Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TMEM169 Gene

Aliases for TMEM169 Gene

  • Transmembrane Protein 169 2 3

External Ids for TMEM169 Gene

Previous GeneCards Identifiers for TMEM169 Gene

  • GC02P216654
  • GC02P216946
  • GC02P208803

Summaries for TMEM169 Gene

GeneCards Summary for TMEM169 Gene

TMEM169 (Transmembrane Protein 169) is a Protein Coding gene.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TMEM169 Gene

Genomics for TMEM169 Gene

Regulatory Elements for TMEM169 Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for TMEM169 Gene

216,081,866 bp from pter
216,102,783 bp from pter
20,918 bases
Plus strand

Genomic View for TMEM169 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for TMEM169 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TMEM169 Gene

Proteins for TMEM169 Gene

  • Protein details for TMEM169 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Transmembrane protein 169
    Protein Accession:
    Secondary Accessions:
    • B2R8W6

    Protein attributes for TMEM169 Gene

    297 amino acids
    Molecular mass:
    33611 Da
    Quaternary structure:
    No Data Available

neXtProt entry for TMEM169 Gene

Proteomics data for TMEM169 Gene at MOPED

Post-translational modifications for TMEM169 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for TMEM169 Gene

Domains for TMEM169 Gene

Protein Domains for TMEM169 Gene


Suggested Antigen Peptide Sequences for TMEM169 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with TMEM169: view

No data available for Gene Families and UniProtKB/Swiss-Prot for TMEM169 Gene

Function for TMEM169 Gene

Phenotypes for TMEM169 Gene

GenomeRNAi human phenotypes for TMEM169:
genes like me logo Genes that share phenotypes with TMEM169: view

Animal Model Products

CRISPR Products

miRNA for TMEM169 Gene

miRTarBase miRNAs that target TMEM169

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Animal Models , Transcription Factor Targets and HOMER Transcription for TMEM169 Gene

Localization for TMEM169 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TMEM169 Gene

Membrane; Multi-pass membrane protein.

Subcellular locations from

Jensen Localization Image for TMEM169 Gene COMPARTMENTS Subcellular localization image for TMEM169 gene
Compartment Confidence
plasma membrane 3

Gene Ontology (GO) - Cellular Components for TMEM169 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with TMEM169: view

Pathways for TMEM169 Gene

SuperPathways for TMEM169 Gene

No Data Available

Interacting Proteins for TMEM169 Gene

STRING Interaction Network Preview (showing 1 interactants - click image to see details)
Selected Interacting proteins: ENSP00000295658 for TMEM169 Gene via STRING

Symbol External ID(s) Details

Gene Ontology (GO) - Biological Process for TMEM169 Gene


No data available for Pathways by source for TMEM169 Gene

Transcripts for TMEM169 Gene

Unigene Clusters for TMEM169 Gene

Transmembrane protein 169:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for TMEM169

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for TMEM169 Gene

ExUns: 1a · 1b ^ 2a · 2b ^ 3a · 3b ^ 4a · 4b
SP1: -
SP2: - -
SP3: - -
SP4: - -

Relevant External Links for TMEM169 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TMEM169 Gene

mRNA expression in normal human tissues for TMEM169 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for TMEM169 Gene

This gene is overexpressed in Brain - Frontal Cortex (BA9) (4.2).

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, and MOPED for TMEM169 Gene

SOURCE GeneReport for Unigene cluster for TMEM169 Gene Hs.334916

genes like me logo Genes that share expressions with TMEM169: view

Primer Products

In Situ Assay Products

No data available for Protein differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Expression partners for TMEM169 Gene

Orthologs for TMEM169 Gene

This gene was present in the common ancestor of animals.

Orthologs for TMEM169 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia TMEM169 35
  • 86.53 (n)
  • 88.55 (a)
TMEM169 36
  • 89 (a)
(Canis familiaris)
Mammalia TMEM169 35
  • 90.46 (n)
  • 91.25 (a)
-- 36
  • 84 (a)
-- 36
  • 91 (a)
(Mus musculus)
Mammalia Tmem169 35
  • 85.52 (n)
  • 87.88 (a)
Tmem169 16
Tmem169 36
  • 88 (a)
(Pan troglodytes)
Mammalia TMEM169 35
  • 99.55 (n)
  • 99.66 (a)
TMEM169 36
  • 100 (a)
(Rattus norvegicus)
Mammalia Tmem169 35
  • 85.52 (n)
  • 87.54 (a)
(Monodelphis domestica)
Mammalia TMEM169 36
  • 81 (a)
(Gallus gallus)
Aves TMEM169 35
  • 70.28 (n)
  • 67.46 (a)
TMEM169 36
  • 64 (a)
(Anolis carolinensis)
Reptilia TMEM169 36
  • 62 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia Str.12596 35
tmem169 35
  • 67.57 (n)
  • 66.55 (a)
(Danio rerio)
Actinopterygii LOC570044 35
  • 62.24 (n)
  • 60.15 (a)
CR339053.3 36
  • 58 (a)
tmem169 36
  • 50 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG4596 36
  • 22 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 36
  • 37 (a)
Species with no ortholog for TMEM169:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for TMEM169 Gene

Gene Tree for TMEM169 (if available)
Gene Tree for TMEM169 (if available)

Paralogs for TMEM169 Gene

No data available for Paralogs for TMEM169 Gene

Variants for TMEM169 Gene

Sequence variations from dbSNP and Humsavar for TMEM169 Gene

SNP ID Clin Chr 02 pos Sequence Context AA Info Type MAF
rs828919 -- 216,088,018(+) attgc(A/G)catgg intron-variant
rs6736096 -- 216,093,646(+) CAACA(C/T)CTGCC intron-variant
rs10188727 -- 216,091,578(+) AAAAA(A/G)AGAGA intron-variant
rs10498045 -- 216,096,965(+) TTGCC(A/G)AAAAT intron-variant
rs11268927 -- 216,092,811(+) AAGCT(-/GCCTCAGAAAACAACAGAGAGAA)GCCTC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for TMEM169 Gene

Variant ID Type Subtype PubMed ID
esv8814 CNV Gain 19470904
nsv523434 CNV Loss 19592680

Relevant External Links for TMEM169 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TMEM169 Gene

Disorders for TMEM169 Gene

Relevant External Links for TMEM169

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator

No disorders were found for TMEM169 Gene.

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Novoseek inferred disease relationships and Genatlas for TMEM169 Gene

Publications for TMEM169 Gene

  1. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 2 3
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4
  4. Generation and annotation of the DNA sequences of human chromosomes 2 and 4. (PMID: 15815621) Hillier L.W. … Wilson R.K. (Nature 2005) 3 4
  5. Multistudy fine mapping of chromosome 2q identifies XRCC5 as a chronic obstructive pulmonary disease susceptibility gene. (PMID: 20463177) Hersh C.P. … Silverman E.K. (Am. J. Respir. Crit. Care Med. 2010) 3 48

Products for TMEM169 Gene

Sources for TMEM169 Gene

Back to Top
