Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



TNFRSF11B Gene

protein-coding   GIFtS: 68
GCID: GC08M119935

Tumor Necrosis Factor Receptor Superfamily, Member 11b

(Previous name: osteoprotegerin)
(Previous symbol: OPG)
  See TNFRSF11B-related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Tumor Necrosis Factor Receptor Superfamily, Member 11b1 2     Osteoclastogenesis Inhibitory Factor2 3
OPG1 2 3 5     TR12
OCIF2 3 5     Tumor Necrosis Factor Receptor Superfamily Member 11B2
osteoprotegerin1 2     Osteoprotegerin3

External Ids:    HGNC: 119091   Entrez Gene: 49822   Ensembl: ENSG000001647617   OMIM: 6026435   UniProtKB: O003003   

Export aliases for TNFRSF11B gene to outside databases

Previous GC identifers: GC08M118923 GC08M119997 GC08M119604 GC08M119892 GC08M120004 GC08M115263


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for TNFRSF11B Gene:
The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein is an
osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein
specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of
osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a
role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this
gene have been reported, but their full length nature has not been determined. (provided by RefSeq, Jul 2008)

GeneCards Summary for TNFRSF11B Gene:
TNFRSF11B (tumor necrosis factor receptor superfamily, member 11b) is a protein-coding gene. Diseases associated with TNFRSF11B include paget disease, juvenile, and synovitis. GO annotations related to this gene include cytokine activity and receptor activity. An important paralog of this gene is TNFRSF21.

UniProtKB/Swiss-Prot: TR11B_HUMAN, O00300
Function: Acts as decoy receptor for TNFSF11/RANKL and thereby neutralizes its function in osteoclastogenesis.
Inhibits the activation of osteoclasts and promotes osteoclast apoptosis in vitro. Bone homeostasis seems to
depend on the local ratio between TNFSF11 and TNFRSF11B. May also play a role in preventing arterial
calcification. May act as decoy receptor for TNFSF10/TRAIL and protect against apoptosis. TNFSF10/TRAIL binding
blocks the inhibition of osteoclastogenesis

Gene Wiki entry for TNFRSF11B (Osteoprotegerin) Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000008.10  NC_018919.2  NT_008046.17  
Regulatory elements:
   Regulatory transcription factor binding sites in the TNFRSF11B gene promoter:
         AML1a   Nkx2-5   NF-kappaB   Roaz   FAC1   POU2F1   POU2F1a   NF-kappaB1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidTNFRSF11B promoter sequence
   Search Chromatin IP Primers for TNFRSF11B

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat TNFRSF11B


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 8q24   Ensembl cytogenetic band:  8q24.12   HGNC cytogenetic band: 8q24

TNFRSF11B Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TNFRSF11B gene location

GeneLoc information about chromosome 8         GeneLoc Exon Structure

GeneLoc location for GC08M119935:  view genomic region     (about GC identifiers)

Start:
119,935,796 bp from pter      End:
119,964,439 bp from pter
Size:
28,644 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., and/or eBioscience,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., and/or eBioscience, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: TR11B_HUMAN, O00300 (See protein sequence)
Recommended Name: Tumor necrosis factor receptor superfamily member 11B precursor  
Size: 401 amino acids; 46026 Da
Subunit: Homodimer. Interacts with TNFSF10 and TNFSF11
1 PDB 3D structure from and Proteopedia for TNFRSF11B:
3URF (3D)    
Secondary accessions: B2R9A8 O60236 Q53FX6 Q9UHP4

Explore the universe of human proteins at neXtProt for TNFRSF11B: NX_O00300

Explore proteomics data for TNFRSF11B at MOPED

Post-translational modifications: 

  • N-glycosylated. Contains sialic acid residues1
  • The N-terminus is blocked1
  • Glycosylation2 at Asn98, Asn152, Asn165, Asn178, Asn289

  • See TNFRSF11B Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins: NP_002537.3  
    ENSEMBL proteins: 
     ENSP00000297350   ENSP00000427924  

    TNFRSF11B Human Recombinant Protein Products:

    EMD Millipore Purified and/or Recombinant TNFRSF11B Protein
    R&D Systems Recombinant & Natural Proteins for TNFRSF11B (Osteoprotegerin/TNFRSF11B)
    Enzo Life Sciences proteins for TNFRSF11B
    OriGene Purified Protein for TNFRSF11B
    OriGene Protein Over-expression Lysate for TNFRSF11B
    OriGene Custom MassSpec
    OriGene Custom Protein Services for TNFRSF11B
    GenScript Custom Purified and Recombinant Proteins Services for TNFRSF11B
    Novus Biologicals TNFRSF11B Proteins
    Novus Biologicals TNFRSF11B Lysate
    Sino Biological Recombinant Protein for TNFRSF11B
    Sino Biological Cell Lysate for TNFRSF11B
    ProSpec Recombinant Protein for TNFRSF11B
    Browse Proteins at Cloud-Clone Corp.

     
    Search eBioscience for Proteins for TNFRSF11B 

    TNFRSF11B Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    R&D Systems Antibodies for TNFRSF11B (Osteoprotegerin/TNFRSF11B)
    OriGene Antibodies for TNFRSF11B
    OriGene Custom Antibody Services for TNFRSF11B
    Novus Biologicals TNFRSF11B Antibodies
    Abcam antibodies for TNFRSF11B
    Browse Antibodies at Cloud-Clone Corp.
    ThermoFisher Antibody for TNFRSF11B
    LSBio Antibodies in human, mouse, rat for TNFRSF11B

    TNFRSF11B Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for TNFRSF11B
    R&D Systems ELISAs for TNFRSF11B (Osteoprotegerin/TNFRSF11B)
    GenScript Custom Assay Services for TNFRSF11B
    Enzo Life Sciences assays for TNFRSF11B
    Browse ELISAs at Cloud-Clone Corp.
    Browse CLIAs at Cloud-Clone Corp.
    eBioscience ELISAs for TNFRSF11B:  
                        Human Osteoprotegerin Instant ELISA 128 tests


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    TNFRSF: Tumor necrosis factor receptor superfamily

    IUPHAR Guide to PHARMACOLOGY protein family classification: osteoprotegerin
    Tumour necrosis factor (TNF) receptor family

    5 InterPro protein domains:
     IPR001368 TNFR/NGFR_Cys_rich_reg
     IPR017371 TNFR_11B
     IPR011029 DEATH-like_dom
     IPR000488 Death_domain
     IPR022323 TNFR_11

    Graphical View of Domain Structure for InterPro Entry O00300

    ProtoNet protein and cluster: O00300

    2 Blocks protein domains:
    IPB000488 Death domain
    IPB001368 TNFR/CD27/30/40/95 cysteine-rich region


    UniProtKB/Swiss-Prot: TR11B_HUMAN, O00300
    Similarity: Contains 2 death domains
    Similarity: Contains 4 TNFR-Cys repeats


    Find genes that share domains with TNFRSF11B           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: TR11B_HUMAN, O00300
    Function: Acts as decoy receptor for TNFSF11/RANKL and thereby neutralizes its function in osteoclastogenesis.
    Inhibits the activation of osteoclasts and promotes osteoclast apoptosis in vitro. Bone homeostasis seems to
    depend on the local ratio between TNFSF11 and TNFRSF11B. May also play a role in preventing arterial
    calcification. May act as decoy receptor for TNFSF10/TRAIL and protect against apoptosis. TNFSF10/TRAIL binding
    blocks the inhibition of osteoclastogenesis
    Induction: Up-regulated by increasing calcium-concentration in the medium and estrogens. Down-regulated by
    glucocorticoids

         Genatlas biochemistry entry for TNFRSF11B:
    tumor necrosis factor receptor superfamily,member 11B,expressed in lymphoid cells and up-regulated by CD40
    (TNFRSF5) stimulation,involved in osteoclastogenesis,secreted form down-regulating osteoclast differentiation by
    binding the osteoprotegerin ligand (TNFSF11)

         Gene Ontology (GO): 3 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004872receptor activity TAS9108485
    GO:0005125cytokine activity TAS9168977
    GO:0005515protein binding ----
         
    Find genes that share ontologies with TNFRSF11B           About GenesLikeMe


    Phenotypes:
         10 MGI mutant phenotypes (inferred from 3 alleles(MGI details for Tnfrsf11b):
     cardiovascular system  cellular  craniofacial  growth/size/body  hearing/vestibular/ear 
     hematopoietic system  immune system  limbs/digits/tail  mortality/aging  skeleton 

    Find genes that share phenotypes with TNFRSF11B           About GenesLikeMe

    Animal Models:
         MGI mouse knock-outs for TNFRSF11B: Tnfrsf11btm1Khs Tnfrsf11btm1Eac Tnfrsf11btm1Wss

       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for TNFRSF11B
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for TNFRSF11B

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for TNFRSF11B
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for TNFRSF11B

    miRNA
    Products:
        
    miRTarBase miRNAs that target TNFRSF11B:
    hsa-mir-21-5p (MIRT031067), hsa-mir-124-3p (MIRT023202)

    Block miRNA regulation of human, mouse, rat TNFRSF11B using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate TNFRSF11B (see all 30):
    hsa-miR-181c hsa-miR-429 hsa-miR-199b-3p hsa-miR-199a-3p hsa-miR-4263 hsa-miR-3129-5p hsa-miR-183* hsa-miR-4330
    SwitchGear 3'UTR luciferase reporter plasmidTNFRSF11B 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for TNFRSF11B
    Predesigned siRNA for gene silencing in human, mouse, rat TNFRSF11B

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for TNFRSF11B

    Clone
    Products:
         
    OriGene clones in human, mouse for TNFRSF11B (see all 6)
    OriGene ORF clones in mouse, rat for TNFRSF11B
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: TNFRSF11B (NM_002546)
    Sino Biological Human cDNA Clone for TNFRSF11B
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TNFRSF11B
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TNFRSF11B

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for TNFRSF11B
    ESI BIO PureStem Progenitor for TNFRSF11B: 
    PureStem 7SMOO32, NCr-fac & Meso Progenitor
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TNFRSF11B


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    TR11B_HUMAN, O00300: Secreted
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    extracellular5
    nucleus3
    cytoskeleton1
    cytosol1
    lysosome1
    mitochondrion1
    plasma membrane1

    Gene Ontology (GO): 3 cellular component terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005576extracellular region TAS9108485
    GO:0005578proteinaceous extracellular matrix IEA--
    GO:0005615extracellular space IDA15516325

    Find genes that share ontologies with TNFRSF11B           About GenesLikeMe


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for TNFRSF11B About   (see all 11)  
    See pathways by source

    SuperPathContained pathways About
    1TNF Signaling
    TNF Signaling0.50
    TNF Superfamily - Human Ligand-Receptor Interactions and their Associated Functions0.49
    Death Receptor Signaling0.50
    NF-kB (NFkB) Pathway0.46
    2PEDF Induced Signaling
    Cytokine-cytokine receptor interaction0.43
    3TRAF Pathway
    TNF Superfamily Pathway0.42
    4TWEAK Pathway
    TRAIL Pathway0.40
    5Apoptosis (WikiPathways)
    Apoptosis Modulation and Signaling0.38


    Find genes that share SuperPaths with TNFRSF11B           About GenesLikeMe

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    1 R&D Systems Pathway for TNFRSF11B
        TNF Superfamily - Human Ligand-Receptor Interactions & their Associated Functions

    2 Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for TNFRSF11B
        TRAIL Pathway
    TNF Superfamily Pathway

    1 GeneGo (Thomson Reuters) Pathway for TNFRSF11B
        Transcription Role of VDR in regulation of genes involved in osteoporosis

    5 BioSystems Pathways for TNFRSF11B
        Apoptosis Modulation and Signaling
    Monoamine Transport
    RANKL/RANK Signaling Pathway
    Osteoclast Signaling
    Osteoblast Signaling

    3 Sino Biological Pathways for TNFRSF11B
        TNF Signaling
    Death Receptor Signaling
    NF-kB (NFkB) Pathway


    2 Kegg Pathways  (Kegg details for TNFRSF11B):
        Cytokine-cytokine receptor interaction
    Osteoclast differentiation

        Pathway & Disease-focused RT2 Profiler PCR Arrays including TNFRSF11B (see all 9): 
              Apoptosis in human mouse rat
              Inflammatory Response & Autoimmunity 384HT in human mouse rat
              Inflammatory Cytokines & Receptors in human mouse rat
              TNF Ligands & Receptors in human mouse rat
              Common Cytokines in human mouse rat

    Interactions:

        GeneGlobe Interaction Network for TNFRSF11B

    STRING Interaction Network Preview (showing 5 interactants - click image to see 7)

    Selected Interacting proteins for TNFRSF11B (O003003 ENSP000002973504) via UniProtKB, MINT, STRING, and/or I2D (see all 7)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    TNFSF13O758883, ENSP000003435054I2D: score=2 STRING: ENSP00000343505
    FN1P027513, ENSP000003468394I2D: score=1 STRING: ENSP00000346839
    TNFSF10P505913, ENSP000002412614I2D: score=1 STRING: ENSP00000241261
    VWFP042753, ENSP000002614054I2D: score=1 STRING: ENSP00000261405
    TNFSF11O147883, ENSP000002398494I2D: score=2 STRING: ENSP00000239849
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 12):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001501skeletal system development TAS9108485
    GO:0006915apoptotic process IEA--
    GO:0007165signal transduction IEA--
    GO:0007584response to nutrient IEA--
    GO:0010035response to inorganic substance ----

    Find genes that share ontologies with TNFRSF11B           About GenesLikeMe



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for TNFRSF11B (TR11B)

    1 HMDB Compound for TNFRSF11B    About this table
    CompoundSynonyms CAS #PubMed Ids
    CalciumCa (see all 2)7440-70-2--

    Selected Novoseek inferred chemical compound relationships for TNFRSF11B gene (see all 107)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    denosumab 84.1 7 16370384 (1), 17211092 (1), 18377337 (1), 16188502 (1) (see all 7)
    zoledronic acid 66.8 45 16715352 (5), 19670154 (4), 11855844 (3), 17013645 (2) (see all 16)
    deoxypyridinoline 66.1 26 16404967 (1), 19484355 (1), 11204435 (1), 16899502 (1) (see all 15)
    hcc-1 61.2 4 12773123 (2), 16418778 (1)
    1,25 dihydroxy vitamin d3 59.4 13 9784422 (2), 11182380 (2), 17541498 (1), 19464673 (1) (see all 6)
    vitamin d 56.9 36 20041365 (3), 19134349 (2), 19131500 (2), 19473634 (2) (see all 21)
    calcitriol 52.7 22 14693199 (2), 17654323 (1), 19134349 (1), 19073256 (1) (see all 13)
    pamidronate 52.4 15 11855844 (3), 16979395 (3), 12845688 (2), 14616979 (1) (see all 8)
    25-hydroxyvitamin d 52.3 22 20350696 (2), 17654323 (1), 14529897 (1), 17541498 (1) (see all 11)
    calcium 50.7 135 14525906 (4), 15631342 (3), 17712108 (2), 18421566 (2) (see all 71)



    Find genes that share compounds with TNFRSF11B           About GenesLikeMe



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for TNFRSF11B gene: 
    NM_002546.3  

    Unigene Cluster for TNFRSF11B:

    Tumor necrosis factor receptor superfamily, member 11b
    Hs.81791  [show with all ESTs]
    Unigene Representative Sequence: NM_002546
    3 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000297350(uc003yon.4) ENST00000521597 ENST00000517352(uc010mdc.1)

    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat TNFRSF11B using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate TNFRSF11B (see all 30):
    hsa-miR-181c hsa-miR-429 hsa-miR-199b-3p hsa-miR-199a-3p hsa-miR-4263 hsa-miR-3129-5p hsa-miR-183* hsa-miR-4330
    SwitchGear 3'UTR luciferase reporter plasmidTNFRSF11B 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for TNFRSF11B
    Predesigned siRNA for gene silencing in human, mouse, rat TNFRSF11B
    Clone
    Products:
         
    OriGene clones in human, mouse for TNFRSF11B (see all 6)
    OriGene ORF clones in mouse, rat for TNFRSF11B
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: TNFRSF11B (NM_002546)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TNFRSF11B
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TNFRSF11B
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for TNFRSF11B
    OriGene qSTAR qPCR primer pairs in human, mouse for TNFRSF11B
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TNFRSF11B
      QuantiTect SYBR Green Assays in human, mouse, rat TNFRSF11B
      QuantiFast Probe-based Assays in human, mouse, rat TNFRSF11B

    Additional mRNA sequence: 

    AB002146.1 AF134187.1 AK223155.1 AK308524.1 AK313710.1 BC011023.1 BC030155.2 U94332.1 

    3 DOTS entries:

    DT.214628  DT.95164900  DT.422066 

    Selected AceView cDNA sequences (see all 100):

    CF551889 BM748946 AI356557 CK903485 AF134187 NM_002546 BF194916 BF590126 
    AA599841 H88770 BC030155 AI168275 BQ000897 AA194983 C16486 AI754898 
    C16511 CR592423 CA422210 BQ001556 BM840192 AB002146 AL543947 CD299410 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    TNFRSF11B expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: GATGAGTAAA
    TNFRSF11B Expression
    About this image


    TNFRSF11B expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 7) fully expand
     
     Neural Crest (Gastrulation Derivatives)    fully expand to see all 2 entries
             PureStem 4D20.8, NCr-fac Progenitor
     
     Bone (Muscoskeletal System)    fully expand to see all 2 entries
             Bone marrow-derived mesenchymal stem cells
     
     Mesenchymal Stem Cells
             Bone marrow-derived mesenchymal stem cells
     
     Endothelium (Cardiovascular System)
             Mature Endothelial Cells Blood Brain Barrier
     
     Mesoderm (Gastrulation Derivatives)
             PureStem 7SMOO32, NCr-fac & Meso Progenitor
    TNFRSF11B Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    TNFRSF11B Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.81791

    UniProtKB/Swiss-Prot: TR11B_HUMAN, O00300
    Tissue specificity: Highly expressed in adult lung, heart, kidney, liver, spleen, thymus, prostate, ovary, small
    intestine, thyroid, lymph node, trachea, adrenal gland, testis, and bone marrow. Detected at very low levels in
    brain, placenta and skeletal muscle. Highly expressed in fetal kidney, liver and lung

        Pathway & Disease-focused RT2 Profiler PCR Arrays including TNFRSF11B (see all 9): 
              Apoptosis in human mouse rat
              Inflammatory Response & Autoimmunity 384HT in human mouse rat
              Inflammatory Cytokines & Receptors in human mouse rat
              TNF Ligands & Receptors in human mouse rat
              Common Cytokines in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for TNFRSF11B
    OriGene qSTAR qPCR primer pairs in human, mouse for TNFRSF11B
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TNFRSF11B
    QuantiTect SYBR Green Assays in human, mouse, rat TNFRSF11B
    QuantiFast Probe-based Assays in human, mouse, rat TNFRSF11B
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TNFRSF11B

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of chordates.

    Orthologs for TNFRSF11B gene from Selected species (see all 11)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Tnfrsf11b1 , 5 tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) less1, 5 83.96(n)1
    85.04(a)1
      15 (21.15 cM)5
    183831  NM_008764.31  NP_032790.31 
     542506195 
    chicken
    (Gallus gallus)
    Aves TNFRSF11B1 tumor necrosis factor receptor superfamily, member 11b less 71.74(n)
    69.58(a)
      378803  NM_001033641.1  NP_001028813.1 
    lizard
    (Anolis carolinensis)
    Reptilia TNFRSF11B6
    tumor necrosis factor receptor superfamily, member...
    66(a)
    1 ↔ 1
    GL343269.1(716524-732995)
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia tnfrsf11b1 tumor necrosis factor receptor superfamily, member 11b less 58.27(n)
    49.59(a)
      100494982  XM_002937979.2  XP_002938025.2 
    zebrafish
    (Danio rerio)
    Actinopterygii CABZ01053483.16
    Uncharacterized protein
    19(a)
    many ↔ many
    16(34198766-34214589) ENSDARG00000088018


    ENSEMBL Gene Tree for TNFRSF11B (if available)
    TreeFam Gene Tree for TNFRSF11B (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for TNFRSF11B gene
    TNFRSF212  TNFRSF11A2  TNFRSF6B2  LTBR2  TNFRSF142  CD402  TNFRSF1B2  
    1 SIMAP similar gene for TNFRSF11B using alignment to 2 protein entries:     TR11B_HUMAN (see all proteins):
    TNFRSF6B

    Find genes that share paralogs with TNFRSF11B           About GenesLikeMe



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for TNFRSF11B (see all 679)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 8 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1048940921,2
    Cpathogenic1120216024(-) TAGAGC/TTCTGC 2 L F mis10--------
    rs1048940911,2
    Cpathogenic1120216113(-) CGTGTA/GCAAGG 2 Y C mis10--------
    rs30814001,2
    C,F--115275335(+) GACAACTTTC/
            
    AGGGC
    1 -- int12Minor allele frequency- -:0.40NS CSA 176
    rs340519801,2
    C--115275581(+) ATCCA-/GAGG  
            
    GATTC
    1 -- int10--------
    rs30814021,2
    C,F--115275583(+) CCAGA-/GAG   
      G
    /GGGA
    TTCCT
    1 -- int16NS EU EA NA MN 572
    rs20623781,2
    H--115275584(+) CAGAGG/AGATTC 1 -- int13Minor allele frequency- A:0.00EA NS 288
    rs1425142251,2
    C--115286986(+) CTATC-/TGGCAGTAAGCTAAATTCTGT
    TGGAACATCCATGGAAATTGCCAG
    TGGCA
    1 -- int10--------
    rs106757801,2
    C--119939791(+) TTTTT-/T/TTT 
            
    TTTTT
    2 -- int1 cds1 trp31NA 2
    rs712921981,2
    C--119940502(+) CCTAC-/CTGCCT
    A
    /TGCCTAC
    CTTGG
    1 -- int11NA 2
    rs58944641,2
    C--119944900(+) AAAAA-/ACCATC 1 -- int10--------

    HapMap Linkage Disequilibrium report for TNFRSF11B (119935796 - 119964439 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 7 variations for TNFRSF11B:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2737487CNV Deletion23290073
    esv2737484CNV Deletion23290073
    esv2737486CNV Deletion23290073
    esv2737483CNV Deletion23290073
    esv2005767CNV Deletion18987734
    essv5532CNV CNV17122850
    essv8481CNV CNV17122850

    Human Gene Mutation Database (HGMD): TNFRSF11B
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing TNFRSF11B
    DNA2.0 Custom Variant and Variant Library Synthesis for TNFRSF11B

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 602643   
    OMIM disorders: 239000  
    UniProtKB/Swiss-Prot: TR11B_HUMAN, O00300
  • Juvenile Paget disease (JPD) [MIM:239000]: Rare autosomal recessive osteopathy that presents in infancy
    or early childhood. The disorder is characterized by rapidly remodeling woven bone, osteopenia, debilitating
    fractures, and deformities due to a markedly accelerated rate of bone remodeling throughout the skeleton.
    Approximately 40 cases of JPD have been reported worldwide. Unless it is treated with drugs that block
    osteoclast-mediated skeletal resorption, the disease can be fatal. Note=The disease is caused by mutations
    affecting the gene represented in this entry

  • Selected diseases for TNFRSF11B (see all 25):    
    About MalaCards
    paget disease, juvenile    synovitis    periostitis    chronic apical periodontitis
    optic nerve glioma    multicentric reticulohistiocytosis    osteosclerosis    renal osteodystrophy
    diabetic angiopathy    otosclerosis    hemophilic arthropathy    osteoporosis, postmenopausal
    villonodular synovitis    shwachman-diamond syndrome    periodontitis    pigmented villonodular synovitis
    arthropathy    pericardial effusion    paget's disease of bone    ankylosis

    10 diseases from the University of Copenhagen DISEASES database for TNFRSF11B:
    Osteoporosis     Arthritis     Periodontitis     Multiple myeloma
    Root resorption     Osteosclerosis     Kidney disease     Hypercalcemia
    Atherosclerosis     Bone cancer

    Find genes that share disorders with TNFRSF11B           About GenesLikeMe

    Selected Novoseek inferred disease relationships for TNFRSF11B gene (see all 92)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    paget disease, juvenile 88.7 26 16135836 (3), 15068491 (3), 16491292 (2), 17284635 (2) (see all 13)
    bone diseases 86.9 74 12424190 (3), 19201081 (2), 15775610 (2), 15363860 (1) (see all 53)
    bone destruction 85.6 45 11358823 (2), 10802707 (2), 12183580 (2), 15775561 (2) (see all 27)
    bone loss 84.4 139 12847699 (4), 19701599 (3), 14742260 (3), 15615494 (3) (see all 81)
    osteoporosis 83.4 182 12793029 (4), 12181640 (4), 15526523 (4), 19229472 (3) (see all 99)
    osteolytic 81.7 40 17471510 (2), 15363860 (1), 16450378 (1), 17964729 (1) (see all 28)
    osteolysis 80.7 56 11389072 (3), 19502684 (3), 12177271 (3), 15615495 (2) (see all 37)
    familial expansile osteolysis 79.7 4 17284635 (2), 17174136 (1)
    calcification 74.7 277 16712673 (6), 17056676 (5), 18463323 (5), 19007931 (5) (see all 99)
    osteoporosis postmenopausal 73.9 30 17879531 (2), 18560259 (2), 12629078 (2), 11121682 (2) (see all 18)

    Genetic Association Database (GAD): TNFRSF11B
    Human Genome Epidemiology (HuGE) Navigator: TNFRSF11B (90 documents)

    Export disorders for TNFRSF11B gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for TNFRSF11B gene, integrated from 10 sources (see all 1536):
    (articles sorted by number of sources associating them with TNFRSF11B)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. (PubMed id 9108485)1, 2, 3 Simonet W.S.... Boyle W.J. (Cell 1997)
    2. Susceptibility to Paget's disease of bone is influenced by a common polymorphic variant of osteoprotegerin. (PubMed id 15312251)1, 4, 9 Daroszewska A....Ralston S.H. (J. Bone Miner. Res. 2004)
    3. Serum levels of osteoprotegerin and osteoprotegerin polymorphisms in Gaucher disease. (PubMed id 16512834)1, 4, 9 Magal I....Elstein D. (Br. J. Haematol. 2006)
    4. Single nucleotide polymorphisms in the human gene for osteoprotegerin are not related to bone mineral density or fracture in elderly women. (PubMed id 14508625)1, 4, 9 BrAondstrAPm H....Akesson K. (Calcif. Tissue Int. 2004)
    5. Identity of osteoclastogenesis inhibitory factor (OCIF) and osteoprotegerin (OPG): a mechanism by which OPG/OCIF inhibits osteoclastogenesis in vitro. (PubMed id 9492069)1, 2, 9 Yasuda H.... Higashio K. (Endocrinology 1998)
    6. The relationship between four single nucleotide polymorphisms in the promoter region of the osteoprotegerin gene and aortic calcification or coronary artery disease in Koreans. (PubMed id 16712673)1, 4, 9 Rhee E.J....Kim S.W. (Clin. Endocrinol. (Oxf) 2006)
    7. Genetic variations in genes encoding RANK, RANKL, and OPG in rheumatoid arthritis: a case-control study. (PubMed id 20231205)1, 4, 9 Assmann G....Wieczorek S. (J. Rheumatol. 2010)
    8. Associations between HLA-DRB1, RANK, RANKL, OPG, and IL-17 genotypes and disease severity phenotypes in Japanese patients with early rheumatoid arthritis. (PubMed id 17876645)1, 4, 9 Furuya T....Kotake S. (Clin. Rheumatol. 2007)
    9. Variation in genes involved in the RANKL/RANK/OPG bone remodeling pathway are associated with bone mineral density at different skeletal sites in men. (PubMed id 16249885)1, 4, 9 Hsu Y.H....Xu X. (Hum. Genet. 2006)
    10. Genetic polymorphisms of OPG, RANK, and ESR1 and bone mineral density in Korean postmenopausal women. (PubMed id 16151677)1, 4, 9 Choi J.Y....Kang D. (Calcif. Tissue Int. 2005)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 4982 HGNC: 11909 AceView: TNFRSF11B Ensembl:ENSG00000164761 euGenes: HUgn4982
    ECgene: TNFRSF11B Kegg: 4982 H-InvDB: TNFRSF11B

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for TNFRSF11B Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for TNFRSF11B Genetics and Cytogenetics in Oncology and Haematology
    NIEHS-SNPshttp://egp.gs.washington.edu/data/tnfrsf11b/

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for TNFRSF11B gene:
    Search GeneIP for patents involving TNFRSF11B

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, eBioscience, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     Browse Kits and Assays available from EMD Millipore
     Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
     Browse Small Molecules at EMD Millipore
     EMD Millipore Purified and/or Recombinant TNFRSF11B Protein
     
     EMD Millipore genomic analysis products

      
     Antibodies for TNFRSF11B (Osteoprotegerin/TNFRSF11B)   Browse Cell Culture Products  
     ELISAs for TNFRSF11B (Osteoprotegerin/TNFRSF11B)   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Recombinant/Natural Proteins for TNFRSF11B (Osteoprotegerin/TNFRSF11B)   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for TNFRSF11B   OriGene RNAi products in human, mouse, rat for TNFRSF11B  
     OriGene qPCR primer pairs and template standards for TNFRSF11B   OriGene Protein Over-expression Lysate for TNFRSF11B  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for TNFRSF11B  
     OriGene qSTAR qPCR primer pairs in human, mouse for TNFRSF11B   OriGene Purified Protein for TNFRSF11B  
     OriGene ORF clones in mouse, rat for TNFRSF11B   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for TNFRSF11B   OriGene Custom Protein Services for TNFRSF11B  

     
     
     Block miRNA regulation of human, mouse, rat TNFRSF11B using miScript Target Protectors SeqTarget long-range PCR primers for resequencing TNFRSF11B
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat TNFRSF11B Predesigned siRNA for gene silencing in human, mouse, rat TNFRSF11B
     QuantiFast Probe-based Assays in human, mouse, rat TNFRSF11B QuantiTect SYBR Green Assays in human, mouse, rat TNFRSF11B
     PCR Arrays including human, mouse, rat TNFRSF11B Search Chromatin IP Primers for TNFRSF11B
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TNFRSF11B  GeneGlobe Interaction Network for TNFRSF11B
     Regulatory tfbs in TNFRSF11B promoter
     GenScript Custom Purified and Recombinant Proteins Services for TNFRSF11B GenScript cDNA clones with any tag delivered in your preferred vector for TNFRSF11B
     GenScript Custom Assay Services for TNFRSF11B GenScript Custom overexpressing Cell Line Services for TNFRSF11B
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for TNFRSF11B (TR11B)
     Proteins for TNFRSF11B
     Cell Lysates for TNFRSF11B
     cDNA Clones for TNFRSF11B
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Assays/Proteins for TNFRSF11B
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     TNFRSF11B antibodies
     TNFRSF11B proteins
     TNFRSF11B lysates
     Antibodies for TNFRSF11B
     See all of Abcam's Antibodies, Kits and Proteins for TNFRSF11B
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Recombinant Protein for TNFRSF11B
     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.



     PureStem Progenitor for TNFRSF11B: PureStem 7SMOO32, NCr-fac & Meso Progenitor
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TNFRSF11B
     SwitchGear 3'UTR luciferase reporter plasmids for TNFRSF11B
     SwitchGear Promoter luciferase reporter plasmids for TNFRSF11B
     ThermoFisher Antibody for TNFRSF11B
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TNFRSF11B
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for TNFRSF11B
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for TNFRSF11B
     LSBio Antibodies in human, mouse, rat for TNFRSF11B
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
     Search Addgene for plasmids for TNFRSF11B
      Search eBioscience for proteins for TNFRSF11B
     eBioscience elisas for TNFRSF11B (Human Osteoprotegerin Instant ELISA 128 tests)
      eBioscience FlowRNA Probe Sets
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      TNFRSF11B gene at Home site.
    Version: 3.12.224 13 Oct 2014
    hostname: 356977-web1.xennexinc.com index build: 128 solr: 1.4