Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



TRAFD1 Gene

protein-coding   GIFtS: 50
GCID: GC12P112563

TRAF-Type Zinc Finger Domain Containing 1

Microbiology & Infectious Diseases Congress
  Search for TRAFD1
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
TRAF-Type Zinc Finger Domain Containing 11 2
FLN292 3 5
FLN29 Gene Product2
TRAF-Type Zinc Finger Domain-Containing Protein 12
Protein FLN293

External Ids:    HGNC: 248081   Entrez Gene: 109062   Ensembl: ENSG000001351487   OMIM: 6131975   UniProtKB: O145453   

Export aliases for TRAFD1 gene to outside databases

Previous GC identifers: GC12P111027 GC12P109576


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for TRAFD1 Gene:
The innate immune system confers host defense against viral and microbial infection, and TRAFD1 is a negative
feedback regulator that controls excessive immune responses (Sanada et al., 2008 (PubMed 18849341)).(supplied by
OMIM, Dec 2009)

GeneCards Summary for TRAFD1 Gene:
TRAFD1 (TRAF-type zinc finger domain containing 1) is a protein-coding gene. An important paralog of this gene is XAF1.

UniProtKB/Swiss-Prot: TRAD1_HUMAN, O14545
Function: Negative feedback regulator that controls excessive innate immune responses. Regulates both Toll-like
receptor 4 (TLR4) and DDX58/RIG1-like helicases (RLH) pathways. May inhibit the LTR pathway by direct interaction
with TRAF6 and attenuation of NF-kappa-B activation. May negatively regulate the RLH pathway downstream from MAVS
and upstream of NF-kappa-B and IRF3 (By similarity)

Gene Wiki entry for TRAFD1 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000012.12  NC_018923.2  NT_029419.13  
Regulatory elements:
   Regulatory transcription factor binding sites in the TRAFD1 gene promoter:
         STAT1   p53   Sp1   Brachyury   HTF   FOXO3   NF-kappaB   FOXO3b   FOXO3a   NF-kappaB1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidTRAFD1 promoter sequence
   Search Chromatin IP Primers for TRAFD1

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat TRAFD1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 12q   Ensembl cytogenetic band:  12q24.13   HGNC cytogenetic band: 12q24.13

TRAFD1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TRAFD1 gene location

GeneLoc information about chromosome 12         GeneLoc Exon Structure

GeneLoc location for GC12P112563:  view genomic region     (about GC identifiers)

Start:
112,563,305 bp from pter      End:
112,591,408 bp from pter
Size:
28,104 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: TRAD1_HUMAN, O14545 (See protein sequence)
Recommended Name: TRAF-type zinc finger domain-containing protein 1  
Size: 582 amino acids; 64841 Da
Subunit: Interacts with MAVS, TICAM1, TRAF1, TRAF2, TRAF3 (By similarity). Interacts with TRAF6
1 PDB 3D structure from and Proteopedia for TRAFD1:
2D9K (3D)    
Secondary accessions: A8K5L6

Explore the universe of human proteins at neXtProt for TRAFD1: NX_O14545

Explore proteomics data for TRAFD1 at MOPED

Post-translational modifications: 

  • Ubiquitination2 at Lys283, Lys485
  • Modification sites at PhosphoSitePlus

  • See TRAFD1 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (2 alternative transcripts): 
    NP_001137378.1  NP_006691.1  

    ENSEMBL proteins: 
     ENSP00000396526   ENSP00000449319   ENSP00000449297   ENSP00000473800   ENSP00000447340  
     ENSP00000450357   ENSP00000257604  

    TRAFD1 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for TRAFD1
    OriGene Protein Over-expression Lysate for TRAFD1
    OriGene MassSpec for TRAFD1
    OriGene Custom Protein Services for TRAFD1
    GenScript Custom Purified and Recombinant Proteins Services for TRAFD1
    Novus Biologicals TRAFD1 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for TRAFD1

    TRAFD1 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for TRAFD1
    Novus Biologicals TRAFD1 Antibodies
    Abcam antibodies for TRAFD1
    Cloud-Clone Corp. Antibodies for TRAFD1
    ThermoFisher Antibody for TRAFD1
    LSBio Antibodies in human, mouse, rat for TRAFD1

    TRAFD1 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for TRAFD1
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for TRAFD1
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for TRAFD1
    Cloud-Clone Corp. CLIAs for TRAFD1


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    1 InterPro protein domain:
     IPR015880 Znf_C2H2-like

    Graphical View of Domain Structure for InterPro Entry O14545

    ProtoNet protein and cluster: O14545

    UniProtKB/Swiss-Prot: TRAD1_HUMAN, O14545
    Similarity: Contains 1 TRAF-type zinc finger


    TRAFD1 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: TRAD1_HUMAN, O14545
    Function: Negative feedback regulator that controls excessive innate immune responses. Regulates both Toll-like
    receptor 4 (TLR4) and DDX58/RIG1-like helicases (RLH) pathways. May inhibit the LTR pathway by direct interaction
    with TRAF6 and attenuation of NF-kappa-B activation. May negatively regulate the RLH pathway downstream from MAVS
    and upstream of NF-kappa-B and IRF3 (By similarity)

         Gene Ontology (GO): 2 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005515protein binding IPI17500595
    GO:0046872metal ion binding IEA--
         
    TRAFD1 for ontologies           About GeneDecksing


    Phenotypes:
         5 MGI mutant phenotypes (inferred from 2 alleles(MGI details for Trafd1):
     growth/size/body  homeostasis/metabolism  immune system  mortality/aging  skeleton 

    TRAFD1 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-out Trafd1tm1Ayos for TRAFD1

       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for TRAFD1
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for TRAFD1

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for TRAFD1
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for TRAFD1

    miRNA
    Products:
        
    miRTarBase miRNAs that target TRAFD1:
    hsa-mir-615-3p (MIRT039607), hsa-mir-26b-5p (MIRT029570), hsa-mir-335-5p (MIRT018198), hsa-mir-378a-3p (MIRT043867), hsa-mir-324-5p (MIRT043116), hsa-mir-92b-3p (MIRT040555)

    Block miRNA regulation of human, mouse, rat TRAFD1 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate TRAFD1 (see all 25):
    hsa-miR-34b* hsa-miR-193a-3p hsa-miR-302d hsa-miR-520e hsa-miR-29c hsa-miR-29a hsa-miR-624 hsa-miR-302e
    SwitchGear 3'UTR luciferase reporter plasmidTRAFD1 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for TRAFD1
    Predesigned siRNA for gene silencing in human, mouse, rat TRAFD1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for TRAFD1

    Clone
    Products:
         
    OriGene clones in human, mouse for TRAFD1 (see all 11)
    OriGene ORF clones in mouse, rat for TRAFD1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): TRAFD1 (NM_001143906)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TRAFD1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TRAFD1

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for TRAFD1
    Browse ESI BIO Cell Lines and PureStem Progenitors for TRAFD1 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TRAFD1


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    cytosol2
    nucleus2
    plasma membrane1

    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus



        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for TRAFD1
    Interactions:

        Search GeneGlobe Interaction Network for TRAFD1

    STRING Interaction Network Preview (showing 3 interactants - click image to see more details)

    Selected Interacting proteins for TRAFD1 (O145453 ENSP000002576044) via UniProtKB, MINT, STRING, and/or I2D (see all 8)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    UBCP0CG483, ENSP000003448184I2D: score=1 STRING: ENSP00000344818
    TRAF1Q130773, ENSP000003629944I2D: score=2 STRING: ENSP00000362994
    TRAF6Q9Y4K33I2D: score=5 
    MAVSQ7Z4343I2D: score=1 
    TICAM1Q8IUC63I2D: score=1 
    About this table

    Gene Ontology (GO): 2 biological process terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0034097response to cytokine IEA--
    GO:0045824negative regulation of innate immune response ISS--

    TRAFD1 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for TRAFD1 (TRAD1)



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for TRAFD1 gene (2 alternative transcripts): 
    NM_001143906.1  NM_006700.2  

    Unigene Cluster for TRAFD1:

    TRAF-type zinc finger domain containing 1
    Hs.5148  [show with all ESTs]
    Unigene Representative Sequence: NM_001143906
    9 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000412615(uc010syj.1) ENST00000550051(uc009zwb.2) ENST00000549358
    ENST00000547063 ENST00000548092 ENST00000552890 ENST00000552896 ENST00000548277
    ENST00000257604(uc001ttp.3 uc001tto.3)
    Congresses - knowledge worth sharing:
    European Congress of Clinical Microbiology and Infectious Diseases (ECCMID) 10 - 13 May 2014

    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat TRAFD1 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate TRAFD1 (see all 25):
    hsa-miR-34b* hsa-miR-193a-3p hsa-miR-302d hsa-miR-520e hsa-miR-29c hsa-miR-29a hsa-miR-624 hsa-miR-302e
    SwitchGear 3'UTR luciferase reporter plasmidTRAFD1 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for TRAFD1
    Predesigned siRNA for gene silencing in human, mouse, rat TRAFD1
    Clone
    Products:
         
    OriGene clones in human, mouse for TRAFD1 (see all 11)
    OriGene ORF clones in mouse, rat for TRAFD1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): TRAFD1 (NM_001143906)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TRAFD1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TRAFD1
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for TRAFD1
    OriGene qSTAR qPCR primer pairs in human, mouse for TRAFD1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TRAFD1
      QuantiTect SYBR Green Assays in human, mouse, rat TRAFD1
      QuantiFast Probe-based Assays in human, mouse, rat TRAFD1

    Additional mRNA sequence: 

    AB007447.1 AK122620.1 AK291331.1 AK295474.1 AK309916.1 AK312601.1 BC003553.2 

    9 DOTS entries:

    DT.454505  DT.101982188  DT.75159256  DT.100030051  DT.95132209  DT.91847488  DT.100786057  DT.86853826 
    DT.121175128 

    Selected AceView cDNA sequences (see all 334):

    BQ651979 BM928806 BQ019805 BF974261 T35623 BM982814 AI751573 BC003553 
    BE501101 CR596482 BU859361 BU729209 AW243061 AA576571 AI266138 BQ691670 
    BI064313 BQ954677 BQ648806 BQ675074 AW452353 AU132262 F05776 BQ052259 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for TRAFD1 (see all 6)    About this scheme

    ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8a · 8b · 8c · 8d ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15
    SP1:              -           -                 -                       -                                             
    SP2:                          -                 -                       -                                             
    SP3:              -           -                                                                                       
    SP4:              -                             -                                                                     
    SP5:                          -                 -                                                                     


    ECgene alternative splicing isoforms for TRAFD1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    TRAFD1 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: --
    TRAFD1 Expression
    About this image


    TRAFD1 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 3) fully expand
     
     Ovary (Reproductive System)
             Secondary Oocyte Antral Follicle
     
     Gonad
             Secondary Oocyte Antral Follicle
     
     Testis (Reproductive System)
    TRAFD1 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    TRAFD1 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.5148
        Custom PCR Arrays for TRAFD1
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for TRAFD1
    OriGene qSTAR qPCR primer pairs in human, mouse for TRAFD1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TRAFD1
    QuantiTect SYBR Green Assays in human, mouse, rat TRAFD1
    QuantiFast Probe-based Assays in human, mouse, rat TRAFD1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TRAFD1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of chordates.

    Orthologs for TRAFD1 gene from Selected species (see all 10)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Trafd11 , 5 TRAF type zinc finger domain containing 11, 5 81.16(n)1
    76.35(a)1
      5 (61.78 cM)5
    2317121  NM_001163470.11  NP_001156942.11 
     1213717255 
    chicken
    (Gallus gallus)
    Aves TRAFD11 TRAF-type zinc finger domain containing 1 58.13(n)
    49.47(a)
      416884  NM_001006191.1  NP_001006191.1 
    lizard
    (Anolis carolinensis)
    Reptilia TRAFD16
    TRAF-type zinc finger domain containing 1
    33(a)
    1 ↔ 1
    GL343282.1(151165-182823)
    zebrafish
    (Danio rerio)
    Actinopterygii zgc:1622281 zgc:162228 51.92(n)
    43.51(a)
      100037363  NM_001089515.1  NP_001082984.1 


    ENSEMBL Gene Tree for TRAFD1 (if available)
    TreeFam Gene Tree for TRAFD1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for TRAFD1 gene
    XAF12  
    2 SIMAP similar genes for TRAFD1 using alignment to 7 protein entries:     TRAD1_HUMAN (see all proteins):
    TRAF3    XAF1

    TRAFD1 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for TRAFD1 (see all 473)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 12 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1848499461,2
    --112561415(+) GTGCTA/GGGATT 2 -- us2k10--------
    rs1887752401,2
    --112561818(+) TCCATC/TTGTGT 2 -- us2k10--------
    rs1920855461,2
    --112561943(+) ATTTTC/TCCTGG 2 -- us2k10--------
    rs1382310251,2
    C--112561949(+) CCTGGC/TTTTAA 2 -- us2k10--------
    rs1495825641,2
    C--112561960(+) ACTTTA/CTATGT 2 -- us2k10--------
    rs1846824501,2
    --112562220(+) ATGTTA/GGCCAG 2 -- us2k10--------
    rs596475571,2
    C--112562410(+) ATTAT-/ATTAT/ATTATATTAT/ATT
    ATATTATATTATATTATATTAT
    TTTTG
    2 -- us2k11NA 2
    rs580478101,2
    C,F--112562486(+) TGCCTC/ACTGGG 2 -- us2k18Minor allele frequency- A:0.24NA WA CSA EA 366
    rs749969951,2
    --112562581(+) TTTGTA/GGAGAT 2 -- us2k10--------
    rs1394545621,2
    C--112562709(+) GTATT-/GTTTGTAATATGTGCTTGGT
    TATACTTATATAATTATAAGTTG
    GTTTG
    2 -- us2k10--------

    HapMap Linkage Disequilibrium report for TRAFD1 (112563305 - 112591408 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 1 variation for TRAFD1:    About this table    
    Variant IDTypeSubtypePubMed ID
    nsv483114CNV Gain15286789

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing TRAFD1
    DNA2.0 Custom Variant and Variant Library Synthesis for TRAFD1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 613197    OMIM disorders: --


    TRAFD1 for disorders           About GeneDecksing

    Genetic Association Database (GAD): TRAFD1

    Export disorders for TRAFD1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for TRAFD1 gene, integrated from 10 sources (see all 38):
    (articles sorted by number of sources associating them with TRAFD1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Multiple loci influence erythrocyte phenotypes in the CHARGE Consortium. (PubMed id 19862010)1, 4 Ganesh S.K....Lin J.P. (Nat. Genet. 2009)
    2. Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (PubMed id 17554300)1, 4 (Nature 2007)
    3. A probability-based approach for high-throughput protein phosphorylation analysis and site localization. (PubMed id 16964243)1, 2 Beausoleil S.A.... Gygi S.P. (Nat. Biotechnol. 2006)
    4. Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. (PubMed id 17081983)1, 2 Olsen J.V....Mann M. (Cell 2006)
    5. FLN29, a novel interferon- and LPS-inducible gene acting as a negative regulator of toll-like receptor signaling. (PubMed id 16221674)1, 2 Mashima R.... Yoshimura A. (J. Biol. Chem. 2005)
    6. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    7. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1, 3 Strausberg R.L....Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002)
    8. Interlaboratory reproducibility of large-scale human protein-complex analysis by standardized AP-MS. (PubMed id 23455922)1 Varjosalo M....Superti-Furga G. (Nat. Methods 2013)
    9. Development and application of a DNA microarray-based yeast two-hybrid system. (PubMed id 23275563)1 Suter B....Wanker E.E. (Nucleic Acids Res. 2013)
    10. The protein interaction landscape of the human CMGC kinase group. (PubMed id 23602568)1 Varjosalo M....Gstaiger M. (Cell Rep 2013)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 10906 HGNC: 24808 AceView: FLN29 Ensembl:ENSG00000135148 euGenes: HUgn10906
    ECgene: TRAFD1 H-InvDB: TRAFD1

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for TRAFD1 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for TRAFD1 gene:
    Search GeneIP for patents involving TRAFD1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for TRAFD1  
     OriGene qPCR primer pairs and template standards for TRAFD1   OriGene Protein Over-expression Lysate for TRAFD1  
     OriGene MassSpec something-or-other for TRAFD1   OriGene clones in human, mouse for TRAFD1  
     OriGene qSTAR qPCR primer pairs in human, mouse for TRAFD1   OriGene Purified Protein for TRAFD1  
     OriGene ORF clones in mouse, rat for TRAFD1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for TRAFD1   OriGene Custom Protein Services for TRAFD1  

     
     
     Block miRNA regulation of human, mouse, rat TRAFD1 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing TRAFD1
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat TRAFD1 Predesigned siRNA for gene silencing in human, mouse, rat TRAFD1
     QuantiFast Probe-based Assays in human, mouse, rat TRAFD1 QuantiTect SYBR Green Assays in human, mouse, rat TRAFD1
     Custom PCR Arrays for TRAFD1 Search Chromatin IP Primers for TRAFD1
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TRAFD1  Search GeneGlobe Interaction Network for TRAFD1
     Regulatory tfbs in TRAFD1 promoter
     GenScript Custom Purified and Recombinant Proteins Services for TRAFD1 GenScript cDNA clones with any tag delivered in your preferred vector for TRAFD1
     GenScript Custom Assay Services for TRAFD1 GenScript Custom overexpressing Cell Line Services for TRAFD1
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for TRAFD1 (TRAD1)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     TRAFD1 antibodies
     TRAFD1 lysates
     Antibodies for TRAFD1
     See all of Abcam's Antibodies, Kits and Proteins for TRAFD1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for TRAFD1
     Antibodies for TRAFD1
     ELISAs for TRAFD1
     CLIAs for TRAFD1



     Browse ESI BIO Cell Lines and PureStem Progenitors for TRAFD1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TRAFD1
     SwitchGear 3'UTR luciferase reporter plasmids for TRAFD1
     SwitchGear Promoter luciferase reporter plasmids for TRAFD1
     ThermoFisher Antibody for TRAFD1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TRAFD1
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for TRAFD1
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for TRAFD1
     LSBio Antibodies in human, mouse, rat for TRAFD1
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      TRAFD1 gene at Home site.
    Version: 3.12.142 28 July 2014
    hostname: 356977-web1.xennexinc.com index build: 126 solr: 1.4