Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TMEM98 Gene

Aliases for TMEM98 Gene

  • Transmembrane Protein 98 2 3 5
  • Protein TADA1 4
  • TADA1 3

External Ids for TMEM98 Gene

Previous GeneCards Identifiers for TMEM98 Gene

  • GC17P028280
  • GC17P031254
  • GC17P027440

Summaries for TMEM98 Gene

Entrez Gene Summary for TMEM98 Gene

  • This gene encodes a transmembrane protein. A missense mutation in this gene result in Nanophthalmos 4 (NNO4). Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2014]

GeneCards Summary for TMEM98 Gene

TMEM98 (Transmembrane Protein 98) is a Protein Coding gene. Diseases associated with TMEM98 include Nanophthalmos 4 and Microphthalmia.

Gene Wiki entry for TMEM98 Gene

Additional gene information for TMEM98 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TMEM98 Gene

Genomics for TMEM98 Gene

Regulatory Elements for TMEM98 Gene

Enhancers for TMEM98 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH17H032893 1.2 ENCODE dbSUPER 28.1 -33.3 -33250 2 HDAC1 PKNOX1 ATF1 TBL1XR1 ARNT TCF12 GATA2 EGR1 ATF7 ETV6 TMEM98 MYO1D ENSG00000236377 GC17P032879
GH17H032875 1.1 ENCODE 25.4 -50.1 -50108 4 PKNOX1 FOXA2 ARID4B SIN3A ZNF2 YY1 ZNF766 ZNF143 ZNF207 SP3 TMEM98 UTP6 SUZ12 ENSG00000266777 ZNF207 MYO1D LOC102724715 GC17P032879
GH17H032896 1.5 FANTOM5 ENCODE dbSUPER 17.4 -29.5 -29495 3 HDGF PKNOX1 ATF1 ARNT TCF12 ZNF766 GATA2 ELK1 ATF7 NCOA1 TMEM98 ENSG00000236377 GC17P032879
GH17H032909 1.5 Ensembl ENCODE dbSUPER 16.5 -16.5 -16501 3 HDGF PKNOX1 ATF1 FOXA2 ARNT ARID4B ZNF766 ELK1 ZNF143 ATF7 MYO1D TMEM98 ENSG00000226377 ENSG00000236377
GH17H032927 1 ENCODE 21.4 +0.6 576 2 HDGF FOXA2 MLX ARNT ZFP64 ARID4B YBX1 DMAP1 ZNF121 ZNF766 SUZ12 ZNF207 TMEM98 ENSG00000266777 LRRC37B PIR43668
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around TMEM98 on UCSC Golden Path with GeneCards custom track

Promoters for TMEM98 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

Genomic Location for TMEM98 Gene

32,927,910 bp from pter
32,945,106 bp from pter
17,197 bases
Plus strand

Genomic View for TMEM98 Gene

Genes around TMEM98 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TMEM98 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TMEM98 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TMEM98 Gene

Proteins for TMEM98 Gene

  • Protein details for TMEM98 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Transmembrane protein 98
    Protein Accession:
    Secondary Accessions:
    • E1P631
    • Q9UFK2

    Protein attributes for TMEM98 Gene

    226 amino acids
    Molecular mass:
    24611 Da
    Quaternary structure:
    No Data Available

neXtProt entry for TMEM98 Gene

Post-translational modifications for TMEM98 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for TMEM98 Gene

Domains & Families for TMEM98 Gene

Gene Families for TMEM98 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted membrane proteins

Protein Domains for TMEM98 Gene


Suggested Antigen Peptide Sequences for TMEM98 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the TMEM98 family.
  • Belongs to the TMEM98 family.
genes like me logo Genes that share domains with TMEM98: view

Function for TMEM98 Gene

Phenotypes From GWAS Catalog for TMEM98 Gene

genes like me logo Genes that share phenotypes with TMEM98: view

Human Phenotype Ontology for TMEM98 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for TMEM98 Gene

MGI Knock Outs for TMEM98:

Animal Model Products

  • Taconic Biosciences Mouse Models for TMEM98

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for TMEM98
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Transcription Factor Targets and HOMER Transcription for TMEM98 Gene

Localization for TMEM98 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TMEM98 Gene

Membrane; Single-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TMEM98 gene
Compartment Confidence
endoplasmic reticulum 5
extracellular 3
nucleus 3
cytosol 2
plasma membrane 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for TMEM98 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005783 endoplasmic reticulum IDA --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with TMEM98: view

Pathways & Interactions for TMEM98 Gene

SuperPathways for TMEM98 Gene

No Data Available

Interacting Proteins for TMEM98 Gene

Selected Interacting proteins: Q9Y2Y6-TMM98_HUMAN for TMEM98 Gene via IID MINT

Gene Ontology (GO) - Biological Process for TMEM98 Gene


No data available for Pathways by source and SIGNOR curated interactions for TMEM98 Gene

Drugs & Compounds for TMEM98 Gene

No Compound Related Data Available

Transcripts for TMEM98 Gene

Unigene Clusters for TMEM98 Gene

Transmembrane protein 98:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for TMEM98
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

Alternative Splicing Database (ASD) splice patterns (SP) for TMEM98 Gene

ExUns: 1a · 1b ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9a · 9b
SP1: - -
SP2: - -
SP3: - - -
SP4: -
SP5: - -

Relevant External Links for TMEM98 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TMEM98 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TMEM98 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for TMEM98 Gene

This gene is overexpressed in Testis (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for TMEM98 Gene

Protein tissue co-expression partners for TMEM98 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of TMEM98 Gene:


SOURCE GeneReport for Unigene cluster for TMEM98 Gene:


mRNA Expression by UniProt/SwissProt for TMEM98 Gene:

Tissue specificity: Expressed in the eye, particularly in corneal endothelium, iris, ciliary body, sclera, optic nerve, optic nerve head, and retina.

Evidence on tissue expression from TISSUES for TMEM98 Gene

  • Nervous system(4.7)
  • Muscle(4.2)
  • Eye(2.5)
  • Heart(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for TMEM98 Gene

Germ Layers:
  • ectoderm
  • mesoderm
  • nervous
  • skeletal muscle
Head and neck:
  • brain
  • cranial nerve
  • eye
  • head
  • peripheral nervous system
genes like me logo Genes that share expression patterns with TMEM98: view

Primer Products

No data available for mRNA differential expression in normal tissues for TMEM98 Gene

Orthologs for TMEM98 Gene

This gene was present in the common ancestor of animals.

Orthologs for TMEM98 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia TMEM98 33 34
  • 99.85 (n)
(Monodelphis domestica)
Mammalia TMEM98 34
  • 96 (a)
(Ornithorhynchus anatinus)
Mammalia TMEM98 34
  • 94 (a)
(Canis familiaris)
Mammalia TMEM98 33 34
  • 90.56 (n)
(Bos Taurus)
Mammalia TMEM98 33 34
  • 90.41 (n)
(Rattus norvegicus)
Mammalia Tmem98 33
  • 89.23 (n)
(Mus musculus)
Mammalia Tmem98 33 16 34
  • 88.5 (n)
(Anolis carolinensis)
Reptilia TMEM98 34
  • 85 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia tmem98 33
  • 74.48 (n)
(Danio rerio)
Actinopterygii tmem98 33 34
  • 74.5 (n)
(Caenorhabditis elegans)
Secernentea K10C3.4 34
  • 15 (a)
Species where no ortholog for TMEM98 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TMEM98 Gene

Gene Tree for TMEM98 (if available)
Gene Tree for TMEM98 (if available)

Paralogs for TMEM98 Gene Pseudogenes for TMEM98 Gene

genes like me logo Genes that share paralogs with TMEM98: view

No data available for Paralogs for TMEM98 Gene

Variants for TMEM98 Gene

Sequence variations from dbSNP and Humsavar for TMEM98 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs587777690 Pathogenic, Nanophthalmos 4 (NNO4) [MIM:615972] 32,940,889(+) CGGCT(C/G)CTGAG reference, missense
rs869312733 Pathogenic 32,940,899(+) GGAGC(A/C)TTTGG reference, missense
rs869312734 Pathogenic 32,933,278(+) TCTGG(-/AGAATGAAGACTGGATCGAAGATGCCTCGTAAGG)CCATG intron-variant
rs1000161412 -- 32,930,578(+) CAGAA(A/C/T)CTTTA intron-variant
rs1000300782 -- 32,942,065(+) AAAAT(A/G)TATTT downstream-variant-500B

Structural Variations from Database of Genomic Variants (DGV) for TMEM98 Gene

Variant ID Type Subtype PubMed ID
esv24161 CNV loss 19812545
esv2667652 CNV deletion 23128226
nsv510705 CNV deletion 20534489
nsv833417 CNV gain 17160897

Variation tolerance for TMEM98 Gene

Residual Variation Intolerance Score: 40.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.82; 34.17% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for TMEM98 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TMEM98 Gene

Disorders for TMEM98 Gene

MalaCards: The human disease database

(2) MalaCards diseases for TMEM98 Gene - From: HGMD, OMIM, ClinVar, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
nanophthalmos 4
  • nanophthalmia 4
  • microphthalmos
- elite association - COSMIC cancer census association via MalaCards


  • Nanophthalmos 4 (NNO4) [MIM:615972]: A rare disorder of eye development characterized by extreme hyperopia (farsightedness) and small functional eyes. The cornea and lens are normal in size and shape. Hyperopia occurs because insufficient growth along the visual axis places these lensing components too close to the retina. Nanophthalmic eyes show considerable thickening of both the choroidal vascular bed and scleral coat, which provide nutritive and structural support for the retina. {ECO:0000269 PubMed:24852644}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for TMEM98

Genetic Association Database (GAD)
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with TMEM98: view

No data available for Genatlas for TMEM98 Gene

Publications for TMEM98 Gene

  1. Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs. (PMID: 11230166) Wiemann S … Poustka A (Genome research 2001) 2 3 4 60
  2. Mutation in TMEM98 in a large white kindred with autosomal dominant nanophthalmos linked to 17p12-q12. (PMID: 24852644) Awadalla MS … Craig JE (JAMA ophthalmology 2014) 3 4 60
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 60
  4. The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. (PMID: 12975309) Clark HF … Gray A (Genome research 2003) 3 4 60
  5. siRNA-TMEM98 inhibits the invasion and migration of lung cancer cells. (PMID: 26884835) Mao M … Wu Z (International journal of clinical and experimental pathology 2015) 3 60

Products for TMEM98 Gene

Sources for TMEM98 Gene

Loading form....