Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TMEM260 Gene

Aliases for TMEM260 Gene

  • Transmembrane Protein 260 2 3 5
  • C14orf101 3 4
  • Chromosome 14 Open Reading Frame 101 2
  • UPF0679 Protein C14orf101 3
  • SHDRA 3

External Ids for TMEM260 Gene

Previous HGNC Symbols for TMEM260 Gene

  • C14orf101

Previous GeneCards Identifiers for TMEM260 Gene

  • GC14P056956

Summaries for TMEM260 Gene

GeneCards Summary for TMEM260 Gene

TMEM260 (Transmembrane Protein 260) is a Protein Coding gene. Diseases associated with TMEM260 include Structural Heart Defects And Renal Anomalies Syndrome and Tetralogy Of Fallot.

Additional gene information for TMEM260 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TMEM260 Gene

Genomics for TMEM260 Gene

GeneHancer (GH) Regulatory Elements for TMEM260 Gene

Promoters and enhancers for TMEM260 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH14I056578 Promoter/Enhancer 2.2 EPDnew FANTOM5 Ensembl ENCODE 558.1 +91.8 91788 2.4 PKNOX1 CLOCK ARNT ARID4B SIN3A FEZF1 DMAP1 ZBTB7B YY1 POLR2B TMEM260 LOC105370515 PELI2 LOC101927690
GH14I056487 Enhancer 0.4 ENCODE 550.8 -0.9 -946 0 CTCF ZNF654 SMC3 TMEM260 LOC105370514
GH14I056488 Enhancer 0.4 ENCODE 550.8 -0.7 -736 0.2 CTCF SP7 TMEM260 LOC105370514
GH14I056489 Enhancer 0.4 ENCODE 550.8 -0.4 -376 0.3 HLF FOXP2 SP7 TMEM260 LOC105370514
GH14I056952 Enhancer 1.2 VISTA UCNEbase ENCODE 12.4 +465.2 465155 2.4 CTCF ZNF350 TMEM260 LOC105370515 RPL3P3 GC14P056899 OTX2-AS1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TMEM260 on UCSC Golden Path with GeneCards custom track

Genomic Locations for TMEM260 Gene

Genomic Locations for TMEM260 Gene
chr14:56,488,354-56,651,884
(GRCh38/hg38)
Size:
163,531 bases
Orientation:
Plus strand
chr14:56,955,072-57,117,324
(GRCh37/hg19)

Genomic View for TMEM260 Gene

Genes around TMEM260 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TMEM260 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TMEM260 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TMEM260 Gene

Proteins for TMEM260 Gene

  • Protein details for TMEM260 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9NX78-TM260_HUMAN
    Recommended name:
    Transmembrane protein 260
    Protein Accession:
    Q9NX78
    Secondary Accessions:
    • A8KAN4
    • B3KPF5
    • Q0VAA1
    • Q86XE1

    Protein attributes for TMEM260 Gene

    Size:
    707 amino acids
    Molecular mass:
    79536 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=BAA91139.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=BC045556; Type=Frameshift; Positions=212; Evidence={ECO:0000305};

    Alternative splice isoforms for TMEM260 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for TMEM260 Gene

Post-translational modifications for TMEM260 Gene

No Post-translational modifications

No data available for DME Specific Peptides for TMEM260 Gene

Domains & Families for TMEM260 Gene

Gene Families for TMEM260 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Predicted membrane proteins

Protein Domains for TMEM260 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for TMEM260 Gene

Graphical View of Domain Structure for InterPro Entry

Q9NX78

UniProtKB/Swiss-Prot:

TM260_HUMAN :
  • Belongs to the TMEM260 family.
Family:
  • Belongs to the TMEM260 family.
genes like me logo Genes that share domains with TMEM260: view

Function for TMEM260 Gene

Phenotypes From GWAS Catalog for TMEM260 Gene

Phenotypes for TMEM260 Gene

genes like me logo Genes that share phenotypes with TMEM260: view

Human Phenotype Ontology for TMEM260 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

miRNA for TMEM260 Gene

miRTarBase miRNAs that target TMEM260

Inhibitory RNA Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Animal Models , Transcription Factor Targets and HOMER Transcription for TMEM260 Gene

Localization for TMEM260 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TMEM260 Gene

Membrane; Multi-pass membrane protein.
Isoform 1: Membrane. Note=Shows strong localization in the vicinity of the cell membrane. {ECO:0000269 PubMed:28318500}.
Isoform 3: Membrane. Note=Shows perinuclear localization. {ECO:0000269 PubMed:28318500}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TMEM260 gene
Compartment Confidence
plasma membrane 3

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Focal adhesion sites (2)
  • Nucleus (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for TMEM260 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with TMEM260: view

Pathways & Interactions for TMEM260 Gene

SuperPathways for TMEM260 Gene

No Data Available

Gene Ontology (GO) - Biological Process for TMEM260 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for TMEM260 Gene

Drugs & Compounds for TMEM260 Gene

No Compound Related Data Available

Transcripts for TMEM260 Gene

Unigene Clusters for TMEM260 Gene

Transmembrane protein 260:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TMEM260 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8a · 8b ^ 9 ^ 10a · 10b ^ 11 ^ 12 ^ 13 ^ 14a · 14b · 14c
SP1: - -
SP2: - - -
SP3: - - -
SP4: - -
SP5: -

Relevant External Links for TMEM260 Gene

GeneLoc Exon Structure for
TMEM260
ECgene alternative splicing isoforms for
TMEM260

Expression for TMEM260 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TMEM260 Gene

Protein differential expression in normal tissues from HIPED for TMEM260 Gene

This gene is overexpressed in Cervix (58.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TMEM260 Gene



Protein tissue co-expression partners for TMEM260 Gene

NURSA nuclear receptor signaling pathways regulating expression of TMEM260 Gene:

TMEM260

SOURCE GeneReport for Unigene cluster for TMEM260 Gene:

Hs.497253

mRNA Expression by UniProt/SwissProt for TMEM260 Gene:

Q9NX78-TM260_HUMAN
Tissue specificity: Isoform 1 and isoform 3 are expressed in brain, heart, kidney, liver, lung, pancreas and placenta but are not detected in skeletal muscle.

Evidence on tissue expression from TISSUES for TMEM260 Gene

  • Nervous system(4.5)
  • Intestine(4.1)
genes like me logo Genes that share expression patterns with TMEM260: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for TMEM260 Gene

Orthologs for TMEM260 Gene

This gene was present in the common ancestor of chordates.

Orthologs for TMEM260 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia TMEM260 33
  • 99.29 (n)
C14H14ORF101 34
  • 99 (a)
OneToOne
dog
(Canis familiaris)
Mammalia TMEM260 33 34
  • 91.04 (n)
cow
(Bos Taurus)
Mammalia TMEM260 33 34
  • 90.49 (n)
mouse
(Mus musculus)
Mammalia Tmem260 33 16 34
  • 83.74 (n)
rat
(Rattus norvegicus)
Mammalia Tmem260 33
  • 82.88 (n)
oppossum
(Monodelphis domestica)
Mammalia TMEM260 34
  • 80 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia TMEM260 34
  • 75 (a)
OneToOne
chicken
(Gallus gallus)
Aves C5H14ORF101 33
  • 72.21 (n)
TMEM260 34
  • 69 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia TMEM260 34
  • 67 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia tmem260 33
  • 67.62 (n)
zebrafish
(Danio rerio)
Actinopterygii LOC559650 33
  • 56.66 (n)
tmem260 34
  • 49 (a)
OneToOne
Species where no ortholog for TMEM260 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for TMEM260 Gene

ENSEMBL:
Gene Tree for TMEM260 (if available)
TreeFam:
Gene Tree for TMEM260 (if available)

Paralogs for TMEM260 Gene

(1) SIMAP similar genes for TMEM260 Gene using alignment to 9 proteins:

genes like me logo Genes that share paralogs with TMEM260: view

No data available for Paralogs for TMEM260 Gene

Variants for TMEM260 Gene

Sequence variations from dbSNP and Humsavar for TMEM260 Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs1085307449 pathogenic, Structural heart defects and renal anomalies syndrome 56,633,142(+) TATCTAT/TAT coding_sequence_variant, frameshift, genic_downstream_transcript_variant, non_coding_transcript_variant
rs201956469 pathogenic, Structural heart defects and renal anomalies syndrome 56,621,697(+) C/T coding_sequence_variant, intron_variant, non_coding_transcript_variant, stop_gained
rs1000000539 -- 56,617,633(+) C/T intron_variant
rs1000013854 -- 56,639,255(+) AGGGTAACTACAGCCAACAA/A genic_downstream_transcript_variant, intron_variant
rs1000077251 -- 56,616,772(+) A/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for TMEM260 Gene

Variant ID Type Subtype PubMed ID
nsv1151097 CNV duplication 26484159

Variation tolerance for TMEM260 Gene

Residual Variation Intolerance Score: 66.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 7.00; 80.07% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TMEM260 Gene

Human Gene Mutation Database (HGMD)
TMEM260
SNPedia medical, phenotypic, and genealogical associations of SNPs for
TMEM260

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TMEM260 Gene

Disorders for TMEM260 Gene

MalaCards: The human disease database

(2) MalaCards diseases for TMEM260 Gene - From: HGMD, ClinVar, and GeneCards

- elite association - COSMIC cancer census association via MalaCards

UniProtKB/Swiss-Prot

TM260_HUMAN
  • Structural heart defects and renal anomalies syndrome (SHDRA) [MIM:617478]: An autosomal recessive syndrome characterized by central nervous system, cardiac, renal, and digit abnormalities. Clinical features include ventricular and atrial septal defects, truncus arteriosus, tetralogy of Fallot, partial anomalous pulmonary venous return, renal cysts, renal failure, and generalized edema. Some patients show partial agenesis of corpus callosum. {ECO:0000269 PubMed:28318500}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for TMEM260

genes like me logo Genes that share disorders with TMEM260: view

No data available for Genatlas for TMEM260 Gene

Publications for TMEM260 Gene

  1. Mutations in TMEM260 Cause a Pediatric Neurodevelopmental, Cardiac, and Renal Syndrome. (PMID: 28318500) Ta-Shma A … Davis EE (American journal of human genetics 2017) 3 4 58
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  4. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
  5. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin EL … Gygi SP (Cell 2015) 3 58

Products for TMEM260 Gene

Sources for TMEM260 Gene

Content
Loading form....