Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

TRAFD1 Gene

protein-coding   GIFtS: 46
GCID: GC12P112563

TRAF-type zinc finger domain containing 1

  Search for TRAFD1
in our new
 Human Malady Compendium 
Biological research products
for TRAFD1
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
TRAF-Type Zinc Finger Domain Containing 11 2
FLN291 2 3 5
FLN29 Gene Product2
TRAF-Type Zinc Finger Domain-Containing Protein 12
Protein FLN293

External Ids:    HGNC: 248081   Entrez Gene: 109062   Ensembl: ENSG000001351487   OMIM: 6131975   UniProtKB: O145453   

Export aliases for TRAFD1 gene to outside databases

Previous GC identifers: GC12P111027 GC12P109576


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for TRAFD1:
The innate immune system confers host defense against viral and microbial infection, and TRAFD1 is a negative feedback
regulator that controls excessive immune responses (Sanada et al., 2008 (PubMed 18849341)).(supplied by OMIM, Dec
2009)

UniProtKB/Swiss-Prot: TRAD1_HUMAN, O14545
Function: Negative feedback regulator that controls excessive innate immune responses. Regulates both Toll-like
receptor 4 (TLR4) and DDX58/RIG1-like helicases (RLH) pathways. May inhibit the LTR pathway by direct interaction with
TRAF6 and attenuation of NF-kappa-B activation. May negatively regulate the RLH pathway downstream from MAVS and
upstream of NF-kappa-B and IRF3 (By similarity)

Gene Wiki entry for TRAFD1


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000012.11  NC_018923.1  NT_009775.17  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the TRAFD1 gene promoter:
         STAT1   p53   Sp1   Brachyury   HTF   FOXO3   NF-kappaB   FOXO3b   FOXO3a   NF-kappaB1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidTRAFD1 promoter sequence
   Search SABiosciences Chromatin IP Primers for TRAFD1

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TRAFD1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 12q   Ensembl cytogenetic band:  12q24.13   HGNC cytogenetic band: 12q24.13

TRAFD1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TRAFD1 gene location

GeneLoc information about chromosome 12         GeneLoc Exon Structure

GeneLoc location for GC12P112563:  view genomic region     (about GC identifiers)

Start:
112,563,305 bp from pter      End:
112,591,408 bp from pter
Size:
28,104 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: TRAD1_HUMAN, O14545 (See protein sequence)
Recommended Name: TRAF-type zinc finger domain-containing protein 1  
Size: 582 amino acids; 64841 Da
Subunit: Interacts with MAVS, TICAM1, TRAF1, TRAF2, TRAF3 (By similarity). Interacts with TRAF6
1 PDB 3D structure from and Proteopedia for TRAFD1:
2D9K (3D)    
Secondary accessions: A8K5L6

Explore the universe of human proteins at neXtProt for TRAFD1: NX_O14545

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_O14545

  • TRAFD1 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins (2 alternative transcripts): 
    NP_001137378.1  NP_006691.1  

    ENSEMBL proteins: 
     ENSP00000396526   ENSP00000449319   ENSP00000449297   ENSP00000447340   ENSP00000450357  
     ENSP00000449098   ENSP00000257604  

    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein: TRAFD1
    OriGene Protein Over-expression Lysate (see all 2): TRAFD1
    OriGene Custom Protein Services for TRAFD1 
    GenScript Custom Purified and Recombinant Proteins Services for TRAFD1
    Novus Biologicals TRAFD1 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for TRAFD1

    Gene Ontology (GO): 1 cellular component term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005622intracellular IEA--


    TRAFD1 for ontologies           About GeneDecksing



    TRAFD1 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for TRAFD1 
    GenScript Custom Superior Antibodies Services for TRAFD1
    Novus Biologicals TRAFD1 Antibodies
    Search for Antibodies for TRAFD1 at Abcam  
    Uscn Antibodies for TRAFD1
    Search ThermoFisher Antibodies for TRAFD1

    Assay Products for TRAFD1: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for TRAFD1
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for TRAFD1


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TRAFD1 for domains           About GeneDecksing

    1 InterPro domain/family:
     IPR015880 Znf_C2H2-like

    Graphical View of Domain Structure for InterPro Entry O14545

    ProtoNet protein and cluster: O14545

    UniProtKB/Swiss-Prot: TRAD1_HUMAN, O14545
    Similarity: Contains 1 TRAF-type zinc finger


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: TRAD1_HUMAN, O14545
    Function: Negative feedback regulator that controls excessive innate immune responses. Regulates both Toll-like
    receptor 4 (TLR4) and DDX58/RIG1-like helicases (RLH) pathways. May inhibit the LTR pathway by direct interaction with
    TRAF6 and attenuation of NF-kappa-B activation. May negatively regulate the RLH pathway downstream from MAVS and
    upstream of NF-kappa-B and IRF3 (By similarity)

    miRNA
    Products:
        
    OriGene 3'-UTR Clone (see all 2): TRAFD1
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TRAFD1
    8/25 QIAGEN miScript miRNA Assays for microRNAs that regulate TRAFD1 (see all 25):
    hsa-miR-34b* hsa-miR-193a-3p hsa-miR-302d hsa-miR-520e hsa-miR-29c hsa-miR-29a hsa-miR-624 hsa-miR-302e
    SwitchGear 3'UTR luciferase reporter plasmidTRAFD1 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TRAFD1 (see all 7)
    OriGene shRNA RFP: TRAFD1
    OriGene siRNA: TRAFD1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TRAFD1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for TRAFD1

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TRAFD1 (see all 5)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TRAFD1 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 2): TRAFD1 (NM_001143906)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TRAFD1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TRAFD1 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for TRAFD1
    Search LifeMap BioReagents cell lines for TRAFD1

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TRAFD1

    Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005515protein binding ----
    GO:0008270zinc ion binding IEA--


    TRAFD1 for ontologies           About GeneDecksing


    Animal Models:
         Mouse knock-out Trafd1tm1Ayos for TRAFD1
         5 MGI mutant phenotypes (inferred from 2 alleles(MGI details for Trafd1):
     growth/size  homeostasis/metabolism  immune system  mortality/aging  skeleton 

    TRAFD1 for phenotypes           About GeneDecksing


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for TRAFD1

    STRING Interaction Network Preview (showing 3 interactants - click image to see more details)

    5/8 Interacting proteins for TRAFD1 (O145453 ENSP000002576044) via UniProtKB, MINT, STRING, and/or I2D (see all 8)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    UBCP0CG483, ENSP000003448184I2D: score=1 STRING: ENSP00000344818
    TRAF1Q130773, ENSP000003629944I2D: score=2 STRING: ENSP00000362994
    TRAF6Q9Y4K33I2D: score=5 
    MAVSQ7Z4343I2D: score=1 
    TICAM1Q8IUC63I2D: score=1 
    About this table

    Gene Ontology (GO): 2 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0034097response to cytokine stimulus IEA--
    GO:0045824negative regulation of innate immune response ISS--


    TRAFD1 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for TRAFD1
    Search CenterWatch for drugs/clinical trials and news about TRAFD1 / TRAD1 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for TRAFD1 gene (2 alternative transcripts): 
    NM_001143906.1  NM_006700.2  

    Unigene Cluster for TRAFD1:

    TRAF-type zinc finger domain containing 1
    Hs.5148  [show with all ESTs]
    Unigene Representative Sequence: NM_001143906
    9 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000412615(uc010syj.1) ENST00000550051(uc009zwb.2) ENST00000549358
    ENST00000547063 ENST00000548092 ENST00000552890 ENST00000552896 ENST00000548277
    ENST00000257604(uc001ttp.3 uc001tto.3)

    miRNA
    Products:
         
    OriGene 3'-UTR Clone (see all 2): TRAFD1
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TRAFD1
    8/25 QIAGEN miScript miRNA Assays for microRNAs that regulate TRAFD1 (see all 25):
    hsa-miR-34b* hsa-miR-193a-3p hsa-miR-302d hsa-miR-520e hsa-miR-29c hsa-miR-29a hsa-miR-624 hsa-miR-302e
    SwitchGear 3'UTR luciferase reporter plasmidTRAFD1 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TRAFD1 (see all 7)
    OriGene shRNA RFP: TRAFD1
    OriGene siRNA: TRAFD1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TRAFD1
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TRAFD1 (see all 5)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TRAFD1 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 2): TRAFD1 (NM_001143906)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TRAFD1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TRAFD1 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TRAFD1
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TRAFD1
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TRAFD1
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TRAFD1

    Additional cDNA sequence: 

    AB007447.1 AK122620.1 AK291331.1 AK295474.1 AK309916.1 AK312601.1 BC003553.2 

    9 DOTS entries:

    DT.454505  DT.101982188  DT.75159256  DT.100030051  DT.95132209  DT.91847488  DT.100786057  DT.86853826 
    DT.121175128 

    24/334 AceView cDNA sequences (see all 334):

    BQ231155 AW452353 BQ709625 BM855746 BM803629 N29133 CA307340 BF974261 
    AI637612 F05776 AI924861 CA314188 AI751573 BU729209 BQ961437 AI961198 
    BQ059382 T35623 BX283270 BQ880437 CR596482 BF059652 AU132262 BI064313 

    GeneLoc Exon Structure

    5/6 Alternative Splicing Database (ASD) splice patterns (SP) for TRAFD1 (see all 6)    About this scheme

    ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8a · 8b · 8c · 8d ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15
    SP1:              -           -                 -                       -                                             
    SP2:                          -                 -                       -                                             
    SP3:              -           -                                                                                       
    SP4:              -                             -                                                                     
    SP5:                          -                 -                                                                     


    ECgene alternative splicing isoforms for TRAFD1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TRAFD1 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: --

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image

    TRAFD1 expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table
    1 LifeMap In Vivo Development Anatomical Compartment/Cell 
    Tissue Anatomical Compartment CellCategory (developmental path)
    OvaryAntral FollicleSecondary OocyteFemale Gametocytes, Germ Cells
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization

    See TRAFD1 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for TRAFD1

    SOURCE GeneReport for Unigene cluster: Hs.5148
        SABiosciences Custom PCR Arrays for TRAFD1
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TRAFD1
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TRAFD1
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TRAFD1
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TRAFD1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TRAFD1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for TRAFD1 gene from 6/14 species (see all 14)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Trafd11 , 5 TRAF type zinc finger domain containing 11, 5 81.26(n)1
    76.55(a)1
      5 (61.78 cM)5
    2317121  NM_001163470.11  NP_001156942.11 
     1213717255 
    chicken
    (Gallus gallus)
    Aves TRAFD11 TRAF-type zinc finger domain containing 1 57.65(n)
    48.75(a)
      416884  NM_001006191.1  NP_001006191.1 
    lizard
    (Anolis carolinensis)
    Reptilia TRAFD16
    --
    39(a)
    1 ↔ 1
    GL343282.1(165540-176250)
    zebrafish
    (Danio rerio)
    Actinopterygii zgc:1622281 zgc:162228 51.32(n)
    42.69(a)
      100037363  NM_001089515.1  NP_001082984.1 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons AT1G099201 TRAF-type zinc finger-related protein 45.52(n)
    32.84(a)
      837524  NM_100866.4  NP_563857.1 
    rice
    (Oryza sativa)
    Liliopsida Os07g06575001 hypothetical protein 47.08(n)
    36.84(a)
      4344157  NM_001067048.1  NP_001060513.1 


    ENSEMBL Gene Tree for TRAFD1 (if available)
    TreeFam Gene Tree for TRAFD1 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for TRAFD1 gene
    XAF12  
    1 SIMAP similar gene for TRAFD1 using alignment to 7 protein entries:     TRAD1_HUMAN (see all proteins):
    XAF1

    TRAFD1 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/363 NCBI SNPs in TRAFD1 are shown (see all 363    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 12 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1848499461,2
    --112561415(+) GTGCTA/GGGATT 2 -- us2k10--------
    rs1887752401,2
    --112561818(+) TCCATC/TTGTGT 2 -- us2k10--------
    rs1920855461,2
    --112561943(+) ATTTTC/TCCTGG 2 -- us2k10--------
    rs1382310251,2
    --112561949(+) CCTGGC/TTTTAA 2 -- us2k10--------
    rs1495825641,2
    --112561960(+) ACTTTA/CTATGT 2 -- us2k10--------
    rs1846824501,2
    --112562220(+) ATGTTA/GGCCAG 2 -- us2k10--------
    rs580478101,2
    C,F,--112562486(+) TGCCTC/ACTGGG 2 -- us2k18Minor allele frequency- A:0.24NA WA CSA EA 366
    rs749969951,2
    --112562581(+) TTTGTA/GGAGAT 2 -- us2k10--------
    rs1394545621,2
    --112562709(+) GTATT-/GTTTGTAATATGTGCTTGGT
    TATACTTATATAATTATAAGTTG
    GTTTG
    2 -- us2k10--------
    rs1394204751,2
    --112562751(+) AGTTG-/CT    
       GTATT
    GTTTG
    2 -- us2k10--------

    HapMap Linkage Disequilibrium report for TRAFD1 (112563305 - 112591408 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 1 variation for TRAFD1
         1 CNV: 0166

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing TRAFD1
    DNA2.0 Custom Variant and Variant Library Synthesis for TRAFD1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TRAFD1 for disorders           About MalaCards

    TRAFD1 for disorders           About GeneDecksing

    OMIM gene information: 613197    OMIM disorders: --


    Export disorders for TRAFD1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for TRAFD1 gene, integrated from 9 sources (see all 28):
    (articles sorted by number of sources associating them with TRAFD1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. A probability-based approach for high-throughput protein phosphorylation analysis and site localization. (PubMed id 16964243)1, 2 Beausoleil S.A.... Gygi S.P. (2006)
    2. Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. (PubMed id 17081983)1, 2 Olsen J.V....Mann M. (2006)
    3. FLN29, a novel interferon- and LPS-inducible gene acting as a negative regulator of toll-like receptor signaling. (PubMed id 16221674)1, 2 Mashima R.... Yoshimura A. (2005)
    4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    5. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1, 3 Strausberg R.L....Marra M.A. (2002)
    6. Methods for quantification of in vivo changes in prote in ubiquitination following proteasome and deubiquitinase inhibition. (PubMed id 22505724)1 Udeshi N.D....Carr S.A. (2012)
    7. Proteomic dissection of the von Hippel-Lindau (VHL) i nteractome. (PubMed id 21942715)1 Lai Y....Shiio Y. (2011)
    8. Initial characterization of the human central proteome. (PubMed id 21269460)2 Burkard T.R.... Colinge J. (2011)
    9. A proteome-wide, quantitative survey of in vivo ubiqui tylation sites reveals widespread regulatory roles. (PubMed id 21890473)1 Wagner S.A....Choudhary C. (2011)
    10. Systematic and quantitative assessment of the ubiquiti n-modified proteome. (PubMed id 21906983)1 Kim W....Gygi S.P. (2011)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 10906 HGNC: 24808 AceView: FLN29 Ensembl:ENSG00000135148 euGenes: HUgn10906
    ECgene: TRAFD1 H-InvDB: TRAFD1

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for TRAFD1 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for TRAFD1 gene:
    Search GeneIP for patents involving TRAFD1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for TRAFD1  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TRAFD1   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TRAFD1  
     OriGene Protein Over-expression Lysate for TRAFD1   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for TRAFD1   OriGene 3'-UTR Clone for TRAFD1  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TRAFD1   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TRAFD1  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for TRAFD1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for TRAFD1   OriGene Custom Protein Services for TRAFD1  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat TRAFD1
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing TRAFD1
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TRAFD1
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TRAFD1
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TRAFD1
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TRAFD1
     GenScript Custom Purified and Recombinant Proteins Services for TRAFD1 GenScript cDNA clones with any tag delivered in your preferred vector for TRAFD1
     GenScript Custom Assay Services for TRAFD1 GenScript Custom Superior Antibodies Services for TRAFD1
     GenScript Custom overexpressing Cell Line Services for TRAFD1 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in TRAFD1 promoter
     Search Chromatin IP Primers for TRAFD1
     RT2 qPCR Primer Assay in human, mouse, rat TRAFD1
     Search GNC Networks for TRAFD1
     SABiosciences Custom PCR Arrays for TRAFD1
     Search Tocris compounds for TRAFD1
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     TRAFD1 antibodies
     TRAFD1 lysates
     Search for Antibodies for TRAFD1 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for TRAFD1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     TRAFD1 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for TRAFD1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TRAFD1
     SwitchGear 3'UTR luciferase reporter plasmids for TRAFD1
     SwitchGear Promoter luciferase reporter plasmids for TRAFD1
     Search ThermoFisher Antibodies for TRAFD1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TRAFD1
           
    GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      TRAFD1 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4