Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

TRAFD1 Gene

protein-coding GIFtS: 46
GCID: GC12P112563

TRAF-type zinc finger domain containing 1

Search for TRAFD1
in

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

Aliases
TRAF-Type Zinc Finger Domain Containing 1¹ ²
FLN29¹ ² ³ ⁵
FLN29 Gene Product²
TRAF-Type Zinc Finger Domain-Containing Protein 1²
Protein FLN29³

External Ids:	HGNC: 24808¹	Entrez Gene: 10906²	Ensembl: ENSG00000135148⁷	OMIM: 613197⁵	UniProtKB: O14545³

Export aliases for TRAFD1 gene to outside databases

Previous GC identifers: GC12P111027 GC12P109576

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for TRAFD1:

The innate immune system confers host defense against viral and microbial infection, and TRAFD1 is a negative feedback

regulator that controls excessive immune responses (Sanada et al., 2008 (PubMed 18849341)).(supplied by OMIM, Dec

2009)

UniProtKB/Swiss-Prot: TRAD1_HUMAN, O14545

Function: Negative feedback regulator that controls excessive innate immune responses. Regulates both Toll-like

receptor 4 (TLR4) and DDX58/RIG1-like helicases (RLH) pathways. May inhibit the LTR pathway by direct interaction with

TRAF6 and attenuation of NF-kappa-B activation. May negatively regulate the RLH pathway downstream from MAVS and

upstream of NF-kappa-B and IRF3 (By similarity)

Gene Wiki entry for TRAFD1

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000012.11 NC_018923.1 NT_009775.17

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the TRAFD1 gene promoter:
STAT1 p53 Sp1 Brachyury HTF FOXO3 NF-kappaB FOXO3b FOXO3a NF-kappaB1
Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: TRAFD1 promoter sequence

Search SABiosciences Chromatin IP Primers for TRAFD1

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TRAFD1

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 12q Ensembl cytogenetic band: 12q24.13 HGNC cytogenetic band: 12q24.13

TRAFD1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TRAFD1 gene location

GeneLoc information about chromosome 12 GeneLoc Exon Structure

GeneLoc location for GC12P112563: view genomic region (about GC identifiers)

Start:	112,563,305 bp from pter	End:	112,591,408 bp from pter
Size:	28,104 bases	Orientation:	plus strand

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: TRAD1_HUMAN, O14545 (See protein sequence)

Recommended Name: TRAF-type zinc finger domain-containing protein 1

Size: 582 amino acids; 64841 Da

Subunit: Interacts with MAVS, TICAM1, TRAF1, TRAF2, TRAF3 (By similarity). Interacts with TRAF6

1 PDB 3D structure from and Proteopedia for TRAFD1:

2D9K (3D)

Secondary accessions: A8K5L6

Explore the universe of human proteins at neXtProt for TRAFD1: NX_O14545

Post-translational modifications:

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_O14545

TRAFD1 Protein expression data from MOPED and PaxDb: About this image

REFSEQ proteins (2 alternative transcripts):

NP_001137378.1 NP_006691.1

ENSEMBL proteins:

ENSP00000396526 ENSP00000449319 ENSP00000449297 ENSP00000447340 ENSP00000450357

ENSP00000449098 ENSP00000257604

Human Recombinant Protein Products:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	OriGene Purified Protein: TRAFD1 OriGene Protein Over-expression Lysate (see all 2): TRAFD1 OriGene Custom Protein Services for TRAFD1
	GenScript Custom Purified and Recombinant Proteins Services for TRAFD1
	Novus Biologicals TRAFD1 Lysates
	Browse Sino Biological Recombinant Proteins
	Browse ProSpec Recombinant Proteins
	Uscn Proteins for TRAFD1

Gene Ontology (GO): 1 cellular component term (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005622	intracellular	IEA	--

TRAFD1 for ontologies About GeneDecksing

TRAFD1 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for TRAFD1
	GenScript Custom Superior Antibodies Services for TRAFD1
	Novus Biologicals TRAFD1 Antibodies
	Search for Antibodies for TRAFD1 at Abcam
	Uscn Antibodies for TRAFD1
	Search ThermoFisher Antibodies for TRAFD1

Assay Products for TRAFD1:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for TRAFD1
	Browse Enzo Life Sciences for kits & assays
	Uscn ELISAs and CLIAs for TRAFD1

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

TRAFD1 for domains About GeneDecksing

1 InterPro domain/family:

IPR015880 Znf_C2H2-like

Graphical View of Domain Structure for InterPro Entry O14545

ProtoNet protein and cluster: O14545

UniProtKB/Swiss-Prot: TRAD1_HUMAN, O14545

Similarity: Contains 1 TRAF-type zinc finger

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Function Summary:

UniProtKB/Swiss-Prot: TRAD1_HUMAN, O14545

Function: Negative feedback regulator that controls excessive innate immune responses. Regulates both Toll-like

receptor 4 (TLR4) and DDX58/RIG1-like helicases (RLH) pathways. May inhibit the LTR pathway by direct interaction with

TRAF6 and attenuation of NF-kappa-B activation. May negatively regulate the RLH pathway downstream from MAVS and

upstream of NF-kappa-B and IRF3 (By similarity)

miRNA Products:		OriGene 3'-UTR Clone (see all 2): TRAFD1 Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TRAFD1
		8/25 QIAGEN miScript miRNA Assays for microRNAs that regulate TRAFD1 (see all 25):
		hsa-miR-34b* hsa-miR-193a-3p hsa-miR-302d hsa-miR-520e hsa-miR-29c hsa-miR-29a hsa-miR-624 hsa-miR-302e

		SwitchGear 3'UTR luciferase reporter plasmid: TRAFD1 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TRAFD1 (see all 7) OriGene shRNA RFP: TRAFD1 OriGene siRNA: TRAFD1
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TRAFD1

Gene Editing
Products:

DNA2.0 Custom Protein Engineering Service for TRAFD1

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TRAFD1 (see all 5) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TRAFD1 (see all 2) OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): TRAFD1 (NM_001143906)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for TRAFD1
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TRAFD1

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for TRAFD1
		Search LifeMap BioReagents cell lines for TRAFD1

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TRAFD1

Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005515	protein binding	--	--
GO:0008270	zinc ion binding	IEA	--

TRAFD1 for ontologies           About GeneDecksing

Animal Models:
     Mouse knock-out Trafd1^tm1Ayos for TRAFD1
     5 MGI mutant phenotypes (inferred from 2 alleles) (MGI details for Trafd1):

growth/size

homeostasis/metabolism

immune system

mortality/aging

skeleton

TRAFD1 for phenotypes About GeneDecksing

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Interactions:

Search SABiosciences Gene Network Central^TM Interacting Genes and Proteins Networks for TRAFD1

STRING Interaction Network Preview (showing 3 interactants - click image to see more details)

5/8 Interacting proteins for TRAFD1 (O14545³ ENSP00000257604⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 8)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
UBC	P0CG48³, ENSP00000344818⁴	I2D: score=1 STRING: ENSP00000344818
TRAF1	Q13077³, ENSP00000362994⁴	I2D: score=2 STRING: ENSP00000362994
TRAF6	Q9Y4K3³	I2D: score=5
MAVS	Q7Z434³	I2D: score=1
TICAM1	Q8IUC6³	I2D: score=1

About this table

Gene Ontology (GO): 2 biological process terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0034097	response to cytokine stimulus	IEA	--
GO:0045824	negative regulation of innate immune response	ISS	--

TRAFD1 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for TRAFD1
Search CenterWatch for drugs/clinical trials and news about TRAFD1 / TRAD1

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for TRAFD1 gene (2 alternative transcripts):

NM_001143906.1 NM_006700.2

Unigene Cluster for TRAFD1:

TRAF-type zinc finger domain containing 1

Hs.5148 [show with all ESTs]

Unigene Representative Sequence: NM_001143906

9 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000412615(uc010syj.1) ENST00000550051(uc009zwb.2) ENST00000549358

ENST00000547063 ENST00000548092 ENST00000552890 ENST00000552896 ENST00000548277

ENST00000257604(uc001ttp.3 uc001tto.3)

miRNA Products:		OriGene 3'-UTR Clone (see all 2): TRAFD1 Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TRAFD1
		8/25 QIAGEN miScript miRNA Assays for microRNAs that regulate TRAFD1 (see all 25):
		hsa-miR-34b* hsa-miR-193a-3p hsa-miR-302d hsa-miR-520e hsa-miR-29c hsa-miR-29a hsa-miR-624 hsa-miR-302e

		SwitchGear 3'UTR luciferase reporter plasmid: TRAFD1 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TRAFD1 (see all 7) OriGene shRNA RFP: TRAFD1 OriGene siRNA: TRAFD1
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TRAFD1

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TRAFD1 (see all 5) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TRAFD1 (see all 2) OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): TRAFD1 (NM_001143906)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for TRAFD1
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TRAFD1

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TRAFD1 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat TRAFD1
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TRAFD1
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TRAFD1

Additional cDNA sequence:

AB007447.1 AK122620.1 AK291331.1 AK295474.1 AK309916.1 AK312601.1 BC003553.2

9 DOTS entries:

DT.454505 DT.101982188 DT.75159256 DT.100030051 DT.95132209 DT.91847488 DT.100786057 DT.86853826

DT.121175128

24/334 AceView cDNA sequences (see all 334):

BQ231155 AW452353 BQ709625 BM855746 BM803629 N29133 CA307340 BF974261

AI637612 F05776 AI924861 CA314188 AI751573 BU729209 BQ961437 AI961198

BQ059382 T35623 BX283270 BQ880437 CR596482 BF059652 AU132262 BI064313

GeneLoc Exon Structure

5/6 Alternative Splicing Database (ASD) splice patterns (SP) for TRAFD1 (see all 6) About this scheme

ExUns:	1a	·	1b	^	2	^	3	^	4	^	5	^	6	^	7	^	8a	·	8b	·	8c	·	8d	^	9	^	10	^	11	^	12	^	13	^	14	^	15
SP1:					-				-						-								-
SP2:									-						-								-
SP3:					-				-
SP4:					-										-
SP5:									-						-

ECgene alternative splicing isoforms for TRAFD1

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

TRAFD1 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: --

About this image

TRAFD1 expression in embryonic tissues and stem cells

Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine About this table

1 LifeMap In Vivo Development Anatomical Compartment/Cell

Tissue

Anatomical Compartment

Cell

Category (developmental path)

Ovary

Antral Follicle

Secondary Oocyte

Female Gametocytes, Germ Cells

Expression:

Positive

Negative

Selective marker

Experimental details:

Curated

Microarrays

In-situ hybridization

See TRAFD1 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for TRAFD1

SOURCE GeneReport for Unigene cluster: Hs.5148

SABiosciences Custom PCR Arrays for TRAFD1

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TRAFD1 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat TRAFD1
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TRAFD1
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TRAFD1

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TRAFD1

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of eukaryotes.

Orthologs for TRAFD1 gene from 6/14 species (see all 14) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
mouse (Mus musculus)	Mammalia	Trafd1^{1 , 5}	TRAF type zinc finger domain containing 1^{1, 5}	81.26(n)¹ 76.55(a)¹		5 (61.78 cM)⁵ 231712¹ NM_001163470.1¹ NP_001156942.1¹ 121371725⁵
chicken (Gallus gallus)	Aves	TRAFD1¹	TRAF-type zinc finger domain containing 1	57.65(n) 48.75(a)		416884 NM_001006191.1 NP_001006191.1
lizard (Anolis carolinensis)	Reptilia	TRAFD1⁶	--	39(a)	1 ↔ 1	GL343282.1(165540-176250)
zebrafish (Danio rerio)	Actinopterygii	zgc:162228¹	zgc:162228	51.32(n) 42.69(a)		100037363 NM_001089515.1 NP_001082984.1
thale cress (Arabidopsis thaliana)	eudicotyledons	AT1G09920¹	TRAF-type zinc finger-related protein	45.52(n) 32.84(a)		837524 NM_100866.4 NP_563857.1
rice (Oryza sativa)	Liliopsida	Os07g0657500¹	hypothetical protein	47.08(n) 36.84(a)		4344157 NM_001067048.1 NP_001060513.1

ENSEMBL Gene Tree for TRAFD1 (if available)
TreeFam Gene Tree for TRAFD1 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for TRAFD1 gene

XAF1²

1 SIMAP similar gene for TRAFD1 using alignment to 7 protein entries: TRAD1_HUMAN (see all proteins):

XAF1

TRAFD1 for paralogs About GeneDecksing

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 12 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs184849946^1,2		--	112561415(+)	`GTGCTA/GGGATT`	2	--	us2k¹		0	--	--	--	--
rs188775240^1,2		--	112561818(+)	`TCCATC/TTGTGT`	2	--	us2k¹		0	--	--	--	--
rs192085546^1,2		--	112561943(+)	`ATTTTC/TCCTGG`	2	--	us2k¹		0	--	--	--	--
rs138231025^1,2		--	112561949(+)	`CCTGGC/TTTTAA`	2	--	us2k¹		0	--	--	--	--
rs149582564^1,2		--	112561960(+)	`ACTTTA/CTATGT`	2	--	us2k¹		0	--	--	--	--
rs184682450^1,2		--	112562220(+)	`ATGTTA/GGCCAG`	2	--	us2k¹		0	--	--	--	--
rs58047810^1,2	C,F,	--	112562486(+)	`TGCCTC/ACTGGG`	2	--	us2k¹		8		NA WA CSA EA	366
rs74996995^1,2		--	112562581(+)	`TTTGTA/GGAGAT`	2	--	us2k¹		0	--	--	--	--
rs139454562^1,2		--	112562709(+)	`GTATT-/GTTTGTAATATGTGCTTGGT TATACTTATATAATTATAAGTTGGTTTG`	2	--	us2k¹		0	--	--	--	--
rs139420475^1,2		--	112562751(+)	`AGTTG-/CT GTATTGTTTG`	2	--	us2k¹		0	--	--	--	--

HapMap Linkage Disequilibrium report for TRAFD1 (112563305 - 112591408 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
Database of Genomic Variants (DGV): 1 variation for TRAFD1
1 CNV: 0166

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing TRAFD1

DNA2.0 Custom Variant and Variant Library Synthesis for TRAFD1

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

TRAFD1 for disorders About MalaCards

TRAFD1 for disorders About GeneDecksing

OMIM gene information: 613197 OMIM disorders: --

Export disorders for TRAFD1 gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for TRAFD1 gene, integrated from 9 sources (see all 28):
(articles sorted by number of sources associating them with TRAFD1)

Utopia: connect your pdf to the dynamic
world of online information

A probability-based approach for high-throughput protein phosphorylation analysis and site localization. (PubMed id 16964243)^{1, 2} Beausoleil S.A.... Gygi S.P. (2006)
Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. (PubMed id 17081983)^{1, 2} Olsen J.V....Mann M. (2006)
FLN29, a novel interferon- and LPS-inducible gene acting as a negative regulator of toll-like receptor signaling. (PubMed id 16221674)^{1, 2} Mashima R.... Yoshimura A. (2005)
The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)^{1, 2} Gerhard D.S....Malek J. (2004)
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)^{1, 3} Strausberg R.L....Marra M.A. (2002)
Methods for quantification of in vivo changes in prote in ubiquitination following proteasome and deubiquitinase inhibition. (PubMed id 22505724)¹ Udeshi N.D....Carr S.A. (2012)
Proteomic dissection of the von Hippel-Lindau (VHL) i nteractome. (PubMed id 21942715)¹ Lai Y....Shiio Y. (2011)
Initial characterization of the human central proteome. (PubMed id 21269460)² Burkard T.R.... Colinge J. (2011)
A proteome-wide, quantitative survey of in vivo ubiqui tylation sites reveals widespread regulatory roles. (PubMed id 21890473)¹ Wagner S.A....Choudhary C. (2011)
Systematic and quantitative assessment of the ubiquiti n-modified proteome. (PubMed id 21906983)¹ Kim W....Gygi S.P. (2011)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 10906	HGNC: 24808	AceView: FLN29	Ensembl:ENSG00000135148	euGenes: HUgn10906
ECgene: TRAFD1	H-InvDB: TRAFD1

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for TRAFD1	Pharmacogenomics, SNPs, Pathways

Intellectual Property for TRAFD1 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for TRAFD1 gene:
Search GeneIP for patents involving TRAFD1

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
In Situ Hybridization Assays from
Advanced Cell Diagnostics
About This Section


	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Phosphatase Activity Assays/Reagents		Browse Recombinant/Natural Proteins

	Browse OriGene Antibodies		OriGene shRNA RFP for TRAFD1
	OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TRAFD1		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TRAFD1
	OriGene Protein Over-expression Lysate for TRAFD1		Browse OriGene Fluorogenic Cell Assay Kits
	OriGene siRNA for TRAFD1		OriGene 3'-UTR Clone for TRAFD1
	OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TRAFD1		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TRAFD1
	Browse OriGene GFP tagged cDNA clones in CMV expression vector		Browse OriGene MicroRNA Expression Plasmids
	Browse OriGene basic RS shRNAs		Browse OriGene validated miRNA SYBR primer pairs
	OriGene Purified Protein for TRAFD1		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for TRAFD1		OriGene Custom Protein Services for TRAFD1
	OriGene Custom Immunoassay Development

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat TRAFD1
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing TRAFD1
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TRAFD1
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TRAFD1
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TRAFD1
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TRAFD1

	GenScript Custom Purified and Recombinant Proteins Services for TRAFD1		GenScript cDNA clones with any tag delivered in your preferred vector for TRAFD1
	GenScript Custom Assay Services for TRAFD1		GenScript Custom Superior Antibodies Services for TRAFD1
	GenScript Custom overexpressing Cell Line Services for TRAFD1		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Search for Antibodies & Assays

	Regulatory tfbs in TRAFD1 promoter
	Search Chromatin IP Primers for TRAFD1
	RT² qPCR Primer Assay in human, mouse, rat TRAFD1
	Search GNC Networks for TRAFD1
	SABiosciences Custom PCR Arrays for TRAFD1

Search Tocris compounds for TRAFD1

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological cDNA Clones
	Antibodies/Proteins Production Services
	Rabbit Monoclonal Antibody Platform
	Bulk Purchasing

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	TRAFD1 antibodies
	TRAFD1 lysates

	Search for Antibodies for TRAFD1 at Abcam
	See all of Abcam's Antibodies, Kits and Proteins for TRAFD1
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

TRAFD1 Proteins, Antibodies, CLIAs, and ELISAs

Search LifeMap BioReagents cell lines for TRAFD1

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TRAFD1

	SwitchGear 3'UTR luciferase reporter plasmids for TRAFD1
	SwitchGear Promoter luciferase reporter plasmids for TRAFD1

Search ThermoFisher Antibodies for TRAFD1

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TRAFD1

GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

View Random Gene

Category			VWF (GIFTS: 73) von Willebrand factor
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes TRAFD1 gene at Home site.

hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4

Advanced Search

Export list of displayed genes

TRAFD1 Gene

TRAF-type zinc finger domain containing 1

Aliases
for TRAFD1 gene

Summaries
for TRAFD1 gene

Genomic Views
for TRAFD1 gene

Proteins
for TRAFD1 gene

Protein Domains /
Families
for TRAFD1 gene

Function
for TRAFD1 gene

Pathways & Interactions
for TRAFD1 gene

Drugs & Compounds
for TRAFD1 gene

Transcripts
for TRAFD1 gene

Expression
for TRAFD1 gene

Orthologs
for TRAFD1 gene

Paralogs
for TRAFD1 gene

Genomic Variants
for TRAFD1 gene

Disorders / Diseases
for TRAFD1 gene

Publications
for TRAFD1 gene

External Searches for TRAFD1 gene

Genome Databases showing TRAFD1 gene

Other Databases showing TRAFD1 gene

Specialized Databases showing TRAFD1 gene

Intellectual Property
for TRAFD1 gene

Products
for TRAFD1 gene

View Random Gene

Advanced Search

Export list of displayed genes

TRAFD1 Gene

TRAF-type zinc finger domain containing 1

Aliasesfor TRAFD1 gene

Summariesfor TRAFD1 gene

Genomic Viewsfor TRAFD1 gene

Proteinsfor TRAFD1 gene

Protein Domains /Familiesfor TRAFD1 gene

Functionfor TRAFD1 gene

Pathways & Interactionsfor TRAFD1 gene

Drugs & Compoundsfor TRAFD1 gene

Transcriptsfor TRAFD1 gene

Expression for TRAFD1 gene

Orthologsfor TRAFD1 gene

Paralogsfor TRAFD1 gene

Genomic Variantsfor TRAFD1 gene

Disorders / Diseasesfor TRAFD1 gene

Publicationsfor TRAFD1 gene

External Searches for TRAFD1 gene

Genome Databases showing TRAFD1 gene

Other Databases showing TRAFD1 gene

Specialized Databases showing TRAFD1 gene

Intellectual Propertyfor TRAFD1 gene

Productsfor TRAFD1 gene

View Random Gene

Aliases
for TRAFD1 gene

Summaries
for TRAFD1 gene

Genomic Views
for TRAFD1 gene

Proteins
for TRAFD1 gene

Protein Domains /
Families
for TRAFD1 gene

Function
for TRAFD1 gene

Pathways & Interactions
for TRAFD1 gene

Drugs & Compounds
for TRAFD1 gene

Transcripts
for TRAFD1 gene

Expression
for TRAFD1 gene

Orthologs
for TRAFD1 gene

Paralogs
for TRAFD1 gene

Genomic Variants
for TRAFD1 gene

Disorders / Diseases
for TRAFD1 gene

Publications
for TRAFD1 gene

Intellectual Property
for TRAFD1 gene

Products
for TRAFD1 gene