Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TMEM256 Gene

Aliases for TMEM256 Gene

  • Transmembrane Protein 256 2 3 5
  • C17orf61 3 4
  • Chromosome 17 Open Reading Frame 61 2
  • UPF0451 Protein C17orf61 3

External Ids for TMEM256 Gene

Previous HGNC Symbols for TMEM256 Gene

  • C17orf61

Previous GeneCards Identifiers for TMEM256 Gene

  • GC17M007307

Summaries for TMEM256 Gene

GeneCards Summary for TMEM256 Gene

TMEM256 (Transmembrane Protein 256) is a Protein Coding gene. Diseases associated with TMEM256 include Meckel Syndrome 1. An important paralog of this gene is TMEM256-PLSCR3.

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TMEM256 Gene

Genomics for TMEM256 Gene

Regulatory Elements for TMEM256 Gene

Enhancers for TMEM256 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH17G007465 1.3 Ensembl ENCODE dbSUPER 11.1 -62.9 -62891 2.2 HDAC1 ESRRA ZNF175 BCL11B YY1 HIC1 POLR2A NCOR1 RCOR1 NR2F6 CHRNB1 FGF11 TMEM102 C17orf74 SPEM1 TNFSF12 TNFSF12-TNFSF13 NLGN2 TMEM256 PLSCR3
GH17G007454 1.3 ENCODE dbSUPER 10.8 -51.8 -51844 2.0 HDGF PKNOX1 ATF1 CREB3L1 AGO1 ZNF493 ZFP64 SIN3A FEZF1 YY1 DVL2 CHRNB1 NLGN2 NEURL4 ENSG00000265749 PFAS SENP3 FGF11 CTC1 ZBTB4
GH17G007472 1 Ensembl dbSUPER 11 -68.0 -67964 0.2 ZFP64 ZNF140 ZNF266 ZNF101 ZNF697 ZNF433 ZNF202 ZBTB11 ZNF426 ZBTB8A NLGN2 ENSG00000265749 DVL2 CHRNB1 FGF11 TMEM102 C17orf74 SPEM1 MIR497HG TMEM256
GH17G007380 0.8 ENCODE 11.7 +23.0 22966 1.4 ELF3 TBP RB1 AGO1 ARID4B FOS PCBP1 SP5 ELF1 ZNF579 CHRNB1 KCTD11 TMEM95 NLGN2 TMEM256 SPEM1 C17orf74 ACAP1 NEURL4 ENSG00000224647
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around TMEM256 on UCSC Golden Path with GeneCards custom track

Promoters for TMEM256 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

Genomic Location for TMEM256 Gene

7,402,974 bp from pter
7,404,137 bp from pter
1,164 bases
Minus strand

Genomic View for TMEM256 Gene

Genes around TMEM256 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TMEM256 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TMEM256 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TMEM256 Gene

Proteins for TMEM256 Gene

  • Protein details for TMEM256 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Transmembrane protein 256
    Protein Accession:

    Protein attributes for TMEM256 Gene

    113 amino acids
    Molecular mass:
    11742 Da
    Quaternary structure:
    No Data Available

neXtProt entry for TMEM256 Gene

Post-translational modifications for TMEM256 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for TMEM256 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for TMEM256 Gene

Domains & Families for TMEM256 Gene

Protein Domains for TMEM256 Gene

Suggested Antigen Peptide Sequences for TMEM256 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the TMEM256 family.
  • Belongs to the TMEM256 family.
genes like me logo Genes that share domains with TMEM256: view

No data available for Gene Families for TMEM256 Gene

Function for TMEM256 Gene

Gene Ontology (GO) - Molecular Function for TMEM256 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with TMEM256: view

Phenotypes for TMEM256 Gene

genes like me logo Genes that share phenotypes with TMEM256: view

Animal Models for TMEM256 Gene

MGI Knock Outs for TMEM256:

Animal Model Products

CRISPR Products

miRNA for TMEM256 Gene

miRTarBase miRNAs that target TMEM256

Inhibitory RNA Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for TMEM256 Gene

Localization for TMEM256 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TMEM256 Gene

Membrane; Multi-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TMEM256 gene
Compartment Confidence
extracellular 5
mitochondrion 2
plasma membrane 1
nucleus 1
cytosol 1

Gene Ontology (GO) - Cellular Components for TMEM256 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
GO:0070062 extracellular exosome IDA 19056867
genes like me logo Genes that share ontologies with TMEM256: view

Pathways & Interactions for TMEM256 Gene

SuperPathways for TMEM256 Gene

No Data Available

Gene Ontology (GO) - Biological Process for TMEM256 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008150 biological_process ND --
genes like me logo Genes that share ontologies with TMEM256: view

No data available for Pathways by source and SIGNOR curated interactions for TMEM256 Gene

Drugs & Compounds for TMEM256 Gene

No Compound Related Data Available

Transcripts for TMEM256 Gene

mRNA/cDNA for TMEM256 Gene

(1) REFSEQ mRNAs :
(1) Additional mRNA sequences :
(267) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for TMEM256 Gene

Transmembrane protein 256:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TMEM256 Gene

No ASD Table

Relevant External Links for TMEM256 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TMEM256 Gene

Protein differential expression in normal tissues from HIPED for TMEM256 Gene

This gene is overexpressed in Urine (37.9) and Nasal epithelium (11.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TMEM256 Gene

Protein tissue co-expression partners for TMEM256 Gene

NURSA nuclear receptor signaling pathways regulating expression of TMEM256 Gene:


SOURCE GeneReport for Unigene cluster for TMEM256 Gene:


Primer Products

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for TMEM256 Gene

Orthologs for TMEM256 Gene

This gene was present in the common ancestor of animals.

Orthologs for TMEM256 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia TMEM256 34
  • 99.41 (n)
-- 35
  • 99 (a)
(Canis familiaris)
Mammalia -- 35
  • 91 (a)
TMEM256 34
  • 89.68 (n)
(Bos Taurus)
Mammalia TMEM256 34 35
  • 89.56 (n)
(Mus musculus)
Mammalia Tmem256 34 16 35
  • 87.07 (n)
(Rattus norvegicus)
Mammalia Tmem256 34
  • 87.07 (n)
(Danio rerio)
Actinopterygii tmem256 34 35
  • 57.45 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG42395 35
  • 23 (a)
CG4686 35
  • 22 (a)
(Caenorhabditis elegans)
Secernentea Y106G6H.8 35
  • 26 (a)
Species where no ortholog for TMEM256 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for TMEM256 Gene

Gene Tree for TMEM256 (if available)
Gene Tree for TMEM256 (if available)

Paralogs for TMEM256 Gene

Paralogs for TMEM256 Gene Pseudogenes for TMEM256 Gene

genes like me logo Genes that share paralogs with TMEM256: view

Variants for TMEM256 Gene

Sequence variations from dbSNP and Humsavar for TMEM256 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs886039795 Likely pathogenic 7,403,143(-) CCAGC(-/TTTTACTACCAGGCTCTGAGTG)GAGAC intron-variant, reference, frameshift-variant
rs1000826837 -- 7,405,982(+) AGAGG(A/G)ATAGG intron-variant, upstream-variant-2KB
rs1001064964 -- 7,404,635(+) ATTCT(-/C)CCCCC upstream-variant-2KB
rs1001456894 -- 7,402,545(+) CAGGC(A/G)CCTGT intron-variant
rs1001742924 -- 7,402,779(+) CAGTA(G/T)GAATC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for TMEM256 Gene

Variant ID Type Subtype PubMed ID
esv1007381 CNV deletion 20482838
esv2422288 CNV deletion 17116639
esv2662967 CNV deletion 23128226
nsv457659 CNV loss 19166990
nsv470575 CNV loss 18288195
nsv523672 CNV loss 19592680
nsv574322 CNV loss 21841781
nsv952118 CNV deletion 24416366

Variation tolerance for TMEM256 Gene

Residual Variation Intolerance Score: 53% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.12; 51.26% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for TMEM256 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TMEM256 Gene

Disorders for TMEM256 Gene

MalaCards: The human disease database

(1) MalaCards diseases for TMEM256 Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
meckel syndrome 1
  • meckel syndrome
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for TMEM256

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with TMEM256: view

No data available for UniProtKB/Swiss-Prot and Genatlas for TMEM256 Gene

Publications for TMEM256 Gene

  1. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 2 3 64
  2. Exosomal proteins as prostate cancer biomarkers in urine: From mass spectrometry discovery to immunoassay-based validation. (PMID: 27664330) Wang L. … Llorente A. (Eur J Pharm Sci 2016) 3 64
  3. A Dynamic Protein Interaction Landscape of the Human Centrosome-Cilium Interface. (PMID: 26638075) Gupta G.D. … Pelletier L. (Cell 2015) 3 64
  4. Proteomic analysis of podocyte exosome-enriched fraction from normal human urine. (PMID: 23376485) Prunotto M. … Moll S. (J Proteomics 2013) 3 64
  5. A census of human soluble protein complexes. (PMID: 22939629) Havugimana P.C. … Emili A. (Cell 2012) 3 64

Products for TMEM256 Gene

Sources for TMEM256 Gene

Loading form....