Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TNRC6C-AS1 Gene

Subcategory (RNA class) for TNRC6C-AS1 Gene


Quality Score for this RNA gene is


Aliases for TNRC6C-AS1 Gene

  • TNRC6C Antisense RNA 1 2 3 5

External Ids for TNRC6C-AS1 Gene

ORGUL Members for TNRC6C-AS1 Gene

Previous GeneCards Identifiers for TNRC6C-AS1 Gene

  • GC17M076105

Summaries for TNRC6C-AS1 Gene

GeneCards Summary for TNRC6C-AS1 Gene

TNRC6C-AS1 (TNRC6C Antisense RNA 1) is an RNA Gene, and is affiliated with the antisense RNA class.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TNRC6C-AS1 Gene

Genomics for TNRC6C-AS1 Gene

Genomic Location for TNRC6C-AS1 Gene

78,107,398 bp from pter
78,111,799 bp from pter
4,402 bases
Minus strand

Genomic View for TNRC6C-AS1 Gene

Genes around TNRC6C-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TNRC6C-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TNRC6C-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TNRC6C-AS1 Gene

No data available for Regulatory Elements for TNRC6C-AS1 Gene

Proteins for TNRC6C-AS1 Gene

Post-translational modifications for TNRC6C-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for TNRC6C-AS1 Gene

Domains & Families for TNRC6C-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for TNRC6C-AS1 Gene

Function for TNRC6C-AS1 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for TNRC6C-AS1 Gene

Localization for TNRC6C-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for TNRC6C-AS1 Gene

Pathways & Interactions for TNRC6C-AS1 Gene

SuperPathways for TNRC6C-AS1 Gene

No Data Available

Interacting Proteins for TNRC6C-AS1 Gene

Gene Ontology (GO) - Biological Process for TNRC6C-AS1 Gene


No data available for Pathways by source and SIGNOR curated interactions for TNRC6C-AS1 Gene

Drugs & Compounds for TNRC6C-AS1 Gene

No Compound Related Data Available

Transcripts for TNRC6C-AS1 Gene

mRNA/cDNA for TNRC6C-AS1 Gene

(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for TNRC6C-AS1 Gene

No ASD Table

Relevant External Links for TNRC6C-AS1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TNRC6C-AS1 Gene

mRNA expression in normal human tissues for TNRC6C-AS1 Gene

mRNA differential expression in normal tissues according to GTEx for TNRC6C-AS1 Gene

This gene is overexpressed in Spleen (x5.6), Brain - Spinal cord (cervical c-1) (x4.2), and Whole Blood (x4.1).
genes like me logo Genes that share expression patterns with TNRC6C-AS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for TNRC6C-AS1 Gene

Orthologs for TNRC6C-AS1 Gene

Evolution for TNRC6C-AS1 Gene

Gene Tree for TNRC6C-AS1 (if available)
Gene Tree for TNRC6C-AS1 (if available)

No data available for Orthologs for TNRC6C-AS1 Gene

Paralogs for TNRC6C-AS1 Gene

No data available for Paralogs for TNRC6C-AS1 Gene

Variants for TNRC6C-AS1 Gene

Sequence variations from dbSNP and Humsavar for TNRC6C-AS1 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs2613513 -- 78,109,650(+) ATTTC(C/T)GAAGC nc-transcript-variant
rs2748431 -- 78,109,673(-) ACTCA(C/T)GCCCG nc-transcript-variant
rs10715213 -- 78,110,083(+) AAAAA(-/A)TTCAC nc-transcript-variant
rs57247632 -- 78,112,219(+) TGGAG(A/C)ACTGA upstream-variant-2KB
rs59515180 -- 78,111,963(+) AGCAC(-/TGGGGTCATGACGGGCTGGTTCCCGC)AGGCC upstream-variant-2KB

Relevant External Links for TNRC6C-AS1 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) and Variation tolerance for TNRC6C-AS1 Gene

Disorders for TNRC6C-AS1 Gene

Relevant External Links for TNRC6C-AS1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for TNRC6C-AS1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TNRC6C-AS1 Gene

Publications for TNRC6C-AS1 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 67
  2. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 3

Products for TNRC6C-AS1 Gene

Sources for TNRC6C-AS1 Gene

Back to Top
