Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TMEM200C Gene

Aliases for TMEM200C Gene

  • Transmembrane Protein 200C 2 3 5
  • Two Transmembrane Domain-Containing Family Member A 3 4
  • Transmembrane Protein TTMA 3 4
  • TTMA 3 4
  • Two Transmembrane Domain Family Member A 3

External Ids for TMEM200C Gene

Summaries for TMEM200C Gene

GeneCards Summary for TMEM200C Gene

TMEM200C (Transmembrane Protein 200C) is a Protein Coding gene. An important paralog of this gene is TMEM200A.

Additional gene information for TMEM200C Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TMEM200C Gene

Genomics for TMEM200C Gene

GeneHancer (GH) Regulatory Elements for TMEM200C Gene

Promoters and enhancers for TMEM200C Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH18I005894 Promoter/Enhancer 1.8 FANTOM5 Ensembl ENCODE 562.3 +1.4 1354 2.1 KLF17 SIN3A ZNF2 ZNF335 ZNF121 GLIS2 ZBTB11 ZNF398 ZEB2 ZNF843 TMEM200C GC18P005896 ENSG00000264449
GH18I005892 Promoter 0.6 EPDnew 550.4 +5.0 5038 0.1 EZH2 TMEM200C ENSG00000264449 GC18P005896
GH18I005890 Promoter/Enhancer 1.1 Ensembl ENCODE 0.4 +6.4 6395 0.2 CTCF RNF2 ZIC2 ZNF48 MXD3 ZNF143 BCL6 EZH2 ENSG00000264449 GC18P005896 TMEM200C
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TMEM200C on UCSC Golden Path with GeneCards custom track

Genomic Locations for TMEM200C Gene

Genomic Locations for TMEM200C Gene
15,030 bases
Minus strand

Genomic View for TMEM200C Gene

Genes around TMEM200C on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TMEM200C Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TMEM200C Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TMEM200C Gene

Proteins for TMEM200C Gene

  • Protein details for TMEM200C Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Transmembrane protein 200C
    Protein Accession:

    Protein attributes for TMEM200C Gene

    621 amino acids
    Molecular mass:
    63928 Da
    Quaternary structure:
    No Data Available

neXtProt entry for TMEM200C Gene

Post-translational modifications for TMEM200C Gene

No Post-translational modifications

Other Protein References for TMEM200C Gene

No data available for DME Specific Peptides for TMEM200C Gene

Domains & Families for TMEM200C Gene

Gene Families for TMEM200C Gene

Human Protein Atlas (HPA):
  • Predicted membrane proteins

Protein Domains for TMEM200C Gene


Suggested Antigen Peptide Sequences for TMEM200C Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the TMEM200 family.
  • Belongs to the TMEM200 family.
genes like me logo Genes that share domains with TMEM200C: view

Function for TMEM200C Gene

Phenotypes From GWAS Catalog for TMEM200C Gene

Phenotypes for TMEM200C Gene

genes like me logo Genes that share phenotypes with TMEM200C: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for TMEM200C Gene

Localization for TMEM200C Gene

Subcellular locations from UniProtKB/Swiss-Prot for TMEM200C Gene

Membrane; Multi-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TMEM200C gene
Compartment Confidence
plasma membrane 3
cytoskeleton 2
nucleus 2
mitochondrion 1
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for TMEM200C Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with TMEM200C: view

Pathways & Interactions for TMEM200C Gene

SuperPathways for TMEM200C Gene

No Data Available

Interacting Proteins for TMEM200C Gene

Gene Ontology (GO) - Biological Process for TMEM200C Gene


No data available for Pathways by source and SIGNOR curated interactions for TMEM200C Gene

Drugs & Compounds for TMEM200C Gene

No Compound Related Data Available

Transcripts for TMEM200C Gene

mRNA/cDNA for TMEM200C Gene

(3) REFSEQ mRNAs :
(0) Additional mRNA sequences :
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for TMEM200C Gene

Transmembrane protein 200C:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for TMEM200C Gene

No ASD Table

Relevant External Links for TMEM200C Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TMEM200C Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TMEM200C Gene

mRNA differential expression in normal tissues according to GTEx for TMEM200C Gene

This gene is overexpressed in Brain - Cortex (x4.5), Brain - Frontal Cortex (BA9) (x4.3), and Adrenal Gland (x4.2).

Protein differential expression in normal tissues from HIPED for TMEM200C Gene

This gene is overexpressed in Pancreatic juice (27.5), Esophagus (23.4), Platelet (11.8), and Urinary Bladder (6.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for TMEM200C Gene

Protein tissue co-expression partners for TMEM200C Gene

NURSA nuclear receptor signaling pathways regulating expression of TMEM200C Gene:


SOURCE GeneReport for Unigene cluster for TMEM200C Gene:


Evidence on tissue expression from TISSUES for TMEM200C Gene

  • Urine(2.4)
genes like me logo Genes that share expression patterns with TMEM200C: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for TMEM200C Gene

Orthologs for TMEM200C Gene

This gene was present in the common ancestor of chordates.

Orthologs for TMEM200C Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia TMEM200C 33 34
  • 94.82 (n)
(Bos Taurus)
Mammalia TMEM200C 33 34
  • 81.82 (n)
(Rattus norvegicus)
Mammalia Tmem200c 33
  • 78.75 (n)
(Mus musculus)
Mammalia Tmem200c 33 16 34
  • 78.71 (n)
(Monodelphis domestica)
Mammalia TMEM200C 34
  • 55 (a)
(Gallus gallus)
Aves LOC421054 33
  • 65.97 (n)
TMEM200C 34
  • 50 (a)
(Anolis carolinensis)
Reptilia TMEM200C 34
  • 46 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia tmem200c 33
  • 52.57 (n)
(Danio rerio)
Actinopterygii CABZ01081294.1 34
  • 40 (a)
TMEM200C (1 of 2) 34
  • 34 (a)
Species where no ortholog for TMEM200C was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for TMEM200C Gene

Gene Tree for TMEM200C (if available)
Gene Tree for TMEM200C (if available)

Paralogs for TMEM200C Gene

Paralogs for TMEM200C Gene

genes like me logo Genes that share paralogs with TMEM200C: view

Variants for TMEM200C Gene

Sequence variations from dbSNP and Humsavar for TMEM200C Gene

SNP ID Clin Chr 18 pos Variation AA Info Type
rs1000043870 -- 5,892,388(-) T/C/G 5_prime_UTR_variant, genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000419096 -- 5,891,345(-) GCCGCGGCGGGGGCAGACGACGACGAAGAGGCGGCGGCGGCCGCGGCGG/GCCGCGGCGG coding_sequence_variant, inframe_deletion
rs1000565051 -- 5,890,568(-) G/A coding_sequence_variant, missense_variant
rs1000625738 -- 5,897,556(-) A/G 5_prime_UTR_variant, genic_upstream_transcript_variant
rs1000637031 -- 5,890,721(-) G/A/T coding_sequence_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for TMEM200C Gene

Variant ID Type Subtype PubMed ID
dgv184n21 CNV gain 19592680
nsv1143873 CNV deletion 24896259
nsv576393 CNV gain 21841781

Variation tolerance for TMEM200C Gene

Gene Damage Index Score: 4.14; 61.42% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TMEM200C Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TMEM200C Gene

Disorders for TMEM200C Gene

Additional Disease Information for TMEM200C

No disorders were found for TMEM200C Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TMEM200C Gene

Publications for TMEM200C Gene

  1. Candidate psychiatric illness genes identified in patients with pericentric inversions of chromosome 18. (PMID: 15722956) Pickard BS … Muir WJ (Psychiatric genetics 2005) 2 3 4 58
  2. DNA sequence and analysis of human chromosome 18. (PMID: 16177791) Nusbaum C … Lander ES (Nature 2005) 3 4 58

Products for TMEM200C Gene

Sources for TMEM200C Gene

Loading form....