Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TMEM50B Gene

Aliases for TMEM50B Gene

  • Transmembrane Protein 50B 2 3 5
  • HCV P7-Trans-Regulated Protein 3 3 4
  • C21orf4 3 4
  • Chromosome 21 Open Reading Frame 4 2
  • HCV P7-Transregulated Protein 3 3
  • HCVP7TP3 3

External Ids for TMEM50B Gene

Previous HGNC Symbols for TMEM50B Gene

  • C21orf4

Previous GeneCards Identifiers for TMEM50B Gene

  • GC21M033727
  • GC21M033743
  • GC21M034804
  • GC21M020291

Summaries for TMEM50B Gene

GeneCards Summary for TMEM50B Gene

TMEM50B (Transmembrane Protein 50B) is a Protein Coding gene. An important paralog of this gene is TMEM50A.

Additional gene information for TMEM50B Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TMEM50B Gene

Genomics for TMEM50B Gene

Regulatory Elements for TMEM50B Gene

Enhancers for TMEM50B Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH21H032769 1.2 ENCODE 142.8 +708.7 708658 3.9 FEZF1 DMAP1 YY1 SLC30A9 ZNF416 ZNF143 SP3 NFYC ZC3H11A ZFP41 PAXBP1 TMEM50B SON DONSON C21orf59 EVA1C URB1 MIS18A-AS1 MIS18A GART
GH21H032492 1.4 Ensembl ENCODE dbSUPER 110.9 +985.3 985331 4.6 PKNOX1 ZNF493 ZFP64 FEZF1 BATF RFX5 EGR1 ZNF350 FOS EGR2 PAXBP1 TMEM50B SCAF4 EVA1C C21orf59 URB1 MIS18A C21orf62-AS1 ENSG00000238390 ENSG00000252045
GH21H033539 1.4 ENCODE dbSUPER 70.6 -63.0 -62997 6.5 DMAP1 YY1 ZNF143 SP3 NFYC ZC3H11A MEF2D SSRP1 ZNF610 GLIS1 SON PAXBP1 TMEM50B GART DONSON C21orf140 C21orf59 PAXBP1-AS1 DNAJC28 ENSG00000231355
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around TMEM50B on UCSC Golden Path with GeneCards custom track

Promoters for TMEM50B Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000141566 211 2401 PKNOX1 ARNT ARID4B SIN3A DMAP1 ZNF2 ZBTB7B YY1 ZNF766 ZNF143

Genomic Locations for TMEM50B Gene

Genomic Locations for TMEM50B Gene
47,527 bases
Minus strand

Genomic View for TMEM50B Gene

Genes around TMEM50B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TMEM50B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TMEM50B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TMEM50B Gene

Proteins for TMEM50B Gene

  • Protein details for TMEM50B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Transmembrane protein 50B
    Protein Accession:
    Secondary Accessions:
    • B2R4L4
    • D3DSF1
    • O60537
    • Q5PY47

    Protein attributes for TMEM50B Gene

    158 amino acids
    Molecular mass:
    17936 Da
    Quaternary structure:
    No Data Available

neXtProt entry for TMEM50B Gene

Post-translational modifications for TMEM50B Gene

No Post-translational modifications

Other Protein References for TMEM50B Gene

No data available for DME Specific Peptides for TMEM50B Gene

Domains & Families for TMEM50B Gene

Gene Families for TMEM50B Gene

Human Protein Atlas (HPA):
  • Predicted membrane proteins

Protein Domains for TMEM50B Gene

Suggested Antigen Peptide Sequences for TMEM50B Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the UPF0220 family.
  • Belongs to the UPF0220 family.
genes like me logo Genes that share domains with TMEM50B: view

Function for TMEM50B Gene

Phenotypes From GWAS Catalog for TMEM50B Gene

Gene Ontology (GO) - Molecular Function for TMEM50B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with TMEM50B: view

Phenotypes for TMEM50B Gene

genes like me logo Genes that share phenotypes with TMEM50B: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for TMEM50B Gene

Localization for TMEM50B Gene

Subcellular locations from UniProtKB/Swiss-Prot for TMEM50B Gene

Membrane; Multi-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TMEM50B gene
Compartment Confidence
plasma membrane 5
endoplasmic reticulum 5

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoli fibrillar center (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for TMEM50B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005783 endoplasmic reticulum IDA --
GO:0005886 plasma membrane IDA 16780588
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with TMEM50B: view

Pathways & Interactions for TMEM50B Gene

SuperPathways for TMEM50B Gene

No Data Available

Interacting Proteins for TMEM50B Gene

Gene Ontology (GO) - Biological Process for TMEM50B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008150 biological_process ND --
genes like me logo Genes that share ontologies with TMEM50B: view

No data available for Pathways by source and SIGNOR curated interactions for TMEM50B Gene

Drugs & Compounds for TMEM50B Gene

No Compound Related Data Available

Transcripts for TMEM50B Gene

Unigene Clusters for TMEM50B Gene

Transmembrane protein 50B:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for TMEM50B Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4a · 4b · 4c ^ 5 ^ 6 ^ 7 ^ 8 ^ 9
SP1: - - -
SP3: - -

Relevant External Links for TMEM50B Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TMEM50B Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TMEM50B Gene

Protein differential expression in normal tissues from HIPED for TMEM50B Gene

This gene is overexpressed in Retina (18.1), Testis (14.3), and Frontal cortex (8.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TMEM50B Gene

NURSA nuclear receptor signaling pathways regulating expression of TMEM50B Gene:


SOURCE GeneReport for Unigene cluster for TMEM50B Gene:


Evidence on tissue expression from TISSUES for TMEM50B Gene

  • Lung(4.3)
  • Eye(4.1)
  • Nervous system(3.7)
  • Thyroid gland(2.3)
  • Kidney(2.2)
genes like me logo Genes that share expression patterns with TMEM50B: view

No data available for mRNA differential expression in normal tissues , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for TMEM50B Gene

Orthologs for TMEM50B Gene

This gene was present in the common ancestor of animals.

Orthologs for TMEM50B Gene

Organism Taxonomy Gene Similarity Type Details
(Canis familiaris)
Mammalia -- 34
  • 100 (a)
-- 34
  • 100 (a)
LOC100856546 33
  • 94.94 (n)
(Pan troglodytes)
Mammalia TMEM50B 34 33
  • 100 (n)
(Monodelphis domestica)
Mammalia TMEM50B 34
  • 97 (a)
(Ornithorhynchus anatinus)
Mammalia TMEM50B 34
  • 95 (a)
(Bos Taurus)
Mammalia TMEM50B 33 34
  • 93.46 (n)
(Mus musculus)
Mammalia Tmem50b 16 34 33
  • 87.9 (n)
(Rattus norvegicus)
Mammalia Tmem50b 33
  • 86.62 (n)
(Gallus gallus)
Aves TMEM50B 33
  • 82.59 (n)
(Anolis carolinensis)
Reptilia TMEM50B 34
  • 85 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia tmem50b 33
  • 77 (n)
Str.683 33
African clawed frog
(Xenopus laevis)
Amphibia MGC68857 33
fruit fly
(Drosophila melanogaster)
Insecta CG15012 34
  • 35 (a)
(Caenorhabditis elegans)
Secernentea Y74C10AL.2 33 34
  • 56.64 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 65 (a)
Species where no ortholog for TMEM50B was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • zebrafish (Danio rerio)

Evolution for TMEM50B Gene

Gene Tree for TMEM50B (if available)
Gene Tree for TMEM50B (if available)

Paralogs for TMEM50B Gene

Paralogs for TMEM50B Gene

(2) SIMAP similar genes for TMEM50B Gene using alignment to 4 proteins: Pseudogenes for TMEM50B Gene

genes like me logo Genes that share paralogs with TMEM50B: view

Variants for TMEM50B Gene

Sequence variations from dbSNP and Humsavar for TMEM50B Gene

SNP ID Clin Chr 21 pos Sequence Context AA Info Type
rs587776823 Pathogenic 33,432,278(+) AAAAG(-/TAACATCTTTAGAGTCGGGCATTTAAG)CAACA downstream-variant-500B, cds-indel
rs193922682 Uncertain significance 33,432,890(+) CATCT(-/C)TTTTT intron-variant
rs121913211 untested 33,432,084(+) GTTGT(C/T)GTGTT intron-variant, downstream-variant-500B
rs121913212 untested 33,432,323(+) TACGA(A/T)ACAAT downstream-variant-500B, reference, missense
rs121913213 untested 33,432,425(+) ATGGG(C/T)GGTGG intron-variant, downstream-variant-500B

Structural Variations from Database of Genomic Variants (DGV) for TMEM50B Gene

Variant ID Type Subtype PubMed ID
dgv7819n54 CNV loss 21841781
esv1009907 CNV insertion 20482838
esv1700579 CNV insertion 17803354
esv3557650 CNV deletion 23714750
esv3893406 CNV loss 25118596
nsv1139017 CNV deletion 24896259
nsv191 CNV insertion 15895083
nsv3497 CNV insertion 18451855
nsv479869 CNV novel sequence insertion 20440878
nsv509795 CNV insertion 20534489
nsv524420 CNV loss 19592680
nsv528264 CNV gain 19592680
nsv587396 CNV loss 21841781
nsv834087 CNV gain 17160897

Variation tolerance for TMEM50B Gene

Residual Variation Intolerance Score: 53.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.42; 9.18% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for TMEM50B Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TMEM50B Gene

Disorders for TMEM50B Gene

Relevant External Links for TMEM50B

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for TMEM50B Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TMEM50B Gene

Publications for TMEM50B Gene

  1. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 60
  2. The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. (PMID: 12975309) Clark HF … Gray A (Genome research 2003) 3 4 60
  3. Comparative genomic analysis of the interferon/interleukin-10 receptor gene cluster. (PMID: 10077530) Reboul J … Lutfalla G (Genome research 1999) 3 4 60
  4. Common genetic variants associated with cognitive performance identified using the proxy-phenotype method. (PMID: 25201988) Rietveld CA … Koellinger PD (Proceedings of the National Academy of Sciences of the United States of America 2014) 3 60
  5. Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (PMID: 23128233) Jostins L … Cho JH (Nature 2012) 3 60

Products for TMEM50B Gene

Sources for TMEM50B Gene

Loading form....