interacts with FES/FPS. Interacts with SMARCAD1. Interacts with, and sumoylates IRF7. Interacts with MAGEC2. Part of a complex composed of TRIM28, HDAC1, HDAC2 and EHMT2. Interacts with AICDA (By similarity). Interacts (via the RBCC domain) with KOX1 (via the KRAB domain), ZNF268 (via the KRAB domain) and ZNF300 (via the KRAB domain); the interactions increase KOX1, ZNF268 and ZNF300 nuclear localization activities. The large PER complex involved in the histone methylation is composed of at least PER2, CBX3, TRIM28, SUV39H1 and/or SUV39H2; CBX3 mediates the formation of the complex. Interacts with isoform 2 of ZFP90. Forms a complex with FOXP3 in the presence of isoform 2 of ZFP90.

    Three dimensional structures from OCA and Proteopedia for TRIM28 Gene

    Alternative splice isoforms for TRIM28 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for TRIM28 Gene

Proteomics data for TRIM28 Gene at MOPED

Post-translational modifications for TRIM28 Gene

  • ATM-induced phosphorylation on Ser-824 represses sumoylation leading to the de-repression of expression of a subset of genes involved in cell cycle control and apoptosis in response to genotoxic stress. Dephosphorylation by the phosphatases, PPP1CA and PP1CB forms, allows sumoylation and expression of TRIM28 target genes.
  • Auto-ubiquitinated; enhanced by MAGEA2 and MAGEC2.
  • Citrullinated by PADI4.
  • Sumoylation/desumoylation events regulate TRIM28-mediated transcriptional repression. Sumoylation is required for interaction with CHD3 and SETDB1 and the corepressor activity. Represses and is repressed by Ser-824 phosphorylation. Enhances the TRIM28 corepressor activity, inhibiting transcriptional activity of a number of genes including GADD45A and CDKN1A/p21. Lys-554, Lys-779 and Lys-804 are the major sites of sumoylation. In response to Dox-induced DNA damage, enhanced phosphorylation on Ser-824 prevents sumoylation and allows de-repression of CDKN1A/p21.
  • Modification sites at PhosphoSitePlus
  • Ubiquitination at Lys31, Lys127, Lys213, Lys238, Lys254, Lys261, Lys272, Lys304, Lys319, Lys337, Lys340, Lys366, Lys377, Lys400, Lys407, Lys434, Lys469, Lys750, Lys770, Lys774, and Lys779

Other Protein References for TRIM28 Gene

No data available for DME Specific Peptides for TRIM28 Gene

Domains for TRIM28 Gene

Gene Families for TRIM28 Gene

HGNC:
  • RNF :RING-type (C3HC4) zinc fingers
  • TRIM :Tripartite motif containing / Tripartite motif containing
  • PHF :Zinc fingers, PHD-type
IUPHAR :

UniProtKB/Swiss-Prot:

TIF1B_HUMAN
Domain:
  • The HP1 box is both necessary and sufficient for HP1 binding.:
    • Q13263
  • The PHD-type zinc finger enhances CEBPB transcriptional activity. The PHD-type zinc finger, the HP1 box and the bromo domain, function together to assemble the machinery required for repression of KRAB domain-containing proteins. Acts as an intramolecular SUMO E3 ligase for autosumoylation of bromodomain.:
    • Q13263
  • The RING-finger-B Box-coiled-coil/tripartite motif (RBCC/TRIM motif) is required for interaction with the KRAB domain of KRAB-zinc finger proteins. Binds four zinc ions per molecule. The RING finger and the N-terminal of the leucine zipper alpha helical coiled-coil region of RBCC are required for oligomerization.:
    • Q13263
  • Contains one Pro-Xaa-Val-Xaa-Leu (PxVxL) motif, which is required for interaction with chromoshadow domains. This motif requires additional residues -7, -6, +4 and +5 of the central Val which contact the chromoshadow domain.:
    • Q13263
  • Contains 1 bromo domain.:
    • Q13263
Family:
  • Belongs to the TRIM/RBCC family.:
    • Q13263
Similarity:
  • Contains 2 B box-type zinc fingers.:
    • Q13263
  • Contains 1 PHD-type zinc finger.:
    • Q13263
  • Contains 1 RING-type zinc finger.:
    • Q13263
genes like me logo Genes that share domains with TRIM28: view

Function for TRIM28 Gene

Molecular function for TRIM28 Gene

UniProtKB/Swiss-Prot Function: Nuclear corepressor for KRAB domain-containing zinc finger proteins (KRAB-ZFPs). Mediates gene silencing by recruiting CHD3, a subunit of the nucleosome remodeling and deacetylation (NuRD) complex, and SETDB1 (which specifically methylates histone H3 at Lys-9 (H3K9me)) to the promoter regions of KRAB target genes. Enhances transcriptional repression by coordinating the increase in H3K9me, the decrease in histone H3 Lys-9 and Lys-14 acetylation (H3K9ac and H3K14ac, respectively) and the disposition of HP1 proteins to silence gene expression. Recruitment of SETDB1 induces heterochromatinization. May play a role as a coactivator for CEBPB and NR3C1 in the transcriptional activation of ORM1. Also corepressor for ERBB4. Inhibits E2F1 activity by stimulating E2F1-HDAC1 complex formation and inhibiting E2F1 acetylation. May serve as a partial backup to prevent E2F1-mediated apoptosis in the absence of RB1. Important regulator of CDKN1A/p21(CIP1). Has E3 SUMO-protein ligase activity toward itself via its PHD-type zinc finger. Also specifically sumoylates IRF7, thereby inhibiting its transactivation activity. Ubiquitinates p53/TP53 leading to its proteosomal degradation; the function is enhanced by MAGEC2 and MAGEA2, and possibly MAGEA3 and MAGEA6. Mediates the nuclear localization of KOX1, ZNF268 and ZNF300 transcription factors. In association with isoform 2 of ZFP90, is required for the transcriptional repressor activity of FOXP3 and the suppressive function of regulatory T-cells (Treg) (PubMed:23543754).

Enzyme Numbers (IUBMB) for TRIM28 Gene

Gene Ontology (GO) - Molecular Function for TRIM28 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003677 DNA binding IDA 9016654
GO:0003700 contributes_to sequence-specific DNA binding transcription factor activity ISS --
GO:0003713 transcription coactivator activity IEA --
GO:0003714 transcription corepressor activity IDA 8769649
GO:0004672 protein kinase activity IEA --
genes like me logo Genes that share ontologies with TRIM28: view
genes like me logo Genes that share phenotypes with TRIM28: view

Animal Models for TRIM28 Gene

MGI Knock Outs for TRIM28:

No data available for Transcription Factor Targeting and HOMER Transcription for TRIM28 Gene

Localization for TRIM28 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TRIM28 Gene

Nucleus. Note=Associated with centromeric heterochromatin during cell differentiation through CBX1. {ECO:0000250}.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for TRIM28 Gene COMPARTMENTS Subcellular localization image for TRIM28 gene
Compartment Confidence
nucleus 5
cytosol 2
extracellular 1
plasma membrane 1

Gene Ontology (GO) - Cellular Components for TRIM28 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000785 chromatin --
GO:0005622 intracellular --
GO:0005634 nucleus ISS --
GO:0005654 nucleoplasm TAS --
GO:0005719 nuclear euchromatin IEA --
genes like me logo Genes that share ontologies with TRIM28: view

Pathways for TRIM28 Gene

genes like me logo Genes that share pathways with TRIM28: view

Pathways by source for TRIM28 Gene

UniProtKB/Swiss-Prot Q13263-TIF1B_HUMAN

  • Pathway: Protein modification; protein sumoylation

Gene Ontology (GO) - Biological Process for TRIM28 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IEA --
GO:0001701 in utero embryonic development --
GO:0001837 epithelial to mesenchymal transition ISS --
GO:0006281 DNA repair IDA 17178852
GO:0006367 transcription initiation from RNA polymerase II promoter TAS --
genes like me logo Genes that share ontologies with TRIM28: view

Compounds for TRIM28 Gene

(2) Novoseek inferred chemical compound relationships for TRIM28 Gene

Compound -log(P) Hits PubMed IDs
zinc 65.9 15
retinoic acid 17.9 2
genes like me logo Genes that share compounds with TRIM28: view

Transcripts for TRIM28 Gene

Unigene Clusters for TRIM28 Gene

Tripartite motif containing 28:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for TRIM28 Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4a · 4b ^ 5a · 5b ^ 6a · 6b · 6c ^ 7a · 7b · 7c · 7d ^ 8a · 8b · 8c ^ 9a · 9b ^ 10 ^ 11a · 11b ^ 12 ^ 13a · 13b ^
SP1: - - - - -
SP2: - - - - - - - -
SP3: -
SP4: - - - -
SP5:
SP6: - - - - - - -
SP7: - - - -
SP8: -
SP9:
SP10: - - - - - - - - - - - - - - - -
SP11: - - -
SP12: - -
SP13:
SP14:
SP15:

ExUns: 14a · 14b ^ 15 ^ 16 ^ 17 ^ 18 ^ 19a · 19b ^ 20a · 20b · 20c
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8:
SP9:
SP10: - - - - - - -
SP11:
SP12:
SP13:
SP14:
SP15:

Relevant External Links for TRIM28 Gene

GeneLoc Exon Structure for
TRIM28
ECgene alternative splicing isoforms for
TRIM28

Expression for TRIM28 Gene

mRNA expression in normal human tissues for TRIM28 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, MOPED, and MaxQB for TRIM28 Gene

SOURCE GeneReport for Unigene cluster for TRIM28 Gene Hs.467408

mRNA Expression by UniProt/SwissProt for TRIM28 Gene

Q13263-TIF1B_HUMAN
Tissue specificity: Expressed in all tissues tested including spleen, thymus, prostate, testis, ovary, small intestine, colon and peripheral blood leukocytes.
genes like me logo Genes that share expressions with TRIM28: view

Orthologs for TRIM28 Gene

This gene was present in the common ancestor of animals.

Orthologs for TRIM28 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia TRIM28 37
  • 100 (a)
OneToOne
cow
(Bos Taurus)
Mammalia TRIM28 36
  • 88.3 (n)
  • 96.14 (a)
TRIM28 37
  • 92 (a)
OneToOne
dog
(Canis familiaris)
Mammalia TRIM28 36
  • 89.08 (n)
  • 96.56 (a)
TRIM28 37
  • 96 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Trim28 36
  • 85.61 (n)
  • 93.6 (a)
Trim28 16
Trim28 37
  • 94 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia TRIM28 37
  • 75 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Trim28 36
  • 85.98 (n)
  • 93.48 (a)
chicken
(Gallus gallus)
Aves -- 37
  • 53 (a)
OneToMany
-- 37
  • 58 (a)
OneToMany
lizard
(Anolis carolinensis)
Reptilia TRIM28 37
  • 62 (a)
OneToOne
African clawed frog
(Xenopus laevis)
Amphibia Xl.18843 36
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100489687 36
  • 59.94 (n)
  • 59.52 (a)
Str.3172 36
zebrafish
(Danio rerio)
Actinopterygii trim33l 37
  • 13 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta mei-P26 37
  • 11 (a)
OneToMany
bon 38
  • 28 (a)
worm
(Caenorhabditis elegans)
Secernentea nhl-2 37
  • 12 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.9380 37
  • 25 (a)
OneToMany
Species with no ortholog for TRIM28:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TRIM28 Gene

ENSEMBL:
Gene Tree for TRIM28 (if available)
TreeFam:
Gene Tree for TRIM28 (if available)

Paralogs for TRIM28 Gene

Paralogs for TRIM28 Gene

Pseudogenes.org Pseudogenes for TRIM28 Gene

genes like me logo Genes that share paralogs with TRIM28: view

Variants for TRIM28 Gene

Sequence variations from dbSNP and Humsavar for TRIM28 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type MAF
rs2305121 -- 58,548,126(-) CAAGA(A/G)GCAAA reference, synonymous-codon
rs2305122 -- 58,545,385(-) GTTCC(C/G)ACCCA intron-variant
rs3816329 -- 58,547,326(-) CCCAA(C/T)TCAGG intron-variant
rs3829643 -- 58,547,077(-) CCCCC(C/G)ACCCC intron-variant
rs3842674 -- 58,547,146(-) CTTCT(-/CAACATAGCTGAGAAACACATCCCTTTCTTCTAGCTTCT)AGAGA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for TRIM28 Gene

Variant ID Type Subtype PubMed ID
nsv515731 CNV Gain+Loss 19592680
nsv828657 CNV Gain 20364138
nsv912546 CNV Loss 21882294
dgv4032n71 CNV Loss 21882294

Relevant External Links for TRIM28 Gene

HapMap Linkage Disequilibrium report
TRIM28

Disorders for TRIM28 Gene

(2) Novoseek inferred disease relationships for TRIM28 Gene

Disease -log(P) Hits PubMed IDs
carcinoma embryonal 48.5 1
tumors 3.6 1
genes like me logo Genes that share disorders with TRIM28: view

No data available for UniProtKB/Swiss-Prot for TRIM28 Gene

Publications for TRIM28 Gene

  1. Solution structure of the PHD domain from the KAP-1 corepressor: structural determinants for PHD, RING and LIM zinc-binding domains. (PMID: 11226167) Capili A.D. … Borden K.L. (EMBO J. 2001) 2 3 4 23
  2. SETDB1: a novel KAP-1-associated histone H3, lysine 9-specific methyltransferase that contributes to HP1-mediated silencing of euchromatic genes by KRAB zinc-finger proteins. (PMID: 11959841) Schultz D.C. … Rauscher F.J. III (Genes Dev. 2002) 3 4 23
  3. Transcriptional repression by RING finger protein TIF1 beta that interacts with the KRAB repressor domain of KOX1. (PMID: 9016654) Moosmann P.R. … Schaffner W. (Nucleic Acids Res. 1996) 3 4 23
  4. KAP-1 corepressor protein interacts and colocalizes with heterochromatic and euchromatic HP1 proteins: a potential role for Kruppel-associated box-zinc finger proteins in heterochromatin- mediated gene silencing. (PMID: 10330177) Ryan R.F. … Rauscher F.J. III (Mol. Cell. Biol. 1999) 3 4 23
  5. Two novel Kruppel-associated box-containing zinc-finger proteins, KRAZ1 and KRAZ2, repress transcription through functional interaction with the corepressor KAP-1 (TIF1beta/KRIP-1). (PMID: 10347202) Agata Y. … Shimizu A. (J. Biol. Chem. 1999) 3 4 23

Products for TRIM28 Gene

Sources for TRIM28 Gene

Back to Top

Content