Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

TLK1 Gene

protein-coding   GIFtS: 65
GCID: GC02M171812

Tousled-Like Kinase 1

Microbiology & Infectious Diseases Congress
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Tousled-Like Kinase 11 2 3     Serine/Threonine-Protein Kinase Tousled-Like 12
PKU-beta2 3     SNARE Protein Kinase SNAK2
EC 2.7.11.13 8     KIAA01373
Serine Threonine Protein Kinase2     EC 2.7.118

External Ids:    HGNC: 118411   Entrez Gene: 98742   Ensembl: ENSG000001985867   OMIM: 6084385   UniProtKB: Q9UKI83   

Export aliases for TLK1 gene to outside databases

Previous GC identifers: GC02M169900 GC02M170390 GC02M172051 GC02M171674 GC02M171556 GC02M163735


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for TLK1 Gene:
The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin
assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell
cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this
protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding
different isoforms have been found for this gene. (provided by RefSeq, Nov 2011)

GeneCards Summary for TLK1 Gene: 
TLK1 (tousled-like kinase 1) is a protein-coding gene. Diseases associated with TLK1 include cholangitis, and tuberculosis, and among its related super-pathways are Cell Cycle / Checkpoint Control and G2-M Phase Transition. GO annotations related to this gene include protein serine/threonine kinase activity and ATP binding. An important paralog of this gene is TTK.

UniProtKB/Swiss-Prot: TLK1_HUMAN, Q9UKI8
Function: Rapidly and transiently inhibited by phosphorylation following the generation of DNA double-stranded
breaks during S-phase. This is cell cycle checkpoint and ATM-pathway dependent and appears to regulate processes
involved in chromatin assembly. Isoform 3 phosphorylates and enhances the stability of the t-SNARE SNAP23,
augmenting its assembly with syntaxin. Isoform 3 protects the cells from the ionizing radiation by facilitating
the repair of DSBs. In vitro, phosphorylates histone H3 at 'Ser-10'

Gene Wiki entry for TLK1 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000002.11  NT_005403.17  NC_018913.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the TLK1 gene promoter:
         Pbx1a   HNF-1   FOXO3a   FOXO3   Sox9   Nkx2-5   FOXO3b   HNF-1A   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): TLK1 promoter sequence
   Search SABiosciences Chromatin IP Primers for TLK1

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TLK1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 2q31.1   Ensembl cytogenetic band:  2q31.1   HGNC cytogenetic band: 2q31.1

TLK1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TLK1 gene location

GeneLoc information about chromosome 2         GeneLoc Exon Structure

GeneLoc location for GC02M171812:  view genomic region     (about GC identifiers)

Start:
171,847,333 bp from pter      End:
172,087,824 bp from pter
Size:
240,492 bases      Orientation:
minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: TLK1_HUMAN, Q9UKI8 (See protein sequence)
Recommended Name: Serine/threonine-protein kinase tousled-like 1  
Size: 766 amino acids; 86700 Da
Cofactor: Magnesium
Subunit: Heterodimerizes with TLK2. Interacts with ASF1A and ASF1B
Subcellular location: Nucleus
Sequence caution: Sequence=AAF03094.1; Type=Erroneous initiation; Sequence=BAA09486.2; Type=Erroneous initiation;
Secondary accessions: B3KR15 B4DX87 Q14150 Q8N591 Q9NYH2 Q9Y4F6
Alternative splicing: 5 isoforms:  Q9UKI8-1   Q9UKI8-2   Q9UKI8-3   Q9UKI8-4   Q9UKI8-5   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for TLK1: NX_Q9UKI8

Explore proteomics data for TLK1 at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q9UKI8

  • 4/13 DME Specific Peptides for TLK1 (Q9UKI8) (see all 13)
     KERLNKC  IKITDFG  KPGNILL  IKITDFGL 

    TLK1 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    TLK1 Protein Expression
    REFSEQ proteins (3 alternative transcripts): 
    NP_001130026.1  NP_001130027.1  NP_036422.3  

    ENSEMBL proteins: 
     ENSP00000411099   ENSP00000354089   ENSP00000352810   ENSP00000428113   ENSP00000409222  
     ENSP00000387313   ENSP00000393165   ENSP00000402165  

    Human Recombinant Protein Products for TLK1: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for TLK1
    OriGene Protein Over-expression Lysate for TLK1
    OriGene MassSpec for TLK1 
    OriGene Custom Protein Services for TLK1
    GenScript Custom Purified and Recombinant Proteins Services for TLK1
    Novus Biologicals TLK1 Protein
    Novus Biologicals TLK1 Lysate
    Sino Biological Recombinant Protein for TLK1
    Sino Biological Cell Lysate for TLK1 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for TLK1 

    Gene Ontology (GO): 1 cellular component term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus TAS9427565

    TLK1 for ontologies           About GeneDecksing



    TLK1 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Cell Signaling Technology (CST) Antibodies for TLK1  (TLK1 iso1)
    OriGene Antibodies for TLK1
    OriGene Custom Antibody Services for TLK1
    GenScript Custom Superior Antibodies Services for TLK1
    Novus Biologicals TLK1 Antibodies
    Abcam antibodies for TLK1
    Cloud-Clone Corp. Antibodies for TLK1 
    ThermoFisher Antibodies for TLK1
    LSBio Antibodies in human, mouse, rat for TLK1 

    Assay Products for TLK1: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for TLK1
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for TLK1
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for TLK1 
    Cloud-Clone Corp. CLIAs for TLK1


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    IUPHAR Guide to PHARMACOLOGY protein family classification: tousled-like kinase 1 
    Tousled-like kinase (TLK) family

    5/6 InterPro protein domains (see all 6):
     IPR017441 Protein_kinase_ATP_BS
     IPR002290 Ser/Thr_dual-sp_kinase_dom
     IPR011009 Kinase-like_dom
     IPR008271 Ser/Thr_kinase_AS
     IPR027086 TLK

    Graphical View of Domain Structure for InterPro Entry Q9UKI8

    ProtoNet protein and cluster: Q9UKI8

    UniProtKB/Swiss-Prot: TLK1_HUMAN, Q9UKI8
    Similarity: Belongs to the protein kinase superfamily. Ser/Thr protein kinase family
    Similarity: Contains 1 protein kinase domain


    TLK1 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: TLK1_HUMAN, Q9UKI8
    Function: Rapidly and transiently inhibited by phosphorylation following the generation of DNA double-stranded
    breaks during S-phase. This is cell cycle checkpoint and ATM-pathway dependent and appears to regulate processes
    involved in chromatin assembly. Isoform 3 phosphorylates and enhances the stability of the t-SNARE SNAP23,
    augmenting its assembly with syntaxin. Isoform 3 protects the cells from the ionizing radiation by facilitating
    the repair of DSBs. In vitro, phosphorylates histone H3 at 'Ser-10'
    Catalytic activity: ATP + a protein = ADP + a phosphoprotein
    Enzyme regulation: Cell-cycle regulated, maximal activity in S-phase. Inactivated by phosphorylation at Ser-743,
    potentially by CHEK1

         Genatlas biochemistry entry for TLK1:
    tousled-like kinase 1,nuclear serine/threonine kinase PKU beta,broadly expressed,autophosphorylating and
    dimerizing cell-cycle regulated displaying maximal activities during S phase,Arabidopsis thaliana homolog

         Enzyme Numbers (IUBMB): EC 2.7.11.11 2 EC 2.7.112

         Gene Ontology (GO): 5 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004672protein kinase activity ----
    GO:0004674protein serine/threonine kinase activity TAS9427565
    GO:0004713protein tyrosine kinase activity ----
    GO:0005524ATP binding IDA12660173
    GO:0016772transferase activity, transferring phosphorus-containing groups ----
         
    TLK1 for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for TLK1:
     Decreased viability with TRAIL  Upregulation of Wnt/beta-caten 

    Animal Models:
       inGenious Targeting Laboratory - Custom generated mouse model solutions for TLK1 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for TLK1

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for TLK1 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for TLK1 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TLK1
    8/80 QIAGEN miScript miRNA Assays for microRNAs that regulate TLK1 (see all 80):
    hsa-miR-15a hsa-miR-200a hsa-miR-219-5p hsa-miR-409-5p hsa-miR-489 hsa-miR-556-3p hsa-miR-192* hsa-miR-761
    SwitchGear 3'UTR luciferase reporter plasmidTLK1 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for TLK1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TLK1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for TLK1
    Sirion Biotech Customized adenovirus for overexpression of TLK1

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for TLK1 (see all 15)
    OriGene ORF clones in mouse, rat for TLK1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): TLK1 (NM_012290)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TLK1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TLK1
    Sirion Biotech Customized lentivirus for stable overexpression of TLK1 
                         Customized lentivirus expression plasmids for stable overexpression of TLK1 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for TLK1
    Search LifeMap BioReagents cell lines for TLK1
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TLK1


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for TLK1 About                                                                                                See pathways by source

    SuperPathContained pathways About
    1DNA Damage
    DNA Damage0.32
    Cell Cycle / Checkpoint Control0.32
    2Chks in Checkpoint Regulation
    Chks in Checkpoint Regulation0.59
    3p53 signaling pathway
    DNA damage response0.41
    4Signal transduction Activin A signaling regulation
    Histone modification0.31
    5ATM Pathway
    ATM Pathway

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    1 EMD Millipore Pathway for TLK1
        Histone modification

    2 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for TLK1
        ATM Pathway
    Chks in Checkpoint Regulation

    2 Cell Signaling Technology (CST) Pathways for TLK1
        Cell Cycle / Checkpoint Control
    DNA Damage

    1 BioSystems Pathway for TLK1
        DNA damage response




    TLK1 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for TLK1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 11)

    5/12 Interacting proteins for TLK1 (Q9UKI82, 3 ENSP000004110994) via UniProtKB, MINT, STRING, and/or I2D (see all 12)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    ASF1AQ9Y2942, 3, ENSP000002295954MINT-67546 I2D: score=6 STRING: ENSP00000229595
    SNAP23O001612, 3, ENSP000002496474MINT-17055 I2D: score=3 STRING: ENSP00000249647
    YWHAEP622583, ENSP000002643354I2D: score=3 STRING: ENSP00000264335
    AURKAO149653, ENSP000002169114I2D: score=1 STRING: ENSP00000216911
    ASF1BQ9NVP23, ENSP000002633824I2D: score=3 STRING: ENSP00000263382
    About this table

    Gene Ontology (GO): 5/7 biological process terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001672regulation of chromatin assembly or disassembly IDA12660173
    GO:0006468protein phosphorylation IDA12660173
    GO:0006886intracellular protein transport IDA10588641
    GO:0006974response to DNA damage stimulus IEA--
    GO:0007049cell cycle IEA--

    TLK1 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for TLK1

    1 HMDB Compound for TLK1    About this table
    CompoundSynonyms CAS #PubMed Ids
    MagnesiumMagnesium (see all 2)7439-95-4--

    Search CenterWatch for drugs/clinical trials and news about TLK1

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for TLK1 gene (3 alternative transcripts): 
    NM_001136554.1  NM_001136555.1  NM_012290.4  

    Unigene Cluster for TLK1:

    Tousled-like kinase 1
    Hs.744917  [show with all ESTs]
    Unigene Representative Sequence: NM_012290
    13 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000431350(uc010zdn.1 uc002ugp.2) ENST00000360843 ENST00000359766
    ENST00000521943 ENST00000434911 ENST00000409443(uc002ugq.2) ENST00000413010
    ENST00000478683(uc002ugr.1) ENST00000486857 ENST00000453628 ENST00000470340
    ENST00000466220 ENST00000442919(uc002ugn.2 uc002ugo.2)
    Congresses - knowledge worth sharing:  
    European Congress of Clinical Microbiology and Infectious Diseases (ECCMID) 10 - 13 May 2014

    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TLK1
    8/80 QIAGEN miScript miRNA Assays for microRNAs that regulate TLK1 (see all 80):
    hsa-miR-15a hsa-miR-200a hsa-miR-219-5p hsa-miR-409-5p hsa-miR-489 hsa-miR-556-3p hsa-miR-192* hsa-miR-761
    SwitchGear 3'UTR luciferase reporter plasmidTLK1 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for TLK1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TLK1
    Clone
    Products:
         
    OriGene clones in human, mouse for TLK1 (see all 15)
    OriGene ORF clones in mouse, rat for TLK1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): TLK1 (NM_012290)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TLK1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TLK1
    Sirion Biotech Customized lentivirus for stable overexpression of TLK1 
                         Customized lentivirus expression plasmids for stable overexpression of TLK1 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for TLK1
    OriGene qSTAR qPCR primer pairs in human, mouse for TLK1
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TLK1
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TLK1
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TLK1

    Additional mRNA sequence: 

    AF162666.1 AF246219.1 AK090779.1 AK292508.1 AK301857.1 BC032657.1 BX537631.1 D50927.2 
    Z25421.1 

    16 DOTS entries:

    DT.100819754  DT.92440397  DT.120966190  DT.100036676  DT.206786  DT.100819756  DT.87007891  DT.100708826 
    DT.95230131  DT.120966186  DT.100819748  DT.100819752  DT.120966209  DT.445900  DT.75172579  DT.100880913 

    24/231 AceView cDNA sequences (see all 231):

    BQ025854 CB119649 AI638170 AI523163 BM147822 BQ931435 BE466676 AV702170 
    AI566108 AI298206 AA424123 AI334207 Z42971 AU119119 AA424035 AA782784 
    BP356036 AI650704 CB123552 AK091975 BM979121 BE857197 AA373979 AI401317 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TLK1 expression in normal human tissues (normalized intensities)      TLK1 embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TTGCAGAAAA
    TLK1 Expression
    About this image


    TLK1 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/3 selected tissues (see all 3) fully expand
     
     Limb (Muscoskeletal System)
             Limb Bud
     
     Blood (Hematopoietic System)
             platelets   
     
     Eye (Sensory Organs)
             Glycinergic Amacrine Cells Inner Nuclear Layer

    See TLK1 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for TLK1

    SOURCE GeneReport for Unigene cluster: Hs.744917

    UniProtKB/Swiss-Prot: TLK1_HUMAN, Q9UKI8
    Tissue specificity: Widely expressed. Present in fetal placenta, liver, kidney and pancreas but not heart or
    skeletal muscle. Also found in adult cell lines. Isoform 3 is ubiquitously expressed in all tissues examined

        SABiosciences Custom PCR Arrays for TLK1
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for TLK1
    OriGene qSTAR qPCR primer pairs in human, mouse for TLK1
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TLK1
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TLK1
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TLK1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TLK1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for TLK1 gene from 9/18 species (see all 18)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Tlk11 , 5 tousled-like kinase 11, 5 91.91(n)1
    98.17(a)1
      2 (41.90 cM)5
    2280121  NM_172664.31  NP_766252.21 
     707124075 
    chicken
    (Gallus gallus)
    Aves TLK11 tousled-like kinase 1 86.72(n)
    94.99(a)
      429024  XM_426581.3  XP_426581.3 
    lizard
    (Anolis carolinensis)
    Reptilia TLK16
    tousled-like kinase 1
    96(a)
    1 ↔ 1
    GL343353.1(865440-928531)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.223952 Xenopus laevis transcribed sequence with strong similarity more 82.48(n)    BU901114.1 
    zebrafish
    (Danio rerio)
    Actinopterygii tlk1a6
    tlk1b6
    tousled-like kinase 1b
    82(a)
    81(a)
    1 ↔ many
    1 ↔ many
    9(3544979-3605958)
    6(3693368-3794863)
    fruit fly
    (Drosophila melanogaster)
    Insecta BcDNA:GH079103 protein amino acid phosphorylation
    protein kinase
    72(a)     --
    worm
    (Caenorhabditis elegans)
    Secernentea tlk-16
    Serine/threonine-protein kinase tousled-like 1
    31(a)
    1 → many
    III(9699881-9710268)
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes MPS16
    Dual-specificity kinase required for spindle pole ...
    11(a)
    1 → many
    IV(400997-403291)
    rice
    (Oryza sativa)
    Liliopsida AK111604.12   -- 75.88(n)    AK111604.1 


    ENSEMBL Gene Tree for TLK1 (if available)
    TreeFam Gene Tree for TLK1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for TLK1 gene
    TTK2  TLK22  
    4 SIMAP similar genes for TLK1 using alignment to 6 protein entries:     TLK1_HUMAN (see all proteins):
    TLK2    STK11    NUAK1    DKFZp564L2416

    TLK1 for paralogs           About GeneDecksing


    3 Pseudogenes.org Pseudogenes for TLK1
    PGOHUM00000258040 PGOHUM00000263188 PGOHUM00000236766


    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/4664 SNPs in TLK1 are shown (see all 4664)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 2 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0412154
    ----see VAR_0412152 R C mis40--------
    rs576105921,2
    C--171299348(+) AATTG-/AAACC/CAACTCTCTAATATCACAAGGACATTATTGTGAT
    ATCACAATAATCACACAATAATCAAACAAGAGTTTGATATCTG
    CAAAC
    3 -- int11NA 2
    rs1384613371,2
    C--171299348(+) AATTG-/AAACCC
            
    AAACT
    3 -- int10--------
    rs1870375481,2
    --171846987(+) ATGTTG/TGTCAG 3 -- ds50010--------
    rs67141641,2
    C,F,A,H--171847117(+) TCTTCA/CGAACA 3 -- ds500121Minor allele frequency- C:0.27NS EA NA WA CSA 2348
    rs27232381,2
    C,F--171847195(+) AAAGAC/TCTGTC 3 -- ds50012Minor allele frequency- T:0.04CSA WA 119
    rs67583311,2
    C,F,A,H--171847269(+) TTAAAT/CTTTAA 3 -- ds500111Minor allele frequency- C:0.12NS EA NA WA 782
    rs67432011,2
    C,F,A--171847275(+) TTTAAG/AAGTAA 3 -- ds50018Minor allele frequency- A:0.29NA WA EA 368
    rs1908799981,2
    --171847336(+) AGGGCA/CATCAA 3 -- ut310--------
    rs105680021,2
    C--171847388(+) ACACA-/ATATACT 1 -- ut310--------

    HapMap Linkage Disequilibrium report for TLK1 (171847333 - 172087824 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 5 variations for TLK1:    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2660349CNV Deletion23128226
    esv2664440CNV Deletion23128226
    nsv3030CNV Insertion18451855
    nsv522291CNV Loss19592680
    nsv834456CNV Loss17160897


    Human Gene Mutation Database (HGMD): TLK1
    SABiosciences Cancer Mutation PCR Assays
    Search QIAGEN SeqTarget long-range PCR primers for resequencing TLK1
    DNA2.0 Custom Variant and Variant Library Synthesis for TLK1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 608438    OMIM disorders: --

    3 diseases for TLK1:    About MalaCards
    cholangitis    tuberculosis    breast cancer


    TLK1 for disorders           About GeneDecksing

    Genetic Association Database (GAD): TLK1

    Export disorders for TLK1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for TLK1 gene, integrated from 9 sources (see all 46):
    (articles sorted by number of sources associating them with TLK1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Human tousled like kinases are targeted by an ATM- and Chk1-dependent DNA damage checkpoint. (PubMed id 12660173)1, 2, 3 Groth A....Hansen K. (2003)
    2. cDNA cloning and chromosomal mapping of genes encoding novel protein kinases termed PKU-alpha and PKU-beta, which have nuclear localization signal. (PubMed id 9427565)1, 2, 3 Yamakawa A.... Date T. (1997)
    3. Identification of human Asf1 chromatin assembly factors as substrates of Tousled-like kinases. (PubMed id 11470414)1, 2, 9 Sillje H.H. and Nigg E.A. (2001)
    4. Meta-analyses identify 13 loci associated with age at menopause and highlight DNA repair and immune pathways. (PubMed id 22267201)1, 4 Stolk L....Lunetta K.L. (2012)
    5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    6. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    7. Construction of expression-ready cDNA clones for KIAA genes: manual curation of 330 KIAA cDNA clones. (PubMed id 12168954)1, 2 Nakajima D.... Nagase T. (2002)
    8. A translationally regulated Tousled kinase phosphorylates histone H3 and confers radioresistance when overexpressed. (PubMed id 11314006)1, 2 Li Y.... De Benedetti A. (2001)
    9. Mammalian homologues of the plant tousled gene code for cell-cycle- regulated kinases with maximal activities linked to ongoing DNA replication. (PubMed id 10523312)1, 2 Sillje H.H.W.... Nigg E.A. (1999)
    10. Phosphorylation of SNAP-23 by the novel kinase SNAK regulates t-SNARE complex assembly. (PubMed id 10588641)1, 2 Cabaniols J.-P.... Roche P.A. (1999)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 9874 HGNC: 11841 AceView: TLK1 Ensembl:ENSG00000198586 euGenes: HUgn9874
    ECgene: TLK1 H-InvDB: TLK1

    (According to HUGE)
    About This Section
    HUGE: KIAA0137

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for TLK1 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for TLK1 gene:
    Search GeneIP for patents involving TLK1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for TLK1   OriGene RNAi products in human, mouse, rat for TLK1  
     OriGene qPCR primer pairs and template standards for TLK1   OriGene Protein Over-expression Lysate for TLK1  
     OriGene MassSpec something-or-other for TLK1   OriGene clones in human, mouse for TLK1  
     OriGene qSTAR qPCR primer pairs in human, mouse for TLK1   OriGene Purified Protein for TLK1  
     OriGene ORF clones in mouse, rat for TLK1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for TLK1   OriGene Custom Protein Services for TLK1  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat TLK1
     QIAGEN SeqTarget long-range PCR primers for resequencing TLK1
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TLK1
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TLK1
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TLK1
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TLK1
     GenScript Custom Purified and Recombinant Proteins Services for TLK1 GenScript cDNA clones with any tag delivered in your preferred vector for TLK1
     GenScript Custom Assay Services for TLK1 GenScript Custom Superior Antibodies Services for TLK1
     GenScript Custom overexpressing Cell Line Services for TLK1 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Antibodies & Assays for TLK1 
    (TLK1 iso1)

     Regulatory tfbs in TLK1 promoter
     Search Chromatin IP Primers for TLK1
     RT2 qPCR Primer Assay in human, mouse, rat TLK1
     GNC Network for TLK1
     SABiosciences PCR Arrays including human, mouse, rat TLK1
     Search Tocris compounds for TLK1
     Proteins and Antibodies for TLK1
     Cell Lysates for TLK1
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     TLK1 antibodies
     TLK1 proteins
     TLK1 lysates
     Antibodies for TLK1
     See all of Abcam's Antibodies, Kits and Proteins for TLK1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Proteins for TLK1
     Antibodies for TLK1
     ELISAs for TLK1
     CLIAs for TLK1
     Search LifeMap BioReagents cell lines for TLK1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TLK1
     SwitchGear 3'UTR luciferase reporter plasmids for TLK1
     SwitchGear Promoter luciferase reporter plasmids for TLK1
     ThermoFisher Antibodies for TLK1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TLK1
     inGenious Targeting Laboratory - Custom generated mouse model solutions for TLK1
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for TLK1
    Customized:
     lentivirus for stable overexpression of TLK1
     lentivirus expression plasmids for stable overexpression of TLK1
     adenovirus for overexpression of TLK1
     LSBio Antibodies in human, mouse, rat for TLK1
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      TLK1 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4