Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TMEM5-AS1 Gene

Subcategory (RNA class) for TMEM5-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for TMEM5-AS1 Gene

  • TMEM5 Antisense RNA 1 2 3 5

External Ids for TMEM5-AS1 Gene

Previous GeneCards Identifiers for TMEM5-AS1 Gene

  • GC12M064203
  • GC00U935938

Summaries for TMEM5-AS1 Gene

GeneCards Summary for TMEM5-AS1 Gene

TMEM5-AS1 (TMEM5 Antisense RNA 1) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for TMEM5-AS1 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TMEM5-AS1 Gene

Genomics for TMEM5-AS1 Gene

GeneHancer (GH) Regulatory Elements for TMEM5-AS1 Gene

Promoters and enhancers for TMEM5-AS1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12I063821 Promoter/Enhancer 1 Ensembl ENCODE 550.8 -0.4 -367 1.9 ZNF202 FOXA2 POLR2A YY1 TEAD3 PABPC1P4 TMEM5-AS1 TBK1 RPS11P6 XPOT LOC100420899 RNU6-1009P GC12M063829
GH12I063814 Enhancer 0.5 ENCODE 0.4 +7.3 7324 1.1 IKZF1 TRIM22 JUNB ELF1 IKZF2 RUNX3 RELA RXYLT1 TMEM5-AS1 PABPC1P4 ENSG00000249753
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TMEM5-AS1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for TMEM5-AS1 Gene

Genomic Locations for TMEM5-AS1 Gene
chr12:63,808,845-63,822,156
(GRCh38/hg38)
Size:
13,312 bases
Orientation:
Minus strand

Genomic View for TMEM5-AS1 Gene

Genes around TMEM5-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TMEM5-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TMEM5-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TMEM5-AS1 Gene

Proteins for TMEM5-AS1 Gene

Post-translational modifications for TMEM5-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for TMEM5-AS1 Gene

Domains & Families for TMEM5-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for TMEM5-AS1 Gene

Function for TMEM5-AS1 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for TMEM5-AS1 Gene

Localization for TMEM5-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for TMEM5-AS1 Gene

Pathways & Interactions for TMEM5-AS1 Gene

SuperPathways for TMEM5-AS1 Gene

No Data Available

Interacting Proteins for TMEM5-AS1 Gene

Gene Ontology (GO) - Biological Process for TMEM5-AS1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for TMEM5-AS1 Gene

Drugs & Compounds for TMEM5-AS1 Gene

No Compound Related Data Available

Transcripts for TMEM5-AS1 Gene

mRNA/cDNA for TMEM5-AS1 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for TMEM5-AS1 Gene

No ASD Table

Relevant External Links for TMEM5-AS1 Gene

GeneLoc Exon Structure for
TMEM5-AS1
ECgene alternative splicing isoforms for
TMEM5-AS1

Expression for TMEM5-AS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TMEM5-AS1 Gene

genes like me logo Genes that share expression patterns with TMEM5-AS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for TMEM5-AS1 Gene

Orthologs for TMEM5-AS1 Gene

Evolution for TMEM5-AS1 Gene

ENSEMBL:
Gene Tree for TMEM5-AS1 (if available)
TreeFam:
Gene Tree for TMEM5-AS1 (if available)

No data available for Orthologs for TMEM5-AS1 Gene

Paralogs for TMEM5-AS1 Gene

No data available for Paralogs for TMEM5-AS1 Gene

Variants for TMEM5-AS1 Gene

Sequence variations from dbSNP and Humsavar for TMEM5-AS1 Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs141536395 benign, not specified, Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type a, 10 63,808,986(-) A/G intron_variant
rs144060489 uncertain-significance, not specified, Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type a, 10 63,808,851(-) A/C non_coding_transcript_variant
rs150736997 pathogenic, Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type a, 10 63,808,776(-) A/G downstream_transcript_variant
rs397514544 pathogenic, Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type a, 10 63,808,779(-) GA/TT downstream_transcript_variant
rs397514545 pathogenic, Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type a, 10 63,808,824(-) ACGTGATGACAGCTGGCAACTGTGGGAA/ downstream_transcript_variant, non_coding_transcript_variant

Additional Variant Information for TMEM5-AS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
TMEM5-AS1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) and Variation tolerance for TMEM5-AS1 Gene

Disorders for TMEM5-AS1 Gene

Additional Disease Information for TMEM5-AS1

No disorders were found for TMEM5-AS1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TMEM5-AS1 Gene

Publications for TMEM5-AS1 Gene

  1. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K … Sugano S (Genome research 2006) 3 58

Products for TMEM5-AS1 Gene

Sources for TMEM5-AS1 Gene

Content
Loading form....