Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



TLK1 Gene

protein-coding   GIFtS: 62
GCID: GC02M171812

Tousled-Like Kinase 1

  Try our

disease database 

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Tousled-Like Kinase 11 2 3     Serine/Threonine-Protein Kinase Tousled-Like 12
PKU-beta2 3     SNARE Protein Kinase SNAK2
EC 2.7.11.13 8     KIAA01373
Serine Threonine Protein Kinase2     EC 2.7.118

External Ids:    HGNC: 118411   Entrez Gene: 98742   Ensembl: ENSG000001985867   OMIM: 6084385   UniProtKB: Q9UKI83   

Export aliases for TLK1 gene to outside databases

Previous GC identifers: GC02M169900 GC02M170390 GC02M172051 GC02M171674 GC02M171556 GC02M163735


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for TLK1 Gene:
The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin
assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell
cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this
protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding
different isoforms have been found for this gene. (provided by RefSeq, Nov 2011)

GeneCards Summary for TLK1 Gene:
TLK1 (tousled-like kinase 1) is a protein-coding gene. GO annotations related to this gene include protein serine/threonine kinase activity. An important paralog of this gene is TTK.

UniProtKB/Swiss-Prot: TLK1_HUMAN, Q9UKI8
Function: Rapidly and transiently inhibited by phosphorylation following the generation of DNA double-stranded
breaks during S-phase. This is cell cycle checkpoint and ATM-pathway dependent and appears to regulate processes
involved in chromatin assembly. Isoform 3 phosphorylates and enhances the stability of the t-SNARE SNAP23,
augmenting its assembly with syntaxin. Isoform 3 protects the cells from the ionizing radiation by facilitating
the repair of DSBs. In vitro, phosphorylates histone H3 at 'Ser-10'

Gene Wiki entry for TLK1 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
Regulatory elements:
   Regulatory transcription factor binding sites in the TLK1 gene promoter:
         Pbx1a   HNF-1   FOXO3a   FOXO3   Sox9   Nkx2-5   FOXO3b   HNF-1A   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): TLK1 promoter sequence
   Search Chromatin IP Primers for TLK1

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat TLK1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 2q31.1   Ensembl cytogenetic band:  2q31.1   HGNC cytogenetic band: 2q31.1

TLK1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TLK1 gene location

GeneLoc information about chromosome 2         GeneLoc Exon Structure

GeneLoc location for GC02M171812:  view genomic region     (about GC identifiers)

Start:
171,847,333 bp from pter      End:
172,087,824 bp from pter
Size:
240,492 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, and/or antibodies-online,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: TLK1_HUMAN, Q9UKI8 (See protein sequence)
Recommended Name: Serine/threonine-protein kinase tousled-like 1  
Size: 766 amino acids; 86700 Da
Cofactor: Magnesium
Subunit: Heterodimerizes with TLK2. Interacts with ASF1A and ASF1B
Sequence caution: Sequence=AAF03094.1; Type=Erroneous initiation; Sequence=BAA09486.2; Type=Erroneous initiation;
Secondary accessions: B3KR15 B4DX87 Q14150 Q8N591 Q9NYH2 Q9Y4F6
Alternative splicing: 5 isoforms:  Q9UKI8-1   Q9UKI8-2   Q9UKI8-3   Q9UKI8-4   Q9UKI8-5   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for TLK1: NX_Q9UKI8

Explore proteomics data for TLK1 at MOPED

Post-translational modifications: 

  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus
  • Selected DME Specific Peptides for TLK1 (Q9UKI8) (see all 13)
     KERLNKC  IKITDFG  KPGNILL  IKITDFGL 


    See TLK1 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (3 alternative transcripts): 
    NP_001130026.1  NP_001130027.1  NP_036422.3  

    ENSEMBL proteins: 
     ENSP00000411099   ENSP00000354089   ENSP00000352810   ENSP00000428113   ENSP00000409222  
     ENSP00000387313   ENSP00000393165   ENSP00000402165  

    TLK1 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for TLK1
    OriGene Protein Over-expression Lysate for TLK1
    OriGene MassSpec for TLK1
    OriGene Custom Protein Services for TLK1
    GenScript Custom Purified and Recombinant Proteins Services for TLK1
    Novus Biologicals TLK1 Protein
    Novus Biologicals TLK1 Lysate
    Sino Biological Recombinant Protein for TLK1
    Sino Biological Cell Lysate for TLK1
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for TLK1

     
    Search eBioscience for Proteins for TLK1 

     
    antibodies-online proteins for TLK1 (3 products) 

     
    antibodies-online peptides for TLK1

    TLK1 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Cell Signaling Technology (CST) Antibodies for TLK1  (TLK1 iso1)
    OriGene Antibodies for TLK1
    OriGene Custom Antibody Services for TLK1
    Novus Biologicals TLK1 Antibodies
    Abcam antibodies for TLK1
    Cloud-Clone Corp. Antibodies for TLK1
    ThermoFisher Antibodies for TLK1
    antibodies-online antibodies for TLK1 (2 products) 

    TLK1 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for TLK1
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for TLK1
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for TLK1
    Cloud-Clone Corp. CLIAs for TLK1
    Search eBioscience for ELISAs for TLK1 
    antibodies-online kits for TLK1 (10 products) 


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    IUPHAR Guide to PHARMACOLOGY protein family classification: tousled-like kinase 1
    Tousled-like kinase (TLK) family

    Selected InterPro protein domains (see all 6):
     IPR017441 Protein_kinase_ATP_BS
     IPR002290 Ser/Thr_dual-sp_kinase_dom
     IPR011009 Kinase-like_dom
     IPR008271 Ser/Thr_kinase_AS
     IPR027086 TLK

    Graphical View of Domain Structure for InterPro Entry Q9UKI8

    ProtoNet protein and cluster: Q9UKI8

    UniProtKB/Swiss-Prot: TLK1_HUMAN, Q9UKI8
    Similarity: Belongs to the protein kinase superfamily. Ser/Thr protein kinase family
    Similarity: Contains 1 protein kinase domain


    Find genes that share domains with TLK1           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: TLK1_HUMAN, Q9UKI8
    Function: Rapidly and transiently inhibited by phosphorylation following the generation of DNA double-stranded
    breaks during S-phase. This is cell cycle checkpoint and ATM-pathway dependent and appears to regulate processes
    involved in chromatin assembly. Isoform 3 phosphorylates and enhances the stability of the t-SNARE SNAP23,
    augmenting its assembly with syntaxin. Isoform 3 protects the cells from the ionizing radiation by facilitating
    the repair of DSBs. In vitro, phosphorylates histone H3 at 'Ser-10'
    Catalytic activity: ATP + a protein = ADP + a phosphoprotein
    Enzyme regulation: Cell-cycle regulated, maximal activity in S-phase. Inactivated by phosphorylation at Ser-743,
    potentially by CHEK1

         Genatlas biochemistry entry for TLK1:
    tousled-like kinase 1,nuclear serine/threonine kinase PKU beta,broadly expressed,autophosphorylating and
    dimerizing cell-cycle regulated displaying maximal activities during S phase,Arabidopsis thaliana homolog

         Enzyme Numbers (IUBMB): EC 2.7.11.11 2 EC 2.7.112

         Gene Ontology (GO): Selected molecular function terms (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004672protein kinase activity ----
    GO:0004674protein serine/threonine kinase activity TAS9427565
    GO:0004713protein tyrosine kinase activity ----
    GO:0005524ATP binding IDA12660173
    GO:0016301kinase activity ----
         
    Find genes that share ontologies with TLK1           About GenesLikeMe


    Phenotypes:
         2 GenomeRNAi human phenotypes for TLK1:
     Decreased viability with TRAIL  Upregulation of Wnt/beta-caten 

    Animal Models:
       genOway: Develop your customized and physiologically relevant rodent model for TLK1

    miRNA
    Products:
        
    miRTarBase miRNAs that target TLK1:
    hsa-mir-28-5p (MIRT050002), hsa-mir-16-5p (MIRT031590), hsa-mir-103a-3p (MIRT027139)

    Block miRNA regulation of human, mouse, rat TLK1 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate TLK1 (see all 80):
    hsa-miR-15a hsa-miR-200a hsa-miR-219-5p hsa-miR-409-5p hsa-miR-489 hsa-miR-556-3p hsa-miR-192* hsa-miR-761
    SwitchGear 3'UTR luciferase reporter plasmidTLK1 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for TLK1
    Predesigned siRNA for gene silencing in human, mouse, rat TLK1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for TLK1

    Clone
    Products:
         
    OriGene clones in human, mouse for TLK1 (see all 16)
    OriGene ORF clones in mouse, rat for TLK1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): TLK1 (NM_012290)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TLK1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TLK1
    Addgene plasmids for TLK1 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for TLK1
    Browse ESI BIO Cell Lines and PureStem Progenitors for TLK1 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TLK1


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    TLK1_HUMAN, Q9UKI8: Nucleus
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    nucleus5
    cytoskeleton2
    cytosol2

    Gene Ontology (GO): 1 cellular component term:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus TAS9427565

    Find genes that share ontologies with TLK1           About GenesLikeMe


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for TLK1 About    
    See pathways by source

    SuperPathContained pathways About
    1Cell Cycle / Checkpoint Control
    Cell Cycle / Checkpoint Control0.32
    DNA Damage0.32
    2Chks in Checkpoint Regulation
    Chks in Checkpoint Regulation0.59
    3p53 signaling pathway
    DNA damage response0.41
    4Packaging Of Telomere Ends
    Histone modification0.31
    5ATM Pathway
    ATM Pathway


    Find genes that share SuperPaths with TLK1           About GenesLikeMe

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    2 Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for TLK1
        ATM Pathway
    Chks in Checkpoint Regulation

    2 Cell Signaling Technology (CST) Pathways for TLK1
        Cell Cycle / Checkpoint Control
    DNA Damage

    1 BioSystems Pathway for TLK1
        DNA damage response



        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for TLK1
    Interactions:

        GeneGlobe Interaction Network for TLK1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 23)

    Selected Interacting proteins for TLK1 (Q9UKI82, 3 ENSP000004110994) via UniProtKB, MINT, STRING, and/or I2D (see all 24)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    ASF1AQ9Y2942, 3, ENSP000002295954MINT-67546 I2D: score=6 STRING: ENSP00000229595
    SNAP23O001612, 3, ENSP000002496474MINT-17055 I2D: score=3 STRING: ENSP00000249647
    YWHAEP622583, ENSP000002643354I2D: score=3 STRING: ENSP00000264335
    AURKAO149653, ENSP000002169114I2D: score=1 STRING: ENSP00000216911
    ASF1BQ9NVP23, ENSP000002633824I2D: score=3 STRING: ENSP00000263382
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001672regulation of chromatin assembly or disassembly IDA12660173
    GO:0006468protein phosphorylation IDA12660173
    GO:0006886intracellular protein transport IDA10588641
    GO:0006974cellular response to DNA damage stimulus IEA--
    GO:0007049cell cycle IEA--

    Find genes that share ontologies with TLK1           About GenesLikeMe



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for TLK1

    1 HMDB Compound for TLK1    About this table
    CompoundSynonyms CAS #PubMed Ids
    MagnesiumMagnesium (see all 2)7439-95-4--



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for TLK1 gene (3 alternative transcripts): 
    NM_001136554.1  NM_001136555.1  NM_012290.4  

    13 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000431350(uc010zdn.1 uc002ugp.2) ENST00000360843 ENST00000359766
    ENST00000521943 ENST00000434911 ENST00000409443(uc002ugq.2) ENST00000413010
    ENST00000478683(uc002ugr.1) ENST00000486857 ENST00000453628 ENST00000470340
    ENST00000466220 ENST00000442919(uc002ugn.2 uc002ugo.2)
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat TLK1 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate TLK1 (see all 80):
    hsa-miR-15a hsa-miR-200a hsa-miR-219-5p hsa-miR-409-5p hsa-miR-489 hsa-miR-556-3p hsa-miR-192* hsa-miR-761
    SwitchGear 3'UTR luciferase reporter plasmidTLK1 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for TLK1
    Predesigned siRNA for gene silencing in human, mouse, rat TLK1
    Clone
    Products:
         
    OriGene clones in human, mouse for TLK1 (see all 16)
    OriGene ORF clones in mouse, rat for TLK1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): TLK1 (NM_012290)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TLK1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TLK1
    Addgene plasmids for TLK1 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for TLK1
    OriGene qSTAR qPCR primer pairs in human, mouse for TLK1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TLK1
      QuantiTect SYBR Green Assays in human, mouse, rat TLK1
      QuantiFast Probe-based Assays in human, mouse, rat TLK1

    Selected AceView cDNA sequences (see all 231):

    BQ025854 AI566108 AI298206 AA424123 AI334207 Z42971 AU119119 AA424035 
    AA782784 BP356036 AI650704 CB123552 AK091975 BM979121 BE857197 AA373979 
    AI401317 BG779394 AI423447 AI927483 BQ581713 AA860690 BU676027 BM467976 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    TLK1 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TTGCAGAAAA
    TLK1 Expression
    About this image


    TLK1 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 3) fully expand
     
     Limb (Muscoskeletal System)
             Limb Bud
     
     Neurons
             Glycinergic Amacrine Cells Inner Nuclear Layer
     
     Eye (Sensory Organs)
             Glycinergic Amacrine Cells Inner Nuclear Layer
    TLK1 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    TLK1 Protein Expression

    UniProtKB/Swiss-Prot: TLK1_HUMAN, Q9UKI8
    Tissue specificity: Widely expressed. Present in fetal placenta, liver, kidney and pancreas but not heart or
    skeletal muscle. Also found in adult cell lines. Isoform 3 is ubiquitously expressed in all tissues examined

        Custom PCR Arrays for TLK1
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for TLK1
    OriGene qSTAR qPCR primer pairs in human, mouse for TLK1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TLK1
    QuantiTect SYBR Green Assays in human, mouse, rat TLK1
    QuantiFast Probe-based Assays in human, mouse, rat TLK1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TLK1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for TLK1 gene from Selected species (see all 19)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Tlk11 , 5 tousled-like kinase 11, 5 91.91(n)1
    98.17(a)1
      2 (41.90 cM)5
    2280121  NM_172664.31  NP_766252.21 
     707124075 
    chicken
    (Gallus gallus)
    Aves TLK11 tousled-like kinase 1 87.44(n)
    96.52(a)
      429024  XM_004942747.1  XP_004942804.1 
    lizard
    (Anolis carolinensis)
    Reptilia TLK16
    tousled-like kinase 1
    96(a)
    1 ↔ 1
    GL343353.1(865440-928531)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.223952 Xenopus laevis transcribed sequence with strong similarity more 82.48(n)    BU901114.1 
    zebrafish
    (Danio rerio)
    Actinopterygii tlk1a1 tousled-like kinase 1a 74.52(n)
    87.66(a)
      557765  NM_001199724.1  NP_001186653.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta BcDNA:GH079103 protein amino acid phosphorylation
    protein kinase
    72(a)     --
    worm
    (Caenorhabditis elegans)
    Secernentea tlk-16
    Protein TLK-1, isoform d (tlk-1) mRNA, complete cd...
    34(a)
    1 → many
    III(9699881-9710268) WBGene00006579
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes MPS16
    Dual-specificity kinase required for spindle pole ...
    15(a)
    1 → many
    IV(400997-403291) YDL028C
    rice
    (Oryza sativa)
    Liliopsida AK111604.12   -- 75.88(n)    AK111604.1 


    ENSEMBL Gene Tree for TLK1 (if available)
    TreeFam Gene Tree for TLK1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for TLK1 gene
    TTK2  TLK22  
    4 SIMAP similar genes for TLK1 using alignment to 6 protein entries:     TLK1_HUMAN (see all proteins):
    TLK2    STK11    NUAK1    DKFZp564L2416

    Find genes that share paralogs with TLK1           About GenesLikeMe


    3 Pseudogenes.org Pseudogenes for TLK1
    PGOHUM00000258040 PGOHUM00000263188 PGOHUM00000236766


    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for TLK1 (see all 4664)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 2 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs576105921,2
    C--171299348(+) AATTG-/AAACC/CAACTCTCTAATATCACAAGGACATTATTGTGAT
    ATCACAATAATCACACAATAATCAAACAAGAGTTTGATATCTG
    CAAAC
    3 -- int11NA 2
    rs1384613371,2
    C--171299348(+) AATTG-/AAACCC
            
    AAACT
    3 -- int10--------
    rs1870375481,2
    --171846987(+) ATGTTG/TGTCAG 3 -- ds50010--------
    rs67141641,2
    C,F,A,H--171847117(+) TCTTCA/CGAACA 3 -- ds500121Minor allele frequency- C:0.27NS EA NA WA CSA 2348
    rs27232381,2
    C,F--171847195(+) AAAGAC/TCTGTC 3 -- ds50012Minor allele frequency- T:0.04CSA WA 119
    rs67583311,2
    C,F,A,H--171847269(+) TTAAAT/CTTTAA 3 -- ds500111Minor allele frequency- C:0.12NS EA NA WA 782
    rs67432011,2
    C,F,A--171847275(+) TTTAAG/AAGTAA 3 -- ds50018Minor allele frequency- A:0.29NA WA EA 368
    rs1908799981,2
    --171847336(+) AGGGCA/CATCAA 3 -- ut310--------
    rs105680021,2
    C--171847388(+) ACACA-/ATATACT 1 -- ut310--------
    rs2015951791,2
    C--171847388(+) ACACAA/CTATAC 3 -- ut310--------

    HapMap Linkage Disequilibrium report for TLK1 (171847333 - 172087824 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 5 variations for TLK1:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2660349CNV Deletion23128226
    esv2664440CNV Deletion23128226
    nsv3030CNV Insertion18451855
    nsv522291CNV Loss19592680
    nsv834456CNV Loss17160897

    Human Gene Mutation Database (HGMD): TLK1
    Site Specific Mutation Identification with PCR Assays
    Search QIAGEN SeqTarget long-range PCR primers for resequencing TLK1
    DNA2.0 Custom Variant and Variant Library Synthesis for TLK1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 608438    OMIM disorders: --


    Find genes that share disorders with TLK1           About GenesLikeMe

    Genetic Association Database (GAD): TLK1

    Export disorders for TLK1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for TLK1 gene, integrated from 10 sources (see all 47):
    (articles sorted by number of sources associating them with TLK1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Human tousled like kinases are targeted by an ATM- and Chk1-dependent DNA damage checkpoint. (PubMed id 12660173)1, 2, 3 Groth A....Hansen K. (EMBO J. 2003)
    2. cDNA cloning and chromosomal mapping of genes encoding novel protein kinases termed PKU-alpha and PKU-beta, which have nuclear localization signal. (PubMed id 9427565)1, 2, 3 Yamakawa A.... Date T. (Gene 1997)
    3. Identification of human Asf1 chromatin assembly factors as substrates of Tousled-like kinases. (PubMed id 11470414)1, 2, 9 Sillje H.H.W. and Nigg E.A. (Curr. Biol. 2001)
    4. Meta-analyses identify 13 loci associated with age at menopause and highlight DNA repair and immune pathways. (PubMed id 22267201)1, 4 Stolk L....Lunetta K.L. (Nat. Genet. 2012)
    5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (Nat. Genet. 2004)
    6. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    7. Construction of expression-ready cDNA clones for KIAA genes: manual curation of 330 KIAA cDNA clones. (PubMed id 12168954)1, 2 Nakajima D.... Nagase T. (DNA Res. 2002)
    8. A translationally regulated Tousled kinase phosphorylates histone H3 and confers radioresistance when overexpressed. (PubMed id 11314006)1, 2 Li Y.... De Benedetti A. (Oncogene 2001)
    9. Mammalian homologues of the plant tousled gene code for cell-cycle- regulated kinases with maximal activities linked to ongoing DNA replication. (PubMed id 10523312)1, 2 Sillje H.H.W.... Nigg E.A. (EMBO J. 1999)
    10. Phosphorylation of SNAP-23 by the novel kinase SNAK regulates t-SNARE complex assembly. (PubMed id 10588641)1, 2 Cabaniols J.-P.... Roche P.A. (Mol. Biol. Cell 1999)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 9874 HGNC: 11841 AceView: TLK1 Ensembl:ENSG00000198586 euGenes: HUgn9874
    ECgene: TLK1 H-InvDB: TLK1

    (According to HUGE)
    About This Section

    TryGeneCards Plus
    HUGE: KIAA0137

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for TLK1 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for TLK1 gene:
    Search GeneIP for patents involving TLK1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for TLK1   OriGene RNAi products in human, mouse, rat for TLK1  
     OriGene qPCR primer pairs and template standards for TLK1   OriGene Protein Over-expression Lysate for TLK1  
     OriGene MassSpec for TLK1   OriGene clones in human, mouse for TLK1  
     OriGene qSTAR qPCR primer pairs in human, mouse for TLK1   OriGene Purified Protein for TLK1  
     OriGene ORF clones in mouse, rat for TLK1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for TLK1   OriGene Custom Protein Services for TLK1  

     
     
     Block miRNA regulation of human, mouse, rat TLK1 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing TLK1
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat TLK1 Predesigned siRNA for gene silencing in human, mouse, rat TLK1
     QuantiFast Probe-based Assays in human, mouse, rat TLK1 QuantiTect SYBR Green Assays in human, mouse, rat TLK1
     Custom PCR Arrays for TLK1 Search Chromatin IP Primers for TLK1
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TLK1  GeneGlobe Interaction Network for TLK1
     Regulatory tfbs in TLK1 promoter
     GenScript Custom Purified and Recombinant Proteins Services for TLK1 GenScript cDNA clones with any tag delivered in your preferred vector for TLK1
     GenScript Custom Assay Services for TLK1 GenScript Custom overexpressing Cell Line Services for TLK1
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Antibodies & Assays for TLK1 
    (TLK1 iso1)

     Search Tocris compounds for TLK1
     Proteins for TLK1
     Cell Lysates for TLK1
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     TLK1 antibodies
     TLK1 proteins
     TLK1 lysates
     Antibodies for TLK1
     See all of Abcam's Antibodies, Kits and Proteins for TLK1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for TLK1
     Antibodies for TLK1
     ELISAs for TLK1
     CLIAs for TLK1



     Browse ESI BIO Cell Lines and PureStem Progenitors for TLK1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TLK1
     SwitchGear 3'UTR luciferase reporter plasmids for TLK1
     SwitchGear Promoter luciferase reporter plasmids for TLK1
     ThermoFisher Antibodies for TLK1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TLK1
     Browse compounds at ApexBio
     Addgene plasmids for TLK1
      Search eBioscience for proteins for TLK1
      Search eBioscience for elisas for TLK1
      eBioscience FlowRNA Probe Sets
     genOway: Develop your customized and physiologically relevant rodent model for TLK1
     antibodies-online antibodies for TLK1 (2 products)
     antibodies-online kits for TLK1 (10 products)
     antibodies-online peptides for TLK1
     antibodies-online proteins for TLK1 (3 products)
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014 , 7 Oct 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      TLK1 gene at Home site.
    Version: 3.12.248 16 Nov 2014
    hostname: 356977-web1.xennexinc.com index build: 128 solr: 1.4