Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TRABD Gene

Aliases for TRABD Gene

  • TraB Domain Containing 2 3 5
  • TraB Domain-Containing Protein 3
  • Protein TTG2 4
  • LP6054 3
  • PP2447 3
  • TTG2 4

External Ids for TRABD Gene

Previous GeneCards Identifiers for TRABD Gene

  • GC22P048966
  • GC22P050624
  • GC22P033529

Summaries for TRABD Gene

GeneCards Summary for TRABD Gene

TRABD (TraB Domain Containing) is a Protein Coding gene.

Additional gene information for TRABD Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TRABD Gene

Genomics for TRABD Gene

GeneHancer (GH) Regulatory Elements for TRABD Gene

Promoters and enhancers for TRABD Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH22I050188 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 562.1 +5.2 5174 5.6 HDGF PKNOX1 ATF1 SIN3A ZNF2 IRF4 ZNF766 GLIS2 ZNF143 KLF7 TRABD ENSG00000273188 TUBGCP6 MAPK12 HDAC10 BRD1 ENSG00000273253 MAPK11 PLXNB2 MLC1
GH22I050183 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 560.7 -0.1 -82 3.9 ARID4B DMAP1 ZNF2 ZNF48 GTF3C2 ZNF121 GLIS2 ZNF213 ZNF143 KLF7 TRABD SELENOO ENSG00000273253 PANX2 LOC105373095 MAPK12 BRD1 SCO2 TUBGCP6 PIM3
GH22I050505 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 13.5 +321.9 321948 4.2 PKNOX1 ZFP64 ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 POLR2B E2F8 LMF2 NCAPH2 SYCE3 CHKB ALG12 ENSG00000273192 TRABD PLXNB2 TYMP MIOX
GH22I050199 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE dbSUPER 10.5 +15.1 15125 2.9 PKNOX1 ATF1 FOXA2 ARID4B SIN3A YY1 GLIS2 ZNF143 FOS RUNX3 ENSG00000273253 SELENOO PIR51711 TUBGCP6 HDAC10 MAPK12 MAPK11 PLXNB2 MLC1 TRABD
GH22I049942 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 10 -236.7 -236664 13.5 HDGF PKNOX1 CLOCK FOXA2 MLX ARNT ZFP64 ARID4B NEUROD1 SIN3A ALG12 ENSG00000272836 RABL2B PLXNB2 TUBGCP6 ZBED4 LMF2 NCAPH2 CHKB BRD1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TRABD on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the TRABD gene promoter:

Genomic Locations for TRABD Gene

Genomic Locations for TRABD Gene
chr22:50,185,905-50,199,598
(GRCh38/hg38)
Size:
13,694 bases
Orientation:
Plus strand
chr22:50,624,344-50,638,027
(GRCh37/hg19)

Genomic View for TRABD Gene

Genes around TRABD on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TRABD Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TRABD Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TRABD Gene

Proteins for TRABD Gene

  • Protein details for TRABD Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9H4I3-TRABD_HUMAN
    Recommended name:
    TraB domain-containing protein
    Protein Accession:
    Q9H4I3
    Secondary Accessions:
    • Q19CC5
    • Q96ED8
    • Q9H7N1
    • Q9UGX6
    • Q9UGX7

    Protein attributes for TRABD Gene

    Size:
    376 amino acids
    Molecular mass:
    42321 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=BAB15737.1; Type=Frameshift; Positions=224, 282; Evidence={ECO:0000305};

    Alternative splice isoforms for TRABD Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for TRABD Gene

Post-translational modifications for TRABD Gene

  • Ubiquitination at posLast=5050, posLast=116116, and posLast=209209

No data available for DME Specific Peptides for TRABD Gene

Domains & Families for TRABD Gene

Gene Families for TRABD Gene

Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted membrane proteins

Protein Domains for TRABD Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for TRABD Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with TRABD: view

No data available for UniProtKB/Swiss-Prot for TRABD Gene

Function for TRABD Gene

Phenotypes From GWAS Catalog for TRABD Gene

genes like me logo Genes that share phenotypes with TRABD: view

Animal Model Products

miRNA for TRABD Gene

miRTarBase miRNAs that target TRABD

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for TRABD Gene

Localization for TRABD Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TRABD gene
Compartment Confidence
nucleus 3
mitochondrion 2
cytosol 2
extracellular 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Mitochondria (2)
  • Nucleus (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for TRABD Gene

Pathways & Interactions for TRABD Gene

SuperPathways for TRABD Gene

No Data Available

Gene Ontology (GO) - Biological Process for TRABD Gene

None

No data available for Pathways by source and SIGNOR curated interactions for TRABD Gene

Drugs & Compounds for TRABD Gene

No Compound Related Data Available

Transcripts for TRABD Gene

Unigene Clusters for TRABD Gene

TraB domain containing:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TRABD Gene

ExUns: 1a · 1b · 1c · 1d · 1e ^ 2 ^ 3a · 3b ^ 4a · 4b ^ 5a · 5b ^ 6 ^ 7a · 7b ^ 8a · 8b · 8c · 8d · 8e ^ 9a · 9b · 9c ^ 10 ^ 11a · 11b ·
SP1: - - - -
SP2: - - - - - - -
SP3: - - - -
SP4: - - - - -
SP5: - - - - -
SP6: - - - -
SP7: - - -
SP8: - - -
SP9: - -
SP10: - - - -
SP11: -
SP12: -
SP13: -
SP14:

ExUns: 11c · 11d · 11e ^ 12a · 12b
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8:
SP9:
SP10:
SP11: - - -
SP12:
SP13:
SP14:

Relevant External Links for TRABD Gene

GeneLoc Exon Structure for
TRABD
ECgene alternative splicing isoforms for
TRABD

Expression for TRABD Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TRABD Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for TRABD Gene

This gene is overexpressed in Whole Blood (x6.0).

Protein differential expression in normal tissues from HIPED for TRABD Gene

This gene is overexpressed in Peripheral blood mononuclear cells (26.8), Breast (17.8), and Bone (11.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TRABD Gene



Protein tissue co-expression partners for TRABD Gene

NURSA nuclear receptor signaling pathways regulating expression of TRABD Gene:

TRABD

SOURCE GeneReport for Unigene cluster for TRABD Gene:

Hs.517731

Evidence on tissue expression from TISSUES for TRABD Gene

  • Nervous system(2.8)
genes like me logo Genes that share expression patterns with TRABD: view

No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for TRABD Gene

Orthologs for TRABD Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for TRABD Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia TRABD 33 34
  • 94.29 (n)
dog
(Canis familiaris)
Mammalia TRABD 33 34
  • 90.79 (n)
cow
(Bos Taurus)
Mammalia TRABD 33 34
  • 88.21 (n)
rat
(Rattus norvegicus)
Mammalia Trabd 33
  • 86.86 (n)
mouse
(Mus musculus)
Mammalia Trabd 33 16 34
  • 86.33 (n)
oppossum
(Monodelphis domestica)
Mammalia TRABD 34
  • 86 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia TRABD 34
  • 81 (a)
OneToOne
chicken
(Gallus gallus)
Aves TRABD 33 34
  • 68.55 (n)
lizard
(Anolis carolinensis)
Reptilia TRABD 34
  • 65 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia trabd 33
  • 67.4 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.32087 33
zebrafish
(Danio rerio)
Actinopterygii trabd 33 34
  • 68.07 (n)
Dr.26717 33
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP004340 33
  • 57.99 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG12360 33 34
  • 56.92 (n)
worm
(Caenorhabditis elegans)
Secernentea F38A5.2 34
  • 32 (a)
OneToOne
thale cress
(Arabidopsis thaliana)
eudicotyledons AT1G05270 33
  • 46.84 (n)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.8533 34
  • 40 (a)
OneToOne
Species where no ortholog for TRABD was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TRABD Gene

ENSEMBL:
Gene Tree for TRABD (if available)
TreeFam:
Gene Tree for TRABD (if available)

Paralogs for TRABD Gene

No data available for Paralogs for TRABD Gene

Variants for TRABD Gene

Sequence variations from dbSNP and Humsavar for TRABD Gene

SNP ID Clin Chr 22 pos Variation AA Info Type
rs1000104568 -- 50,189,443(+) G/A genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000107044 -- 50,190,637(+) G/A 5_prime_UTR_variant, genic_upstream_transcript_variant, intron_variant, non_coding_transcript_variant, upstream_transcript_variant
rs1000184359 -- 50,187,381(+) G/C genic_upstream_transcript_variant, intron_variant
rs1000249865 -- 50,196,287(+) GCCTGGGCTCCCCAGGGTGGCCTGGGC/GCCTGGGC intron_variant
rs1000429509 -- 50,196,420(+) T/C intron_variant

Structural Variations from Database of Genomic Variants (DGV) for TRABD Gene

Variant ID Type Subtype PubMed ID
dgv781n67 CNV gain 20364138
esv2724755 CNV deletion 23290073
esv2724756 CNV deletion 23290073
esv2724757 CNV deletion 23290073
nsv191327 CNV deletion 16902084
nsv471223 CNV loss 18288195
nsv829333 CNV gain 20364138
nsv955199 CNV deletion 24416366

Variation tolerance for TRABD Gene

Residual Variation Intolerance Score: 22.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.86; 18.03% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TRABD Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
TRABD

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TRABD Gene

Disorders for TRABD Gene

Additional Disease Information for TRABD

No disorders were found for TRABD Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TRABD Gene

Publications for TRABD Gene

  1. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  2. Reevaluating human gene annotation: a second-generation analysis of chromosome 22. (PMID: 12529303) Collins JE … Dunham I (Genome research 2003) 3 4 58
  3. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 2 3 58
  4. Characterization of long cDNA clones from human adult spleen. (PMID: 11214971) Hattori A … Ohara O (DNA research : an international journal for rapid publication of reports on genes and genomes 2000) 3 4 58
  5. The DNA sequence of human chromosome 22. (PMID: 10591208) Dunham I … O'Brien KP (Nature 1999) 3 4 58

Products for TRABD Gene

Sources for TRABD Gene

Content
Loading form....