Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

TMEM144 Gene

protein-coding GIFtS: 41
GCID: GC04P159131

transmembrane protein 144

Search for TMEM144
in

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

Aliases
Transmembrane Protein 144¹ ²
FLJ11155¹

External Ids:	HGNC: 25633¹	Entrez Gene: 55314²	Ensembl: ENSG00000164124⁷	UniProtKB: Q7Z5S9³

Export aliases for TMEM144 gene to outside databases

Previous GC identifers: GC04P159351 GC04P154882

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000004.11 NC_018915.1 NT_016354.19

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the TMEM144 gene promoter:
E2F-4 E2F-3a E2F-5 Lmo2 E2F-2 PPAR-gamma1 S8 Nkx6-1 E2F E2F-1
Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: TMEM144 promoter sequence

Search SABiosciences Chromatin IP Primers for TMEM144

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TMEM144

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 4q32.1 Ensembl cytogenetic band: 4q32.1 HGNC cytogenetic band: 4q32.1

TMEM144 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TMEM144 gene location

GeneLoc information about chromosome 4 GeneLoc Exon Structure

GeneLoc location for GC04P159131: view genomic region (about GC identifiers)

Start:	159,122,756 bp from pter	End:	159,176,563 bp from pter
Size:	53,808 bases	Orientation:	plus strand

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: TM144_HUMAN, Q7Z5S9 (See protein sequence)

Recommended Name: Transmembrane protein 144

Size: 345 amino acids; 37653 Da

Subcellular location: Membrane; Multi-pass membrane protein (Potential)

Secondary accessions: D3DP24 Q49A05 Q9NUT3

Alternative splicing: 2 isoforms: Q7Z5S9-1 Q7Z5S9-2 (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for TMEM144: NX_Q7Z5S9

Post-translational modifications:

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_Q7Z5S9

TMEM144 Protein expression data from MOPED and PaxDb: About this image

REFSEQ proteins: NP_060812.2

ENSEMBL proteins:

ENSP00000425266 ENSP00000421289 ENSP00000422255 ENSP00000422297 ENSP00000296529

ENSP00000424659 ENSP00000422082 ENSP00000425815 ENSP00000426211 ENSP00000420990

ENSP00000420930 ENSP00000425907 ENSP00000422899

Human Recombinant Protein Products for TMEM144:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells OriGene Protein Over-expression Lysate: TMEM144 OriGene Custom Protein Services for TMEM144
	GenScript Custom Purified and Recombinant Proteins Services for TMEM144
	Novus Biologicals TMEM144 Lysate
	Browse Sino Biological Recombinant Proteins
	Browse ProSpec Recombinant Proteins
	Uscn Proteins for TMEM144

Gene Ontology (GO): 1 cellular component term (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0016021	integral to membrane	IEA	--

TMEM144 for ontologies About GeneDecksing

TMEM144 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for TMEM144
	GenScript Custom Superior Antibodies Services for TMEM144
	Novus Biologicals TMEM144 Antibodies
	Abcam antibodies for TMEM144
	Uscn Antibodies for TMEM144
	Search ThermoFisher Antibodies for TMEM144

Assay Products for TMEM144:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for TMEM144
	Browse Enzo Life Sciences for kits & assays
	Uscn ELISAs and CLIAs for TMEM144

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

TMEM144 for domains About GeneDecksing

1 InterPro domain/family:

IPR012435 DUF1632_TMEM144

Graphical View of Domain Structure for InterPro Entry Q7Z5S9

ProtoNet protein and cluster: Q7Z5S9

1 Blocks protein family: IPB012435 Protein of unknown function DUF1632

UniProtKB/Swiss-Prot: TM144_HUMAN, Q7Z5S9

Similarity: Belongs to the TMEM144 family

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, Sirion Biotech, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, Sirion Biotech, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Phenotypes:
1 GenomeRNAi human phenotype for TMEM144:

Decreased nuclei size in G2M

Animal Models:

inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for TMEM144

miRNA Products:		OriGene 3'-UTR Clone: TMEM144 Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TMEM144
		8/10 QIAGEN miScript miRNA Assays for microRNAs that regulate TMEM144 (see all 10):
		hsa-miR-610 hsa-miR-3921 hsa-miR-138 hsa-miR-2117 hsa-miR-205* hsa-miR-3662 hsa-miR-3143 hsa-miR-3148

		SwitchGear 3'UTR luciferase reporter plasmid: TMEM144 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TMEM144 (see all 7) OriGene shRNA RFP: TMEM144 OriGene siRNA: TMEM144
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TMEM144
		Sirion Biotech Custom design and validation of potent shRNA sequences against TMEM144

Gene Editing Products:			DNA2.0 Custom Protein Engineering Service for TMEM144
			Sirion Biotech Customized adenovirus for overexpression of TMEM144 Sirion Biotech Customized adenovirus for potent knockdown of TMEM144

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TMEM144 (see all 3) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TMEM144 OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: TMEM144 (NM_018342)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for TMEM144
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TMEM144

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for TMEM144
		Search LifeMap BioReagents cell lines for TMEM144
		Sirion Biotech Customized stable knockdown cell line services for TMEM144 Sirion Biotech Customized inducible knockdown cell line services for TMEM144 Sirion Biotech Customized stable overexpressing cell line services for TMEM144 Sirion Biotech Customized inducible overexpressing cell line services for TMEM144

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TMEM144

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Interactions:

Search SABiosciences Gene Network Central^TM Interacting Genes and Proteins Networks for TMEM144

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for TMEM144
Search CenterWatch for drugs/clinical trials and news about TMEM144 / TM144

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, Sirion Biotech, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for TMEM144 gene:

NM_018342.4

Unigene Cluster for TMEM144:

Transmembrane protein 144

Hs.176227 [show with all ESTs]

Unigene Representative Sequence: BC050297

17 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000505049 ENST00000505189 ENST00000511038 ENST00000508243 ENST00000296529(uc003ipx.3 uc010iqi.3)

ENST00000512481 ENST00000504569 ENST00000509278 ENST00000514558 ENST00000513744

ENST00000514346 ENST00000503200 ENST00000511532 ENST00000502698 ENST00000514971

ENST00000503404 ENST00000512272

miRNA Products:		OriGene 3'-UTR Clone: TMEM144 Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TMEM144
		8/10 QIAGEN miScript miRNA Assays for microRNAs that regulate TMEM144 (see all 10):
		hsa-miR-610 hsa-miR-3921 hsa-miR-138 hsa-miR-2117 hsa-miR-205* hsa-miR-3662 hsa-miR-3143 hsa-miR-3148

		SwitchGear 3'UTR luciferase reporter plasmid: TMEM144 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TMEM144 (see all 7) OriGene shRNA RFP: TMEM144 OriGene siRNA: TMEM144
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TMEM144
		Sirion Biotech Custom design and validation of potent shRNA sequences against TMEM144

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TMEM144 (see all 3) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TMEM144 OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: TMEM144 (NM_018342)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for TMEM144
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TMEM144

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TMEM144 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat TMEM144
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TMEM144
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TMEM144

Additional cDNA sequence:

AK002017.1 BC026318.1 BC035811.1 BC036551.1 BC048117.1 BC050297.1 BC054487.1 BC060875.1

14 DOTS entries:

DT.101982476 DT.97799189 DT.95126061 DT.91726037 DT.99977186 DT.91834672 DT.95257481 DT.113303

DT.121219647 DT.121219643 DT.121219662 DT.91726039 DT.95069047 DT.40255526

24/142 AceView cDNA sequences (see all 142):

BI753496 BQ268684 CA431715 BE835296 AK129723 AW173720 AW173735 BC035811

AL120648 BX112844 CB156739 AK126266 H40933 BG701252 N62499 BI602659

BG707457 BI553393 BC048117 N48765 BI550725 BI457786 BC054487 AI914416

GeneLoc Exon Structure

5/13 Alternative Splicing Database (ASD) splice patterns (SP) for TMEM144 (see all 13) About this scheme

ExUns:	1a	·	1b	·	1c	·	1d	^	2a	·	2b	^	3a	·	3b	·	3c	^	4	^	5a	·	5b	^	6a	·	6b	^	7a	·	7b	^	8a	·	8b	^	9a	·	9b	^	10	^	11a	·	11b	^	12	^	13	^	14a	·
SP1:									-		-						-		-				-																-				-
SP2:									-		-						-		-				-																-		-		-
SP3:																	-		-				-																-				-
SP4:									-		-						-		-				-
SP5:																							-

ExUns:	14b	^	15
SP1:
SP2:
SP3:
SP4:
SP5:

ECgene alternative splicing isoforms for TMEM144

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

TMEM144 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: TAAGAGCTAC

About this image

TMEM144 expression in embryonic tissues and stem cells
Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine About this table

Stem Cell Differentiation: 2 LifeMap Cells

Name

Category

PureStem™ progenitor SK17 (Embryonic Progenitor Cell)

Posterior foregut-like cells (A scalable, suspensi...)

Expression:

Positive

Negative

Selective marker

Experimental details:

Curated

Microarrays

In-situ hybridization

See TMEM144 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for TMEM144

SOURCE GeneReport for Unigene cluster: Hs.176227

SABiosciences Custom PCR Arrays for TMEM144

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TMEM144 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat TMEM144
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TMEM144
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TMEM144

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TMEM144

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of animals.

Orthologs for TMEM144 gene from 6/17 species (see all 17) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
mouse (Mus musculus)	Mammalia	Tmem144^{1 , 5}	transmembrane protein 144^{1, 5}	83.19(n)¹ 86.67(a)¹		3 (35.07 cM)⁵ 70652¹ NM_027495.4¹ NP_081771.2¹ 79813153⁵
chicken (Gallus gallus)	Aves	TMEM144¹	transmembrane protein 144	73.86(n) 69.1(a)		422414 XM_420383.3 XP_420383.2
lizard (Anolis carolinensis)	Reptilia	TMEM144⁶	--	57(a)	1 ↔ 1	5(128485235-128502078)
African clawed frog (Xenopus laevis)	Amphibia	48014474²	--	76.88(n)		48014474
zebrafish (Danio rerio)	Actinopterygii	tmem144a¹	transmembrane protein 144a	64.32(n) 65.4(a)		445495 NM_001003999.1 NP_001003999.1
worm (Caenorhabditis elegans)	Secernentea	R144.6⁶ W02D3.4⁶ (see all 6)	Protein W02D3.4 (see all 6)	40(a) 37(a) (see all 6)	many → 1 many → 1 (see all 6)	III(5003157-5004689) I(6719369-6723062)

ENSEMBL Gene Tree for TMEM144 (if available)
TreeFam Gene Tree for TMEM144 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 4 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs11100154^1,2	C,F,A,H	--	159129407(+)	`TAAAAT/CTCATT`	1	--	us2k¹		23		NS EA NA WA	2348
rs186626499^1,2		--	159129530(+)	`TATCCC/TTTACT`	1	--	us2k¹		0	--	--	--	--
rs191025575^1,2		--	159129578(+)	`TCTCCA/GTATTC`	1	--	us2k¹		0	--	--	--	--
rs149832032^1,2		--	159129731(+)	`TCAGAC/GCAGAA`	1	--	us2k¹		0	--	--	--	--
rs140951315^1,2	C	--	159129760(+)	`AATGT-/TATATATATATATATATAT ATATATATATATATATATATATATAT`	1	--	us2k¹		0	--	--	--	--
rs12502806^1,2	C,A,H	--	159129761(+)	`ATGTTT/ATATAT`	1	--	us2k¹		1		CSA	1
rs56367530^1,2	C	--	159129773(+)	`TATAT-/ATATATATATATATATATA TATATATATATATATATATATCTCTT`	1	--	us2k¹		1		NA	2
rs114238706^1,2		--	159129930(+)	`ACAGAC/TGAAGC`	1	--	us2k¹		1		NA	120
rs78253802^1,2		--	159130041(+)	`TTTAGT/CTTAAG`	1	--	us2k¹		2		CSA WA	119
rs72973897^1,2	C	--	159130144(+)	`AGCCCC/TCAACT`	1	--	us2k¹		2		WA	120

HapMap Linkage Disequilibrium report for TMEM144 (159122756 - 159176563 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
Database of Genomic Variants (DGV) variations for TMEM144: --

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing TMEM144

DNA2.0 Custom Variant and Variant Library Synthesis for TMEM144

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for TMEM144 gene integrated from 9 sources:
(articles sorted by number of sources associating them with TMEM144)

Utopia: connect your pdf to the dynamic
world of online information

Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)^{1, 2} Ota T.... Sugano S. (2004)
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)^{1, 3} Strausberg R.L....Marra M.A. (2002)
hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. (PubMed id 17207965)¹ Lamesch P.... Vidal M. (2007)
The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)² Gerhard D.S....Malek J. (2004)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 55314	HGNC: 25633	AceView: FLJ11155	Ensembl:ENSG00000164124	euGenes: HUgn55314
ECgene: TMEM144	H-InvDB: TMEM144

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for TMEM144	Pharmacogenomics, SNPs, Pathways

Intellectual Property for TMEM144 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for TMEM144 gene:
Search GeneIP for patents involving TMEM144

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, LifeMap BioReagents, and Sirion Biotech, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory)
About This Section


	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Phosphatase Activity Assays/Reagents		Browse Recombinant/Natural Proteins

	Browse OriGene Antibodies		OriGene shRNA RFP for TMEM144
	OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TMEM144		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TMEM144
	OriGene Protein Over-expression Lysate for TMEM144		Browse OriGene Fluorogenic Cell Assay Kits
	OriGene siRNA for TMEM144		OriGene 3'-UTR Clone for TMEM144
	OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TMEM144		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TMEM144
	Browse OriGene GFP tagged cDNA clones in CMV expression vector		Browse OriGene MicroRNA Expression Plasmids
	Browse OriGene basic RS shRNAs		Browse OriGene validated miRNA SYBR primer pairs
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for TMEM144		OriGene Custom Protein Services for TMEM144
	OriGene Custom Immunoassay Development

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat TMEM144
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing TMEM144
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TMEM144
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TMEM144
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TMEM144
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TMEM144

	GenScript Custom Purified and Recombinant Proteins Services for TMEM144		GenScript cDNA clones with any tag delivered in your preferred vector for TMEM144
	GenScript Custom Assay Services for TMEM144		GenScript Custom Superior Antibodies Services for TMEM144
	GenScript Custom overexpressing Cell Line Services for TMEM144		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Search for Antibodies & Assays

	Regulatory tfbs in TMEM144 promoter
	Search Chromatin IP Primers for TMEM144
	RT² qPCR Primer Assay in human, mouse, rat TMEM144
	Search GNC Networks for TMEM144
	SABiosciences Custom PCR Arrays for TMEM144

Search Tocris compounds for TMEM144

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological cDNA Clones
	Antibodies/Proteins Production Services
	Rabbit Monoclonal Antibody Platform
	Bulk Purchasing

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	TMEM144 antibodies
	TMEM144 lysates

	Antibodies for TMEM144
	See all of Abcam's Antibodies, Kits and Proteins for TMEM144
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

TMEM144 Proteins, Antibodies, CLIAs, and ELISAs

Search LifeMap BioReagents cell lines for TMEM144

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TMEM144

	SwitchGear 3'UTR luciferase reporter plasmids for TMEM144
	SwitchGear Promoter luciferase reporter plasmids for TMEM144

Search ThermoFisher Antibodies for TMEM144

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TMEM144

inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for TMEM144

Sirion Biotech Customized:

	stable knockdown cell line services for TMEM144
	inducible knockdown cell line services for TMEM144
	design and validation of potent shRNA sequences against TMEM144
	adenovirus for potent knockdown of TMEM144
	adenovirus for overexpression of TMEM144
	stable overexpressing cell line services for TMEM144
	inducible overexpressing cell line services for TMEM144

GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013 , 13 May 2013

View Random Gene

Category			VWF (GIFTS: 73) von Willebrand factor
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes TMEM144 gene at Home site.

hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4

Advanced Search

Export list of displayed genes

TMEM144 Gene

transmembrane protein 144

Aliases
for TMEM144 gene

Summaries
for TMEM144 gene

Genomic Views
for TMEM144 gene

Proteins
for TMEM144 gene

Protein Domains /
Families
for TMEM144 gene

Function
for TMEM144 gene

Pathways & Interactions
for TMEM144 gene

Drugs & Compounds
for TMEM144 gene

Transcripts
for TMEM144 gene

Expression
for TMEM144 gene

Orthologs
for TMEM144 gene

Paralogs
for TMEM144 gene

Genomic Variants
for TMEM144 gene

Disorders / Diseases
for TMEM144 gene

Publications
for TMEM144 gene

External Searches for TMEM144 gene

Genome Databases showing TMEM144 gene

Other Databases showing TMEM144 gene

Specialized Databases showing TMEM144 gene

Intellectual Property
for TMEM144 gene

Products
for TMEM144 gene

View Random Gene

Advanced Search

Export list of displayed genes

TMEM144 Gene

transmembrane protein 144

Aliasesfor TMEM144 gene

Summariesfor TMEM144 gene

Genomic Viewsfor TMEM144 gene

Proteinsfor TMEM144 gene

Protein Domains /Familiesfor TMEM144 gene

Functionfor TMEM144 gene

Pathways & Interactionsfor TMEM144 gene

Drugs & Compoundsfor TMEM144 gene

Transcriptsfor TMEM144 gene

Expression for TMEM144 gene

Orthologsfor TMEM144 gene

Paralogsfor TMEM144 gene

Genomic Variantsfor TMEM144 gene

Disorders / Diseasesfor TMEM144 gene

Publicationsfor TMEM144 gene

External Searches for TMEM144 gene

Genome Databases showing TMEM144 gene

Other Databases showing TMEM144 gene

Specialized Databases showing TMEM144 gene

Intellectual Propertyfor TMEM144 gene

Productsfor TMEM144 gene

View Random Gene

Aliases
for TMEM144 gene

Summaries
for TMEM144 gene

Genomic Views
for TMEM144 gene

Proteins
for TMEM144 gene

Protein Domains /
Families
for TMEM144 gene

Function
for TMEM144 gene

Pathways & Interactions
for TMEM144 gene

Drugs & Compounds
for TMEM144 gene

Transcripts
for TMEM144 gene

Expression
for TMEM144 gene

Orthologs
for TMEM144 gene

Paralogs
for TMEM144 gene

Genomic Variants
for TMEM144 gene

Disorders / Diseases
for TMEM144 gene

Publications
for TMEM144 gene

Intellectual Property
for TMEM144 gene

Products
for TMEM144 gene