Set Analyses:
Advanced Search

Advanced Search

Search By
Section (entire)


TMEM132E Gene

protein-coding   GIFtS: 43
GCID: GC17P032907

Transmembrane Protein 132E

  Try our

disease database 

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Transmembrane Protein 132E1 2

External Ids:    HGNC: 269911   Entrez Gene: 1248422   Ensembl: ENSG000001812917   UniProtKB: Q6IEE73   

Export aliases for TMEM132E gene to outside databases

Previous GC identifers: GC17P029932 GC17P029094

(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

GeneCards Summary for TMEM132E Gene:
TMEM132E (transmembrane protein 132E) is a protein-coding gene. An important paralog of this gene is TMEM132D.

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence at NCBI GenBank:
NC_000017.10  NT_010783.16  NC_018928.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the TMEM132E gene promoter:
         Pax-5   CUTL1   AP-2gamma   E47   YY1   c-Ets-1   S8   HSF2   Hand1   ZIC2/Zic2   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidTMEM132E promoter sequence
   Search Chromatin IP Primers for TMEM132E

DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat TMEM132E

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 17q12   Ensembl cytogenetic band:  17q12   HGNC cytogenetic band: 17q12

TMEM132E Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TMEM132E gene location

GeneLoc information about chromosome 17         GeneLoc Exon Structure

GeneLoc location for GC17P032907:  view genomic region     (about GC identifiers)

32,907,768 bp from pter      End:
32,966,337 bp from pter
58,570 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, antibodies-online, and/or GeneTex,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or others.)
About This Section

UniProtKB/Swiss-Prot: T132E_HUMAN, Q6IEE7 (See protein sequence)
Recommended Name: Transmembrane protein 132E precursor  
Size: 984 amino acids; 107094 Da
Secondary accessions: Q8WUF4 Q8WVA5

Explore the universe of human proteins at neXtProt for TMEM132E: NX_Q6IEE7

Explore proteomics data for TMEM132E at MOPED

Post-translational modifications: 

  • Glycosylation2 at Asn91, Asn228, Asn309
  • Modification sites at PhosphoSitePlus

  • See TMEM132E Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins: NP_997196.1  
    ENSEMBL proteins: 

    TMEM132E Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for TMEM132E
    OriGene Custom MassSpec
    OriGene Custom Protein Services for TMEM132E
    GenScript Custom Purified and Recombinant Proteins Services for TMEM132E
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for TMEM132E

    Search eBioscience for Proteins for TMEM132E 

    Search GeneTex for Proteins for TMEM132E 

    Search antibodies-online for proteins for TMEM132E 

    antibodies-online peptides for TMEM132E

    TMEM132E Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for TMEM132E
    Abcam antibodies for TMEM132E
    Cloud-Clone Corp. Antibodies for TMEM132E
    Search ThermoFisher Antibodies for TMEM132E
    antibodies-online antibodies for TMEM132E (12 products) 

    TMEM132E Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for TMEM132E
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for TMEM132E
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for TMEM132E
    Cloud-Clone Corp. CLIAs for TMEM132E
    Search eBioscience for ELISAs for TMEM132E 
    antibodies-online kits for TMEM132E (4 products) 

    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GenesLikeMe)
    About This Section

    1 InterPro protein domain:
     IPR026307 TMEM132

    Graphical View of Domain Structure for InterPro Entry Q6IEE7

    ProtoNet protein and cluster: Q6IEE7

    UniProtKB/Swiss-Prot: T132E_HUMAN, Q6IEE7
    Similarity: Belongs to the TMEM132 family

    Find genes that share domains with TMEM132E           About GenesLikeMe

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway, and/or Taconic Biosciences, transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
    About This Section

         1 GenomeRNAi human phenotype for TMEM132E:
     Elongated cells 

    Animal Models:
       genOway: Develop your customized and physiologically relevant rodent model for TMEM132E

        Search Taconic Biosciences for animal models for TMEM132E 

    Block miRNA regulation of human, mouse, rat TMEM132E using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate TMEM132E (see all 29):
    hsa-miR-4291 hsa-miR-125a-5p hsa-miR-128 hsa-miR-605 hsa-miR-3653 hsa-miR-486-3p hsa-miR-1205 hsa-miR-4260
    SwitchGear 3'UTR luciferase reporter plasmidTMEM132E 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for TMEM132E
    Predesigned siRNA for gene silencing in human, mouse, rat TMEM132E

    Gene Editing
    DNA2.0 Custom Protein Engineering Service for TMEM132E

    OriGene clones in human, mouse for TMEM132E (see all 5)
    OriGene ORF clones in mouse, rat for TMEM132E
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: TMEM132E (NM_207313)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TMEM132E
    Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat TMEM132E

    Cell Line
    GenScript Custom overexpressing Cell Line Services for TMEM132E
    Browse ESI BIO Cell Lines and PureStem Progenitors for TMEM132E 
    In Situ Assay

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TMEM132E

    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
    About This Section

    Subcellular locations from UniProtKB/Swiss-Prot
    T132E_HUMAN, Q6IEE7: Membrane; Single-pass type I membrane protein (Potential)
    Subcellular locations from COMPARTMENTS: 

    endoplasmic reticulum2
    plasma membrane2
    golgi apparatus1

    Gene Ontology (GO): 1 cellular component term:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0016021integral component of membrane IEA--

    Find genes that share ontologies with TMEM132E           About GenesLikeMe

    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GenesLikeMe, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
    About This Section

        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for TMEM132E

        Search GeneGlobe Interaction Network for TMEM132E

    1 Interacting protein for TMEM132E (Q6IEE73) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    TARBP2Q156333I2D: score=2 
    About this table

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, Sets of similar genes according to GenesLikeMe)
    About This Section

    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for TMEM132E (T132E)

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    REFSEQ mRNAs for TMEM132E gene (2 alternative transcripts): 
    NM_207313.1  XM_006721692.1  

    Unigene Cluster for TMEM132E:

    Transmembrane protein 132E
    Hs.310482  [show with all ESTs]
    Unigene Representative Sequence: NM_207313
    2 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000321639(uc002hif.3) ENST00000577271
    Block miRNA regulation of human, mouse, rat TMEM132E using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate TMEM132E (see all 29):
    hsa-miR-4291 hsa-miR-125a-5p hsa-miR-128 hsa-miR-605 hsa-miR-3653 hsa-miR-486-3p hsa-miR-1205 hsa-miR-4260
    SwitchGear 3'UTR luciferase reporter plasmidTMEM132E 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for TMEM132E
    Predesigned siRNA for gene silencing in human, mouse, rat TMEM132E
    OriGene clones in human, mouse for TMEM132E (see all 5)
    OriGene ORF clones in mouse, rat for TMEM132E
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: TMEM132E (NM_207313)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TMEM132E
    Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat TMEM132E
    OriGene qSTAR qPCR primer pairs in human, mouse for TMEM132E
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TMEM132E
      QuantiTect SYBR Green Assays in human, mouse, rat TMEM132E
      QuantiFast Probe-based Assays in human, mouse, rat TMEM132E

    Additional mRNA sequence: 

    BC018318.1 BC020591.1 

    1 DOTS entry:


    12 AceView cDNA sequences:

    BN000149 AA777050 AI678145 NM_207313 BC020591 BF346126 BQ068843 BC018318 
    BX281016 BG912538 N34927 BQ339724 

    GeneLoc Exon Structure

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GenesLikeMe, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TMEM132E expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    TMEM132E Expression
    About this image

    TMEM132E expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     Heart (Cardiovascular System)
             Atrioventricular Canal Cells Atrioventricular Canal
    TMEM132E Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    TMEM132E Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.310482
        Custom PCR Arrays for TMEM132E
    OriGene qSTAR qPCR primer pairs in human, mouse for TMEM132E
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TMEM132E
    QuantiTect SYBR Green Assays in human, mouse, rat TMEM132E
    QuantiFast Probe-based Assays in human, mouse, rat TMEM132E
    In Situ
    Assay Products:

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TMEM132E

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for TMEM132E gene from Selected species (see all 15)    About this table
    Organism Taxonomic
    Gene Description Human
    (Mus musculus)
    Mammalia Tmem132e1 , 5 transmembrane protein 132E1, 5 86.42(n)1
      11 (50.08 cM)5
    2708931  NM_023438.21  NP_075927.21 
    (Gallus gallus)
    Aves TMEM132E1 transmembrane protein 132E 76.28(n)
      771389  XM_001234667.3  XP_001234668.3 
    (Anolis carolinensis)
    Reptilia TMEM132E6
    transmembrane protein 132E
    1 ↔ 1
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia LOC1004918531 transmembrane protein 132E-like 65.26(n)
      100491853  XM_002940528.2  XP_002940574.2 
    (Danio rerio)
    Actinopterygii tmem132e1 transmembrane protein 132E 63.57(n)
      564044  XM_687404.6  XP_692496.5 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG144461 CG14446 44.97(n)
      31555  NM_001258618.1  NP_001245547.1 
    (Caenorhabditis elegans)
    Secernentea Y71H2AM.106
    Protein Y71H2AM.10 (Y71H2AM.10) mRNA, complete cds...
    1 → many
    III(2707737-2716277) WBGene00022175

    ENSEMBL Gene Tree for TMEM132E (if available)
    TreeFam Gene Tree for TMEM132E (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to Build 68,Sets of similar genes according to GenesLikeMe)
    About This Section

    Paralogs for TMEM132E gene
    TMEM132D2  TMEM132A2  TMEM132C2  TMEM132B2  
    3 SIMAP similar genes for TMEM132E using alignment to 1 protein entry:     T132E_HUMAN:
    TMEM132C    TMEM132D    TMEM132B

    Find genes that share paralogs with TMEM132E           About GenesLikeMe

    1 Pseudogene for TMEM132E

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    Selected SNPs for TMEM132E (see all 1335)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    Chr 17 posSequence#AA
    C--29127831(+) CCCTG-/GGTTTCCCCAGGAG
    1 -- int11Minor allele frequency- GGTTTCCCCAGGAGCAGGACTAGGAGGCCAG:0.00NA 2
    C--32909540(+) GGGGGG/TTTGTT 1 -- int10--------
    C--32913837(+) AAAAAA/GGGGAA 1 -- int10--------
    C,F,A,H--32923087(+) CACACG/ACACAA 1 -- int14Minor allele frequency- A:0.44NA WA CSA 9
    C--32923087(+) CACAC-/GCACAAC 1 -- int11Minor allele frequency- GC:0.00NA 2
    C--32942183(+) ACTAGG/AAGGCC 1 -- int11Minor allele frequency- A:0.50CSA 2
    C,F--32950421(+) CCGCT-/C/CCC 
    2 -- int1 cds1 trp32NA 4
    C--32968222(+) CACCCC/ACACCT 1 -- us2k11Minor allele frequency- A:0.00EU 983
    C--32968316(+) ATAAAT/CAGGTT 1 -- us2k12Minor allele frequency- C:0.08WA 120
    C--32968354(+) CGCACG/TAAGCT 1 -- us2k11Minor allele frequency- T:0.00EU 1000

    HapMap Linkage Disequilibrium report for TMEM132E (32907768 - 32966337 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 5 variations for TMEM132E:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2715865CNV Deletion23290073
    esv2715864CNV Deletion23290073
    nsv833423CNV Loss17160897
    nsv519297CNV Gain19592680
    esv33292CNV Gain17666407

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing TMEM132E
    DNA2.0 Custom Variant and Variant Library Synthesis for TMEM132E

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB, Sets of similar genes according to GenesLikeMe)
    About This Section

    UniProtKB/Swiss-Prot: T132E_HUMAN, Q6IEE7
  • Note=TMEM132E is located in a region involved in a heterozygous deletion of approximately 4.7 Mb; this
    deletion, involving the NF1 gene and contiguous genes lying in its flanking regions, is observed in a patient
    17q11.2 microdeletion syndrome, a syndrome characterized by variable facial dysmorphism, mental retardation,
    developmental delay, and an excessive number of neurofibromas

  • Find genes that share disorders with TMEM132E           About GenesLikeMe

    Genetic Association Database (GAD): TMEM132E

    Export disorders for TMEM132E gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for TMEM132E gene integrated from 10 sources:
    (articles sorted by number of sources associating them with TMEM132E)

    1. Heterogeneity of breakpoints in non-LCR-mediated large constitutional deletions of the 17q11.2 NF1 tumour suppressor region. (PubMed id 14569139)1, 2 Kehrer-Sawatzki H.... Jenne D.E. (J. Med. Genet. 2003)
    2. Genetic modifiers of menopausal hormone replacement therapy and breast cancer risk: a genome-wide interaction study. (PubMed id 24080446)1 Rudolph A....Chang-Claude J. (Endocr. Relat. Cancer 2013)
    3. Genome-wide association study of the five-factor model of personality in young Korean women. (PubMed id 23903073)1 Kim H.N....Kim H.L. (J. Hum. Genet. 2013)
    4. DNA sequence of human chromosome 17 and analysis of rearrangement in the human lineage. (PubMed id 16625196)2 Zody M.C.... Nusbaum C. (Nature 2006)
    5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    6. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
    Free Text  

      Query String
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 124842 HGNC: 26991 AceView: LOC124842 Ensembl:ENSG00000181291 euGenes: HUgn124842
    ECgene: TMEM132E H-InvDB: TMEM132E

    (According to HUGE)
    About This Section

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section
    PharmGKB entry for TMEM132E Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for TMEM132E gene:
    Search GeneIP for patents involving TMEM132E

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, GeneTex, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from genOway and/or Taconic Biosciences)
    About This Section

     EMD Millipore genomic analysis products

     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for TMEM132E  
     Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for TMEM132E  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for TMEM132E  
     OriGene qSTAR qPCR primer pairs in human, mouse for TMEM132E   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for TMEM132E   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for TMEM132E   OriGene Custom Protein Services for TMEM132E  

     Block miRNA regulation of human, mouse, rat TMEM132E using miScript Target Protectors SeqTarget long-range PCR primers for resequencing TMEM132E
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat TMEM132E Predesigned siRNA for gene silencing in human, mouse, rat TMEM132E
     QuantiFast Probe-based Assays in human, mouse, rat TMEM132E QuantiTect SYBR Green Assays in human, mouse, rat TMEM132E
     Custom PCR Arrays for TMEM132E Search Chromatin IP Primers for TMEM132E
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TMEM132E  Search GeneGlobe Interaction Network for TMEM132E
     Regulatory tfbs in TMEM132E promoter
     GenScript Custom Purified and Recombinant Proteins Services for TMEM132E GenScript cDNA clones with any tag delivered in your preferred vector for TMEM132E
     GenScript Custom Assay Services for TMEM132E GenScript Custom overexpressing Cell Line Services for TMEM132E
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for TMEM132E (T132E)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search for proteins, assays, substrates, inhibitors & antibodies

     Novus Biologicals
     Novus Tissue Slides
     Antibodies for TMEM132E
     See all of Abcam's Antibodies, Kits and Proteins for TMEM132E
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for TMEM132E
     Antibodies for TMEM132E
     ELISAs for TMEM132E
     CLIAs for TMEM132E

     Browse ESI BIO Cell Lines and PureStem Progenitors for TMEM132E
      Search Taconic Biosciences for animal models for TMEM132E
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TMEM132E
     SwitchGear 3'UTR luciferase reporter plasmids for TMEM132E
     SwitchGear Promoter luciferase reporter plasmids for TMEM132E
     Search ThermoFisher Antibodies for TMEM132E
     Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat TMEM132E
     Browse compounds at ApexBio
     Search Addgene for plasmids for TMEM132E
      Search eBioscience for proteins for TMEM132E
      Search eBioscience for elisas for TMEM132E
      eBioscience FlowRNA Probe Sets
     genOway: Develop your customized and physiologically relevant rodent model for TMEM132E
     antibodies-online antibodies for TMEM132E (12 products)
     antibodies-online kits for TMEM132E (4 products)
     antibodies-online peptides for TMEM132E
      Search antibodies-online for proteins for TMEM132E
      Search GeneTex for proteins for TMEM132E

     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
    GeneCards Home - Full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014 , 2 Nov 2014 , 8 Jan 2015 , 3 Feb 2015 , 22 Mar 2015

    View Random Gene

    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science
    This site does not provide medical advice and is for research use only
    Hot genes      Disease genes      TMEM132E gene at Home site.
    Version: 3.12.364 30 Mar 2015
    hostname: index build: 128 solr: 1.4