Set Analyses:
Advanced Search

Advanced Search

Search By
Section (entire)

or upload a file of gene symbols

Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

TMEM132E Gene

protein-coding   GIFtS: 42
GCID: GC17P032907

Transmembrane Protein 132E

  See related diseases

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Transmembrane Protein 132E1 2

External Ids:    HGNC: 269911   Entrez Gene: 1248422   Ensembl: ENSG000001812917   UniProtKB: Q6IEE73   

Export aliases for TMEM132E gene to outside databases

Previous GC identifers: GC17P029932 GC17P029094

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

GeneCards Summary for TMEM132E Gene: 
TMEM132E (transmembrane protein 132E) is a protein-coding gene. Diseases associated with TMEM132E include neurofibroma, and mental retardation. An important paralog of this gene is TMEM132D.

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000017.10  NC_018928.2  NT_010799.15  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the TMEM132E gene promoter:
         Pax-5   CUTL1   AP-2gamma   E47   YY1   c-Ets-1   S8   HSF2   Hand1   ZIC2/Zic2   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidTMEM132E promoter sequence
   Search SABiosciences Chromatin IP Primers for TMEM132E

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TMEM132E

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 17q12   Ensembl cytogenetic band:  17q12   HGNC cytogenetic band: 17q12

TMEM132E Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TMEM132E gene location

GeneLoc information about chromosome 17         GeneLoc Exon Structure

GeneLoc location for GC17P032907:  view genomic region     (about GC identifiers)

32,907,768 bp from pter      End:
32,966,337 bp from pter
58,570 bases      Orientation:
plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: T132E_HUMAN, Q6IEE7 (See protein sequence)
Recommended Name: Transmembrane protein 132E precursor  
Size: 984 amino acids; 107094 Da
Subcellular location: Membrane; Single-pass type I membrane protein (Potential)
Secondary accessions: Q8WUF4 Q8WVA5

Explore the universe of human proteins at neXtProt for TMEM132E: NX_Q6IEE7

Explore proteomics data for TMEM132E at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q6IEE7

  • TMEM132E Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    TMEM132E Protein Expression
    REFSEQ proteins: NP_997196.1  
    ENSEMBL proteins: 

    Human Recombinant Protein Products for TMEM132E: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for TMEM132E
    OriGene Custom MassSpec 
    OriGene Custom Protein Services for TMEM132E
    GenScript Custom Purified and Recombinant Proteins Services for TMEM132E
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for TMEM132E 

    Gene Ontology (GO): 1 cellular component term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0016021integral to membrane IEA--

    TMEM132E for ontologies           About GeneDecksing

    TMEM132E Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for TMEM132E
    GenScript Custom Superior Antibodies Services for TMEM132E
    Abcam antibodies for TMEM132E
    Cloud-Clone Corp. Antibodies for TMEM132E 
    Search ThermoFisher Antibodies for TMEM132E
    LSBio Antibodies in human, mouse, rat for TMEM132E 

    Assay Products for TMEM132E: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for TMEM132E
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for TMEM132E
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for TMEM132E 
    Cloud-Clone Corp. CLIAs for TMEM132E

    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    1 InterPro protein domain:
     IPR026307 TMEM132

    Graphical View of Domain Structure for InterPro Entry Q6IEE7

    ProtoNet protein and cluster: Q6IEE7

    UniProtKB/Swiss-Prot: T132E_HUMAN, Q6IEE7
    Similarity: Belongs to the TMEM132 family

    TMEM132E for domains           About GeneDecksing

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

         1 GenomeRNAi human phenotype for TMEM132E:
     Elongated cells 

    Animal Models:
       inGenious Targeting Laboratory - Custom generated mouse model solutions for TMEM132E 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for TMEM132E

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for TMEM132E 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for TMEM132E 

    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TMEM132E
    8/29 QIAGEN miScript miRNA Assays for microRNAs that regulate TMEM132E (see all 29):
    hsa-miR-4291 hsa-miR-125a-5p hsa-miR-128 hsa-miR-605 hsa-miR-3653 hsa-miR-486-3p hsa-miR-1205 hsa-miR-4260
    SwitchGear 3'UTR luciferase reporter plasmidTMEM132E 3' UTR sequence
    Inhib. RNA
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for TMEM132E
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TMEM132E

    Gene Editing
    DNA2.0 Custom Protein Engineering Service for TMEM132E
    Sirion Biotech Customized adenovirus for overexpression of TMEM132E

    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for TMEM132E (see all 6)
    OriGene ORF clones in mouse, rat for TMEM132E
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: TMEM132E (NM_207313)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TMEM132E
    Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat TMEM132E
    Sirion Biotech Customized lentivirus for stable overexpression of TMEM132E 
                         Customized lentivirus expression plasmids for stable overexpression of TMEM132E 

    Cell Line
    GenScript Custom overexpressing Cell Line Services for TMEM132E
    Search LifeMap BioReagents cell lines for TMEM132E
    In Situ Assay

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TMEM132E

    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section


        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for TMEM132E

    1 Interacting protein for TMEM132E (Q6IEE73) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    TARBP2Q156333I2D: score=2 
    About this table

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for TMEM132E (T132E)

    Search CenterWatch for drugs/clinical trials and news about TMEM132E / T132E

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for TMEM132E gene: 

    Unigene Cluster for TMEM132E:

    Transmembrane protein 132E
    Hs.310482  [show with all ESTs]
    Unigene Representative Sequence: NM_207313
    2 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000321639(uc002hif.3) ENST00000577271
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TMEM132E
    8/29 QIAGEN miScript miRNA Assays for microRNAs that regulate TMEM132E (see all 29):
    hsa-miR-4291 hsa-miR-125a-5p hsa-miR-128 hsa-miR-605 hsa-miR-3653 hsa-miR-486-3p hsa-miR-1205 hsa-miR-4260
    SwitchGear 3'UTR luciferase reporter plasmidTMEM132E 3' UTR sequence
    Inhib. RNA
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for TMEM132E
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TMEM132E
    OriGene clones in human, mouse for TMEM132E (see all 6)
    OriGene ORF clones in mouse, rat for TMEM132E
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: TMEM132E (NM_207313)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TMEM132E
    Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat TMEM132E
    Sirion Biotech Customized lentivirus for stable overexpression of TMEM132E 
                         Customized lentivirus expression plasmids for stable overexpression of TMEM132E 
    OriGene qSTAR qPCR primer pairs in human, mouse for TMEM132E
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TMEM132E
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TMEM132E
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TMEM132E

    Additional mRNA sequence: 

    BC018318.1 BC020591.1 

    1 DOTS entry:


    12 AceView cDNA sequences:

    NM_207313 BN000149 AI678145 AA777050 BF346126 BC018318 BC020591 BQ068843 
    BX281016 BG912538 N34927 BQ339724 

    GeneLoc Exon Structure

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TMEM132E expression in normal human tissues (normalized intensities)      TMEM132E embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    TMEM132E Expression
    About this image

    TMEM132E expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/2 selected tissues (see all 2) fully expand
     Heart (Cardiovascular System)
             Atrioventricular Canal Cells Atrioventricular Canal
     Peripheral Nervous System (Nervous System)
             dorsal root ganglia   

    See TMEM132E Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for TMEM132E

    SOURCE GeneReport for Unigene cluster: Hs.310482
        SABiosciences Custom PCR Arrays for TMEM132E
    OriGene qSTAR qPCR primer pairs in human, mouse for TMEM132E
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TMEM132E
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TMEM132E
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TMEM132E
    In Situ
    Assay Products:

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TMEM132E

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for TMEM132E gene from 6/14 species (see all 14)    About this table
    Organism Taxonomic
    Gene Description Human
    (Mus musculus)
    Mammalia Tmem132e1 , 5 transmembrane protein 132E1, 5 86.49(n)1
      11 (50.08 cM)5
    2708931  NM_023438.21  NP_075927.21 
    (Gallus gallus)
    Aves TMEM132E1 transmembrane protein 132E 76.53(n)
      771389  XM_001234667.2  XP_001234668.2 
    (Anolis carolinensis)
    Reptilia TMEM132E6
    Uncharacterized protein
    1 ↔ 1
    (Danio rerio)
    Actinopterygii tmem132e1 transmembrane protein 132E 63.95(n)
      564044  XM_687404.5  XP_692496.4 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG144461 CG14446 44.84(n)
      31555  NM_132072.3  NP_572300.2 
    (Caenorhabditis elegans)
    Secernentea Y71H2AM.106
    Protein Y71H2AM.10
    1 → many

    ENSEMBL Gene Tree for TMEM132E (if available)
    TreeFam Gene Tree for TMEM132E (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to Build 68)
    About This Section
    Paralogs for TMEM132E gene
    TMEM132D2  TMEM132A2  TMEM132C2  TMEM132B2  
    3 SIMAP similar genes for TMEM132E using alignment to 1 protein entry:     T132E_HUMAN:
    TMEM132C    TMEM132D    TMEM132B

    TMEM132E for paralogs           About GeneDecksing

    1 Pseudogene for TMEM132E

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/1335 SNPs in TMEM132E are shown (see all 1335)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    Chr 17 posSequence#AA
    C--29127831(+) CCCTG-/GGTTTCCCCAGGAG
    1 -- int11Minor allele frequency- GGTTTCCCCAGGAGCAGGACTAGGAGGCCAG:0.00NA 2
    C--32909540(+) GGGGGG/TTTGTT 1 -- int10--------
    C--32913837(+) AAAAAA/GGGGAA 1 -- int10--------
    C,F,A,H--32923087(+) CACACG/ACACAA 1 -- int14Minor allele frequency- A:0.44NA WA CSA 9
    C--32923087(+) CACAC-/GCACAAC 1 -- int11Minor allele frequency- GC:0.00NA 2
    C--32942183(+) ACTAGG/AAGGCC 1 -- int11Minor allele frequency- A:0.50CSA 2
    C,F--32950421(+) CCGCT-/C/CCC 
    2 -- int1 cds1 trp32NA 4
    C--32968222(+) CACCCC/ACACCT 1 -- us2k11Minor allele frequency- A:0.00EU 983
    C--32968316(+) ATAAAT/CAGGTT 1 -- us2k12Minor allele frequency- C:0.08WA 120
    C--32968354(+) CGCACG/TAAGCT 1 -- us2k11Minor allele frequency- T:0.00EU 1000

    HapMap Linkage Disequilibrium report for TMEM132E (32907768 - 32966337 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 5 variations for TMEM132E:    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2715865CNV Deletion23290073
    esv2715864CNV Deletion23290073
    nsv833423CNV Loss17160897
    nsv519297CNV Gain19592680
    esv33292CNV Gain17666407

    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing TMEM132E
    DNA2.0 Custom Variant and Variant Library Synthesis for TMEM132E

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    UniProtKB/Swiss-Prot: T132E_HUMAN, Q6IEE7
  • Note=TMEM132E is located in a region involved in a heterozygous deletion of approximately 4.7 Mb; this
    deletion, involving the NF1 gene and contiguous genes lying in its flanking regions, is observed in a patient
    17q11.2 microdeletion syndrome, a syndrome characterized by variable facial dysmorphism, mental retardation,
    developmental delay, and an excessive number of neurofibromas

  • 2 diseases for TMEM132E:    About MalaCards
    neurofibroma    mental retardation

    TMEM132E for disorders           About GeneDecksing

    Genetic Association Database (GAD): TMEM132E

    Export disorders for TMEM132E gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for TMEM132E gene integrated from 9 sources:
    (articles sorted by number of sources associating them with TMEM132E)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Heterogeneity of breakpoints in non-LCR-mediated large constitutional deletions of the 17q11.2 NF1 tumour suppressor region. (PubMed id 14569139)1, 2 Kehrer-Sawatzki H.... Jenne D.E. (2003)
    2. DNA sequence of human chromosome 17 and analysis of rearrangement in the human lineage. (PubMed id 16625196)2 Zody M.C.... Nusbaum C. (2006)
    3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)2 Gerhard D.S....Malek J. (2004)
    4. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (2002)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
    Free Text  

      Query String
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 124842 HGNC: 26991 AceView: LOC124842 Ensembl:ENSG00000181291 euGenes: HUgn124842
    ECgene: TMEM132E H-InvDB: TMEM132E

    (According to HUGE)
    About This Section

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    PharmGKB entry for TMEM132E Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for TMEM132E gene:
    Search GeneIP for patents involving TMEM132E

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for TMEM132E  
     Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for TMEM132E  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for TMEM132E  
     OriGene qSTAR qPCR primer pairs in human, mouse for TMEM132E   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for TMEM132E   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for TMEM132E   OriGene Custom Protein Services for TMEM132E  

     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat TMEM132E
     QIAGEN SeqTarget long-range PCR primers for resequencing TMEM132E
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TMEM132E
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TMEM132E
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TMEM132E
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TMEM132E
     GenScript Custom Purified and Recombinant Proteins Services for TMEM132E GenScript cDNA clones with any tag delivered in your preferred vector for TMEM132E
     GenScript Custom Assay Services for TMEM132E GenScript Custom Superior Antibodies Services for TMEM132E
     GenScript Custom overexpressing Cell Line Services for TMEM132E CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in TMEM132E promoter
     Search Chromatin IP Primers for TMEM132E
     RT2 qPCR Primer Assay in human, mouse, rat TMEM132E
     Search GNC Networks for TMEM132E
     SABiosciences Custom PCR Arrays for TMEM132E
     Search Tocris compounds for TMEM132E (T132E)
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search for proteins, assays, substrates, inhibitors & antibodies
     Novus Biologicals
     Novus Tissue Slides
     Antibodies for TMEM132E
     See all of Abcam's Antibodies, Kits and Proteins for TMEM132E
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins

     Proteins for TMEM132E
     Antibodies for TMEM132E
     ELISAs for TMEM132E
     CLIAs for TMEM132E
     Search LifeMap BioReagents cell lines for TMEM132E
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TMEM132E
     SwitchGear 3'UTR luciferase reporter plasmids for TMEM132E
     SwitchGear Promoter luciferase reporter plasmids for TMEM132E
     Search ThermoFisher Antibodies for TMEM132E
     Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat TMEM132E
     inGenious Targeting Laboratory - Custom generated mouse model solutions for TMEM132E
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for TMEM132E
     lentivirus for stable overexpression of TMEM132E
     lentivirus expression plasmids for stable overexpression of TMEM132E
     adenovirus for overexpression of TMEM132E
     LSBio Antibodies in human, mouse, rat for TMEM132E
    Customized transgenic rodents for:
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 3 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      TMEM132E gene at Home site.
    hostname: index build: 106 solr: 1.4