Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TMEM5 Gene

Aliases for TMEM5 Gene

  • Transmembrane Protein 5 2 3 4 5
  • UDP-D-Xylose:Ribitol-5-Phosphate Beta1,4-Xylosyltransferase 3
  • Type II Membrane Protein 3
  • EC 2.4.2.- 4
  • HP10481 3
  • MDDGA10 3

External Ids for TMEM5 Gene

Previous GeneCards Identifiers for TMEM5 Gene

  • GC12P064228
  • GC12P062459
  • GC12P064173
  • GC12P061224

Summaries for TMEM5 Gene

Entrez Gene Summary for TMEM5 Gene

  • This gene encodes a type II transmembrane protein that is thought to have glycosyltransferase function. Mutations in this gene result in cobblestone lissencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]

GeneCards Summary for TMEM5 Gene

TMEM5 (Transmembrane Protein 5) is a Protein Coding gene. Diseases associated with TMEM5 include Muscular Dystrophy-Dystroglycanopathy , Type A, 10 and Congenital Muscular Dystrophy-Dystroglycanopathy With Brain And Eye Anomalies Type A 10. Among its related pathways are Mannose type O-glycan biosynthesis and Metabolism.

UniProtKB/Swiss-Prot for TMEM5 Gene

  • UDP-xylosyltransferase involved in the biosynthesis of the phosphorylated O-mannosyl trisaccharide (N-acetylgalactosamine-beta-3-N-acetylglucosamine-beta-4-(phosphate-6-)mannose), a carbohydrate structure present in alpha-dystroglycan (DAG1), which is required for binding laminin G-like domain-containing extracellular proteins with high affinity (PubMed:25279699, PubMed:27130732, PubMed:27733679, PubMed:27601598). Acts as a UDP-D-xylose:ribitol-5-phosphate beta1,4-xylosyltransferase, which catalyzes the transfer of UDP-D-xylose to ribitol 5-phosphate (Rbo5P) to form the Xylbeta1-4Rbo5P linkage on O-mannosyl glycan (PubMed:27130732, PubMed:27733679).

Additional gene information for TMEM5 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TMEM5 Gene

Genomics for TMEM5 Gene

Regulatory Elements for TMEM5 Gene

Enhancers for TMEM5 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH12H062933 1.4 ENCODE dbSUPER 10.6 -845.3 -845271 2 PKNOX1 FOXA2 MLX ZFP64 ARID4B SIN3A FEZF1 DMAP1 ZNF2 ZBTB7B MON2 ENSG00000257354 TMEM5 PPM1H RNU1-83P GC12M062851
GH12H063420 0.9 ENCODE 9.7 -359.4 -359448 0 PKNOX1 INSM2 KLF17 FEZF1 ZNF2 RAD21 TCF12 CBX5 ZNF302 ZSCAN5C PABPC1P4 TMEM5 GC12M063412 ENSG00000258117
GH12H063779 1.1 ENCODE 5.5 +0.4 379 1 PKNOX1 ATF1 ARID4B SIN3A DMAP1 ZNF2 GLIS2 ELK1 ZNF143 ZNF207 PABPC1P4 LOC100420899 TMEM5 ENSG00000249753
GH12H063814 0.6 ENCODE 5 +35.0 35029 1 IKZF1 TRIM22 JUNB ELF1 RUNX3 IKZF2 RELA TMEM5 PABPC1P4 ENSG00000249753
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around TMEM5 on UCSC Golden Path with GeneCards custom track

Promoters for TMEM5 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000053080 397 1601 PKNOX1 ARID4B SIN3A DMAP1 ZNF2 ZNF143 ZNF207 SP3 ZHX2 MXD4

Genomic Location for TMEM5 Gene

63,779,803 bp from pter
63,809,558 bp from pter
29,756 bases
Plus strand

Genomic View for TMEM5 Gene

Genes around TMEM5 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TMEM5 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TMEM5 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TMEM5 Gene

Proteins for TMEM5 Gene

  • Protein details for TMEM5 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    UDP-D-xylose:ribitol-5-phosphate beta1,4-xylosyltransferase
    Protein Accession:
    Secondary Accessions:
    • A8K017
    • Q6PKD6

    Protein attributes for TMEM5 Gene

    443 amino acids
    Molecular mass:
    51146 Da
    Quaternary structure:
    No Data Available
    • Sequence=AAH02596.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305};

neXtProt entry for TMEM5 Gene

Post-translational modifications for TMEM5 Gene

  • Glycosylation at Ser91
  • Modification sites at PhosphoSitePlus

Other Protein References for TMEM5 Gene

No data available for DME Specific Peptides for TMEM5 Gene

Domains & Families for TMEM5 Gene

Gene Families for TMEM5 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for TMEM5 Gene


Suggested Antigen Peptide Sequences for TMEM5 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the TMEM5 family.
  • Belongs to the TMEM5 family.
genes like me logo Genes that share domains with TMEM5: view

Function for TMEM5 Gene

Molecular function for TMEM5 Gene

UniProtKB/Swiss-Prot Function:
UDP-xylosyltransferase involved in the biosynthesis of the phosphorylated O-mannosyl trisaccharide (N-acetylgalactosamine-beta-3-N-acetylglucosamine-beta-4-(phosphate-6-)mannose), a carbohydrate structure present in alpha-dystroglycan (DAG1), which is required for binding laminin G-like domain-containing extracellular proteins with high affinity (PubMed:25279699, PubMed:27130732, PubMed:27733679, PubMed:27601598). Acts as a UDP-D-xylose:ribitol-5-phosphate beta1,4-xylosyltransferase, which catalyzes the transfer of UDP-D-xylose to ribitol 5-phosphate (Rbo5P) to form the Xylbeta1-4Rbo5P linkage on O-mannosyl glycan (PubMed:27130732, PubMed:27733679).

Enzyme Numbers (IUBMB) for TMEM5 Gene

genes like me logo Genes that share phenotypes with TMEM5: view

Human Phenotype Ontology for TMEM5 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

  • Taconic Biosciences Mouse Models for TMEM5

CRISPR Products

miRNA for TMEM5 Gene

miRTarBase miRNAs that target TMEM5

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for TMEM5
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

No data available for Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Animal Models , Transcription Factor Targets and HOMER Transcription for TMEM5 Gene

Localization for TMEM5 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TMEM5 Gene

Golgi apparatus membrane; Single-pass type II membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TMEM5 gene
Compartment Confidence
plasma membrane 5
nucleus 5
golgi apparatus 5
extracellular 1
peroxisome 1
endoplasmic reticulum 1
cytosol 1
lysosome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Golgi apparatus (2)
  • Nucleoplasm (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for TMEM5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000139 Golgi membrane IEA --
GO:0005654 nucleoplasm IDA --
GO:0005794 Golgi apparatus IEA,IDA 25279699
GO:0005887 integral component of plasma membrane TAS 10072769
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with TMEM5: view

Pathways & Interactions for TMEM5 Gene

genes like me logo Genes that share pathways with TMEM5: view

Pathways by source for TMEM5 Gene

UniProtKB/Swiss-Prot Q9Y2B1-TMEM5_HUMAN

  • Pathway: Protein modification; protein glycosylation.

Interacting Proteins for TMEM5 Gene

Selected Interacting proteins: Q9Y2B1-TMEM5_HUMAN for TMEM5 Gene via IID

Symbol External ID(s) Details

Gene Ontology (GO) - Biological Process for TMEM5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006486 protein glycosylation IEA --
GO:0035269 protein O-linked mannosylation IMP 25279699
genes like me logo Genes that share ontologies with TMEM5: view

No data available for SIGNOR curated interactions for TMEM5 Gene

Drugs & Compounds for TMEM5 Gene

No Compound Related Data Available

Transcripts for TMEM5 Gene

Unigene Clusters for TMEM5 Gene

Transmembrane protein 5:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for TMEM5
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

Alternative Splicing Database (ASD) splice patterns (SP) for TMEM5 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7
SP1: - - -
SP2: -

Relevant External Links for TMEM5 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TMEM5 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TMEM5 Gene

Protein differential expression in normal tissues from HIPED for TMEM5 Gene

This gene is overexpressed in Prostate (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for TMEM5 Gene

Protein tissue co-expression partners for TMEM5 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of TMEM5 Gene:


SOURCE GeneReport for Unigene cluster for TMEM5 Gene:


Evidence on tissue expression from TISSUES for TMEM5 Gene

  • Adrenal gland(4.2)
  • Skin(4.2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for TMEM5 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • endocrine
  • integumentary
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Head and neck:
  • brain
  • cerebellum
  • cerebrospinal fluid
  • cheek
  • chin
  • cranial nerve
  • ear
  • eye
  • face
  • forehead
  • head
  • inner ear
  • jaw
  • lip
  • mandible
  • maxilla
  • meninges
  • middle ear
  • mouth
  • neck
  • nose
  • outer ear
  • pituitary gland
  • skull
  • tongue
  • breast
  • chest wall
  • clavicle
  • heart
  • heart valve
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
  • intestine
  • kidney
  • large intestine
  • anus
  • ovary
  • pelvis
  • penis
  • prostate
  • rectum
  • testicle
  • ureter
  • uterus
  • vagina
  • vulva
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
  • blood
  • blood vessel
  • hair
  • peripheral nerve
  • peripheral nervous system
  • red blood cell
  • skin
  • spinal column
  • spinal cord
  • vertebrae
genes like me logo Genes that share expression patterns with TMEM5: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for TMEM5 Gene

Orthologs for TMEM5 Gene

This gene was present in the common ancestor of chordates.

Orthologs for TMEM5 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia TMEM5 33 34
  • 99.7 (n)
(Bos Taurus)
Mammalia TMEM5 33 34
  • 88.26 (n)
(Rattus norvegicus)
Mammalia Tmem5 33
  • 85.82 (n)
(Mus musculus)
Mammalia Tmem5 33 16 34
  • 85.67 (n)
(Canis familiaris)
Mammalia TMEM5 34
  • 80 (a)
(Ornithorhynchus anatinus)
Mammalia TMEM5 34
  • 71 (a)
(Gallus gallus)
Aves TMEM5 33 34
  • 73.17 (n)
(Anolis carolinensis)
Reptilia TMEM5 34
  • 62 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia tmem5 33
  • 61.27 (n)
Str.15588 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.29709 33
(Danio rerio)
Actinopterygii tmem5 33 34
  • 56.52 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 34 (a)
Species where no ortholog for TMEM5 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for TMEM5 Gene

Gene Tree for TMEM5 (if available)
Gene Tree for TMEM5 (if available)

Paralogs for TMEM5 Gene

No data available for Paralogs for TMEM5 Gene

Variants for TMEM5 Gene

Sequence variations from dbSNP and Humsavar for TMEM5 Gene

SNP ID Clin Chr 12 pos Sequence Context AA Info Type
rs150736997 Pathogenic, Muscular dystrophy-dystroglycanopathy congenital with brain and eye anomalies A10 (MDDGA10) [MIM:615041] 63,808,776(+) ATGCT(A/G)TCGAA nc-transcript-variant, downstream-variant-500B, reference, missense
rs397514544 Muscular dystrophy-dystroglycanopathy congenital with brain and eye anomalies A10 (MDDGA10) [MIM:615041]
rs397514543 Pathogenic 63,805,285(+) GATGA(-/G)AGGCC nc-transcript-variant, reference, frameshift-variant
rs397514545 Pathogenic 63,808,824(+) GGAAG(-/ACGTGATGACAGCTGGCAACTGTGGGAA)TACAT nc-transcript-variant, reference, frameshift-variant
rs397514546 Pathogenic 63,781,128(+) ACGAA(-/A)GGAAA nc-transcript-variant, reference, frameshift-variant, utr-variant-5-prime

Structural Variations from Database of Genomic Variants (DGV) for TMEM5 Gene

Variant ID Type Subtype PubMed ID
esv2751110 CNV gain 17911159
esv2759905 CNV gain 17122850
esv3629762 CNV loss 21293372
nsv1046836 CNV gain 25217958
nsv746 CNV deletion 18451855
nsv832441 CNV loss 17160897

Variation tolerance for TMEM5 Gene

Residual Variation Intolerance Score: 54.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.61; 65.40% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for TMEM5 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TMEM5 Gene

Disorders for TMEM5 Gene

MalaCards: The human disease database

(7) MalaCards diseases for TMEM5 Gene - From: HGMD, OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
muscular dystrophy-dystroglycanopathy , type a, 10
  • mddga10
congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies type a 10
  • muscular dystrophy-dystroglycanopathy , type a, 10
walker-warburg syndrome
  • cerebroocular dysplasia-muscular dystrophy syndrome
cobblestone lissencephaly
- elite association - COSMIC cancer census association via MalaCards
Search TMEM5 in MalaCards View complete list of genes associated with diseases


  • Muscular dystrophy-dystroglycanopathy congenital with brain and eye anomalies A10 (MDDGA10) [MIM:615041]: An autosomal recessive disorder characterized by congenital muscular dystrophy associated with cobblestone lissencephaly and other brain anomalies, eye malformations, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. {ECO:0000269 PubMed:23217329, ECO:0000269 PubMed:23519211, ECO:0000269 PubMed:27130732, ECO:0000269 PubMed:27212206, ECO:0000269 PubMed:27733679}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for TMEM5

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with TMEM5: view

No data available for Genatlas for TMEM5 Gene

Publications for TMEM5 Gene

  1. The functional O-mannose glycan on α-dystroglycan contains a phospho-ribitol primed for matriglycan addition. (PMID: 27130732) Praissman JL … Wells L (eLife 2016) 2 3 4 60
  2. The Muscular Dystrophy Gene TMEM5 Encodes a Ribitol β1,4-Xylosyltransferase Required for the Functional Glycosylation of Dystroglycan. (PMID: 27733679) Manya H … Endo T (The Journal of biological chemistry 2016) 2 3 4 60
  3. Identification of mutations in TMEM5 and ISPD as a cause of severe cobblestone lissencephaly. (PMID: 23217329) Vuillaumier-Barrot S … Seta N (American journal of human genetics 2012) 2 3 4 60
  4. The glucuronyltransferase B4GAT1 is required for initiation of LARGE-mediated α-dystroglycan functional glycosylation. (PMID: 25279699) Willer T … Campbell KP (eLife 2014) 3 4 60
  5. Deciphering the glycosylome of dystroglycanopathies using haploid screens for lassa virus entry. (PMID: 23519211) Jae LT … Brummelkamp TR (Science (New York, N.Y.) 2013) 3 4 60

Products for TMEM5 Gene

Sources for TMEM5 Gene

Loading form....