Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

TIE1 Gene

protein-coding   GIFtS: 64
GCID: GC01P043766

Tyrosine Kinase With Immunoglobulin-Like And EGF-Like Domains...

(Previous name: tyrosine kinase with immunoglobulin and epidermal growth...)
(Previous symbol: TIE)
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Tyrosine Kinase With Immunoglobulin-Like And EGF-Like Domains 11 2     JTK142 5
TIE1 2 3 5     Tyrosine-Protein Kinase Receptor Tie-12
Tyrosine Kinase With Immunoglobulin And Epidermal Growth Factor Homology
Domains 11 2
     EC 2.7.108
EC 2.7.10.13 8     

External Ids:    HGNC: 118091   Entrez Gene: 70752   Ensembl: ENSG000000660567   OMIM: 6002225   UniProtKB: P355903   

Export aliases for TIE1 gene to outside databases

Previous GC identifers: GC01P043437 GC01P043539 GC01P041886


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for TIE1 Gene:
This gene encodes a member of the tyrosine protein kinase family. The encoded protein plays a critical role in
angiogenesis and blood vessel stability by inhibiting angiopoietin 1 signaling through the endothelial receptor
tyrosine kinase Tie2. Ectodomain cleavage of the encoded protein relieves inhibition of Tie2 and is mediated by
multiple factors including vascular endothelial growth factor. Alternatively spliced transcript variants encoding
multiple isoforms have been observed for this gene. (provided by RefSeq, Nov 2011)

GeneCards Summary for TIE1 Gene: 
TIE1 (tyrosine kinase with immunoglobulin-like and EGF-like domains 1) is a protein-coding gene. Diseases associated with TIE1 include angiosarcoma, and arteriovenous malformation, and among its related super-pathways are Development PDGF signaling via STATs and NF-kB. GO annotations related to this gene include transmembrane receptor protein tyrosine kinase activity and ATP binding. An important paralog of this gene is STYK1.

UniProtKB/Swiss-Prot: TIE1_HUMAN, P35590
Function: Transmembrane tyrosine-protein kinase that may modulate TEK/TIE2 activity and contribute to the
regulation of angiogenesis




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000001.10  NT_032977.9  NC_018912.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the TIE1 gene promoter:
         Spz1   Elk-1   Egr-1   CUTL1   LCR-F1   POU2F1   POU2F1a   POU2F1b   STAT3   POU2F1c   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidTIE1 promoter sequence
   Search SABiosciences Chromatin IP Primers for TIE1

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TIE1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 1p34-p33   Ensembl cytogenetic band:  1p34.2   HGNC cytogenetic band: 1p34-p33

TIE1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TIE1 gene location

GeneLoc information about chromosome 1         GeneLoc Exon Structure

GeneLoc location for GC01P043766:  view genomic region     (about GC identifiers)

Start:
43,766,664 bp from pter      End:
43,788,779 bp from pter
Size:
22,116 bases      Orientation:
plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: TIE1_HUMAN, P35590 (See protein sequence)
Recommended Name: Tyrosine-protein kinase receptor Tie-1 precursor  
Size: 1138 amino acids; 125090 Da
Subunit: Heterodimer with TEK/TIE2
Subcellular location: Cell membrane; Single-pass type I membrane protein
Secondary accessions: B5A949 B5A950
Alternative splicing: 3 isoforms:  P35590-1   P35590-2   P35590-3   

Explore the universe of human proteins at neXtProt for TIE1: NX_P35590

Explore proteomics data for TIE1 at MOPED 

Post-translational modifications:

  • UniProtKB: Phosphorylated on tyrosine residues in response to ANGPT1, most likely by TEK/TIE2
  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_P35590

  • 4/13 DME Specific Peptides for TIE1 (P35590) (see all 13)
     NCDDEVY  FTYAGID  RDLAARN  WMAIESL 

    TIE1 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    TIE1 Protein Expression
    REFSEQ proteins (2 alternative transcripts): 
    NP_001240286.1  NP_005415.1  

    ENSEMBL proteins: 
     ENSP00000361554   ENSP00000401903   ENSP00000440063   ENSP00000411728  

    Human Recombinant Protein Products for TIE1: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    R&D Systems Recombinant & Natural Proteins for TIE1 (Tie-1)
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for TIE1
    OriGene Protein Over-expression Lysate for TIE1
    OriGene MassSpec for TIE1 
    OriGene Custom Protein Services for TIE1
    GenScript Custom Purified and Recombinant Proteins Services for TIE1
    Novus Biologicals TIE1 Lysate
    Sino Biological Recombinant Protein for TIE1
    Sino Biological Cell Lysate for TIE1 
    ProSpec Recombinant Protein for TIE1
    Browse Proteins at Cloud-Clone Corp. 

    Gene Ontology (GO): 3 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005886plasma membrane ----
    GO:0005887integral to plasma membrane TAS1312667
    GO:0016021integral to membrane ----

    TIE1 for ontologies           About GeneDecksing



    TIE1 Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of TIE1
    R&D Systems Antibodies for TIE1 (Tie-1)
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for TIE1
    GenScript Custom Superior Antibodies Services for TIE1
    Novus Biologicals TIE1 Antibodies
    Abcam antibodies for TIE1
    Browse Antibodies at Cloud-Clone Corp. 
    ThermoFisher Antibodies for TIE1
    LSBio Antibodies in human, mouse, rat for TIE1 

    Assay Products for TIE1: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for TIE1
    R&D Systems ELISAs for TIE1 (Tie-1)         (see all)
    GenScript Custom Assay Services for TIE1
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp. 
    Browse CLIAs at Cloud-Clone Corp.


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    HGNC Gene Families: 
    FN3: Fibronectin type III domain containing
    IGD: Immunoglobulin superfamily / Immunoglobulin-like domain containing

    IUPHAR Guide to PHARMACOLOGY protein family classification: tyrosine kinase with immunoglobulin-like and EGF-like domains 1 
    Tie family
    TIE family of angiopoietin receptors

    5/11 InterPro protein domains (see all 11):
     IPR017441 Protein_kinase_ATP_BS
     IPR003599 Ig_sub
     IPR000742 EG-like_dom
     IPR003961 Fibronectin_type3
     IPR001245 Ser-Thr/Tyr_kinase_cat_dom

    Graphical View of Domain Structure for InterPro Entry P35590

    ProtoNet protein and cluster: P35590

    3 Blocks protein domains:
    IPB003599 Immunoglobulin subtype
    IPB006210 Type I EGF
    IPB008266 Tyrosine protein kinase


    UniProtKB/Swiss-Prot: TIE1_HUMAN, P35590
    Similarity: Belongs to the protein kinase superfamily. Tyr protein kinase family. Tie subfamily
    Similarity: Contains 3 EGF-like domains
    Similarity: Contains 3 fibronectin type-III domains
    Similarity: Contains 2 Ig-like C2-type (immunoglobulin-like) domains
    Similarity: Contains 1 protein kinase domain


    TIE1 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: TIE1_HUMAN, P35590
    Function: Transmembrane tyrosine-protein kinase that may modulate TEK/TIE2 activity and contribute to the
    regulation of angiogenesis
    Catalytic activity: ATP + a [protein]-L-tyrosine = ADP + a [protein]-L-tyrosine phosphate

         Enzyme Numbers (IUBMB): EC 2.7.10.11 2 EC 2.7.102

         Gene Ontology (GO): 5/6 molecular function terms (GO ID links to tree view) (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004672protein kinase activity ----
    GO:0004713protein tyrosine kinase activity ----
    GO:0004714transmembrane receptor protein tyrosine kinase activity IEA--
    GO:0005515protein binding IPI--
    GO:0005524ATP binding IEA--
         
    TIE1 for ontologies           About GeneDecksing


    Phenotypes:
         4 GenomeRNAi human phenotypes for TIE1:
     Decreased Hepatitis C virus re  Decreased focal adhesion (FA)   Increased cell death in HCC-19  Increased mitotic index 

         13 MGI mutant phenotypes (inferred from 5 alleles(MGI details for Tie1):
     cardiovascular system  cellular  digestive/alimentary  embryogenesis  growth/size 
     homeostasis/metabolism  immune system  integument  mortality/aging  muscle 
     nervous system  renal/urinary system  respiratory system 

    TIE1 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-outs for TIE1: Tie1tm1Sato Tie1tm1.1Scba

       inGenious Targeting Laboratory - Custom generated mouse model solutions for TIE1 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for TIE1

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for TIE1 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for TIE1 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TIE1
    2 QIAGEN miScript miRNA Assays for microRNAs that regulate TIE1:
    hsa-miR-922 hsa-miR-1827
    SwitchGear 3'UTR luciferase reporter plasmidTIE1 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for TIE1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TIE1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for TIE1
    Sirion Biotech Customized adenovirus for overexpression of TIE1

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for TIE1 (see all 10)
    OriGene ORF clones in mouse, rat for TIE1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: TIE1 (NM_005424)
    Sino Biological Human cDNA Clone for TIE1
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TIE1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TIE1
    Sirion Biotech Customized lentivirus for stable overexpression of TIE1 
                         Customized lentivirus expression plasmids for stable overexpression of TIE1 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for TIE1
    Search LifeMap BioReagents cell lines for TIE1
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TIE1


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for TIE1 About                                                                                                See pathways by source

    SuperPathContained pathways About
    1Development PDGF signaling via STATs and NF-kB
    Development Angiopoietin - Tie2 signaling0.38
    2Akt Signaling Pathway
    Akt Signaling Pathway

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    1 EMD Millipore Pathway for TIE1
        Development Angiopoietin - Tie2 signaling

    1 R&D Systems Pathway for TIE1
        Akt Signaling Pathway


    1 GeneGo (Thomson Reuters) Pathway for TIE1
        Development Angiopoietin - Tie2 signaling




    TIE1 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for TIE1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 18)

    5/19 Interacting proteins for TIE1 (P355901, 2, 3 ENSP000003615544) via UniProtKB, MINT, STRING, and/or I2D (see all 19)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    PIK3R1P279863, ENSP000002743354I2D: score=2 STRING: ENSP00000274335
    TEKQ027633, ENSP000003839774I2D: score=2 STRING: ENSP00000383977
    PTPN11Q061243, ENSP000003409444I2D: score=1 STRING: ENSP00000340944
    PTPRCP085753, ENSP000003563464I2D: score=1 STRING: ENSP00000356346
    PTPRJQ129133, ENSP000004000104I2D: score=1 STRING: ENSP00000400010
    About this table

    Gene Ontology (GO): 5/9 biological process terms (GO ID links to tree view) (see all 9):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001525angiogenesis IEA--
    GO:0001701in utero embryonic development IEA--
    GO:0006468protein phosphorylation ----
    GO:0007165signal transduction TAS1312667
    GO:0007498mesoderm development TAS7596437

    TIE1 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    TIE1 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for TIE1

    2 HMDB Compounds for TIE1    About this table
    CompoundSynonyms CAS #PubMed Ids
    ADPadenosindiphosphorsaeure (see all 8)58-64-0--
    Adenosine triphosphate5'-(tetrahydrogen triphosphate) Adenosine (see all 24)56-65-5--

    4 Novoseek inferred chemical compound relationships for TIE1 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    tyrosine 72.9 54 10913057 (2), 10949653 (2), 12853700 (2), 14530387 (2) (see all 41)
    vegf 71.7 58 8939195 (3), 19376222 (3), 10694277 (3), 11866538 (3) (see all 30)
    nitric oxide 0 3 17132814 (1), 19662988 (1), 17379831 (1)
    glucose 0 2 15613462 (1), 17494864 (1)

    Search CenterWatch for drugs/clinical trials and news about TIE1

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for TIE1 gene (2 alternative transcripts): 
    NM_001253357.1  NM_005424.4  

    Unigene Cluster for TIE1:

    Tyrosine kinase with immunoglobulin-like and EGF-like domains 1
    Hs.78824  [show with all ESTs]
    Unigene Representative Sequence: NM_005424
    12 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000372476(uc010oka.2 uc010okb.2 uc010okc.2 uc010okd.2 uc010okf.1 uc010oke.2 uc001ciu.3 uc009vwq.3 uc010okg.2)
    ENST00000485125 ENST00000480269 ENST00000488437 ENST00000471187 ENST00000461061
    ENST00000473014 ENST00000492599 ENST00000492874 ENST00000441333 ENST00000538015
    ENST00000433781
    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TIE1
    2 QIAGEN miScript miRNA Assays for microRNAs that regulate TIE1:
    hsa-miR-922 hsa-miR-1827
    SwitchGear 3'UTR luciferase reporter plasmidTIE1 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for TIE1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TIE1
    Clone
    Products:
         
    OriGene clones in human, mouse for TIE1 (see all 10)
    OriGene ORF clones in mouse, rat for TIE1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: TIE1 (NM_005424)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TIE1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TIE1
    Sirion Biotech Customized lentivirus for stable overexpression of TIE1 
                         Customized lentivirus expression plasmids for stable overexpression of TIE1 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for TIE1
    OriGene qSTAR qPCR primer pairs in human, mouse for TIE1
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TIE1
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TIE1
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TIE1

    Additional mRNA sequence: 

    AF217976.1 AK225560.1 AK296735.1 AK300399.1 AK300623.1 AK307639.1 BC038239.1 EU826586.1 
    EU826587.1 EU826588.1 EU826589.1 EU826590.1 GU166386.1 X60957.1 

    12 DOTS entries:

    DT.415745  DT.121328166  DT.92427592  DT.121328153  DT.91710036  DT.92427596  DT.121328170  DT.92427595 
    DT.97798813  DT.100705053  DT.40262086  DT.92043278 

    24/161 AceView cDNA sequences (see all 161):

    N95616 BU620475 BX348301 CA432662 AF217976 AA687787 AL574074 BG012156 
    NM_005424 BX114920 CR601214 BI758078 BM970991 BI824583 BC038239 X60957 
    AJ708186 BQ878590 BI523784 AL833389 BF847824 AI286225 BF850172 AW452236 

    GeneLoc Exon Structure

    5/6 Alternative Splicing Database (ASD) splice patterns (SP) for TIE1 (see all 6)    About this scheme

    ExUns: 1a · 1b · 1c ^ 2 ^ 3a · 3b · 3c ^ 4a · 4b ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16a · 16b ^ 17 ^ 18 ^ 19 ^ 20 ^
    SP1:                    -     -                                                                                               -                                 
    SP2:                                                                                                                                                            
    SP3:                                                                                                                                                            
    SP4:                    -     -                                                                                                                                 
    SP5:                    -                                                                                                                                       

    ExUns: 21 ^ 22 ^ 23 ^ 24 ^ 25
    SP1:  -                           
    SP2:                              
    SP3:                              
    SP4:                              
    SP5:                              


    ECgene alternative splicing isoforms for TIE1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TIE1 expression in normal human tissues (normalized intensities)      TIE1 embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: CCCTGTTCAG
    TIE1 Expression
    About this image


    TIE1 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/18 selected tissues (see all 18) fully expand
     
     Endothelium (Cardiovascular System)    fully expand to see all 24 entries
             Angioblasts Proepicardium
             PureStem endothelial progenitor 30-SM2-1
             Human Ovarian Microvascular Endothelial Cells (HOMEC)   
     
     Heart (Cardiovascular System)    fully expand to see all 7 entries
             Endocardial Tube Cells Outflow Tract
             Heart Tube
             Human Pulmonary Artery Endothelial Cells (HPAEC)   
     
     Blood (Cardiovascular System)    fully expand to see all 4 entries
             Hematopoietic Stem Cells Hematopoietic Bone Marrow
             PureStem endothelial Progenitor 30-SM2-3
     
     Umbilical Cord (Extraembryonic Tissues)    fully expand to see all 4 entries
             Wharton's jelly-derived stem cells
             Human Umbilical Vein Endothelial Cells (HUVEC) (BioTime)   
     
     Bone (Muscoskeletal System)    fully expand to see all 3 entries
             Zeugopod Periosteum
             Bone marrow-derived adherent progenitor cells (MultiStem)

    See TIE1 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for TIE1

    SOURCE GeneReport for Unigene cluster: Hs.78824

    UniProtKB/Swiss-Prot: TIE1_HUMAN, P35590
    Tissue specificity: Specifically expressed in developing vascular endothelial cells

        SABiosciences Expression via Pathway-Focused PCR Arrays including TIE1: 
              Angiogenic Growth Factors in human mouse rat
              Angiogenesis in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for TIE1
    OriGene qSTAR qPCR primer pairs in human, mouse for TIE1
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TIE1
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TIE1
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TIE1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TIE1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for TIE1 gene from 5/12 species (see all 12)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Tie11 , 5 tyrosine kinase with immunoglobulin-like and EGF-like more1, 5 87.76(n)1
    93.12(a)1
      4 (54.67 cM)5
    218461  NM_011587.21  NP_035717.21 
     1184711915 
    chicken
    (Gallus gallus)
    Aves TIE11 tyrosine kinase with immunoglobulin-like and EGF-like more 68.74(n)
    67.15(a)
      424562  XM_422400.3  XP_422400.3 
    lizard
    (Anolis carolinensis)
    Reptilia TIE16
    tyrosine kinase with immunoglobulin-like and EGF-l...
    63(a)
    1 ↔ 1
    4(107164826-107212820)
    zebrafish
    (Danio rerio)
    Actinopterygii tie11 endothelium-specific receptor tyrosine kinase 1 60.36(n)
    60.21(a)
      30746  XM_001334637.5  XP_001334673.4 
    fruit fly
    (Drosophila melanogaster)
    Insecta tor6
    torso
    17(a)
    1 → many
    2R(3590680-3597042)


    ENSEMBL Gene Tree for TIE1 (if available)
    TreeFam Gene Tree for TIE1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for TIE1 gene
    STYK12  TEK2  
    18/95 SIMAP similar genes for TIE1 using alignment to 3 protein entries:     TIE1_HUMAN (see all proteins) (see all similar genes):
    TIE    TEK    ABL1    FLT1    BTK kinase deficient isoform 6    CCDC6-RETa
    CCDC6-RETc    RET/PTC2    TXK    EPHA2    urf-ret    tec
    MATK    R11    R12    SRC    RET    FGFR2

    TIE1 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/684 SNPs in TIE1 are shown (see all 684)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 1 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs665189251,2
    C--43769751(+) GCCCC-/GAAGCT 2 -- int10--------
    rs61432041,2
    C--43774128(+) ACCCA-/GGGATTGGGGACTCAGGTTT
    GGGTACCAGGACAGTGGAGTGG
    GGGAT
    2 -- cds10--------
    rs1132205691,2
    C,F--43786220(+) CCTGTC/ATCTAC 2 -- int11Minor allele frequency- A:0.50CSA 2
    rs1118825941,2
    C,F--43786387(+) CGGGCA/C/GTGGTG 2 -- int11NA 2
    rs357784201,2
    C--43786529(+) TCAAA-/AAAT  
            
    AAATA
    2 -- int10--------
    rs11990401,2
    C,A--43786720(+) aaaaaC/Aaaaac 2 -- int1 trp31Minor allele frequency- A:0.50NA 2
    rs1807949381,2
    --43843162(+) ATTATC/GGCTTA 2 -- us2k10--------
    rs38064021,2
    C,F,H--43843266(+) AACTGA/TTGCTA 2 -- us2k132Minor allele frequency- T:0.18NA EA NS WA CSA 3404
    rs12093841,2
    C,F,O,A,H--43843674(+) TTTTCG/ATTCCA 2 -- us2k1 tfbs321Minor allele frequency- A:0.21NA EA NS WA CSA 2434
    rs1416308211,2
    --43843685(+) GATTCA/GAAGGT 2 -- us2k10--------

    HapMap Linkage Disequilibrium report for TIE1 (43766664 - 43788779 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 2 variations for TIE1:    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2747574CNV Deletion23290073
    nsv829693CNV Loss17160897

    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing TIE1
    DNA2.0 Custom Variant and Variant Library Synthesis for TIE1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 600222    OMIM disorders: --

    20/39 diseases for TIE1 (see all 39):    About MalaCards
    angiosarcoma    arteriovenous malformation    hepatopulmonary syndrome    hemangiopericytoma
    hemangioblastoma    giant cell tumor    cavernous malformation    cerebral cavernous malformation
    gastrointestinal stromal tumor    non-small cell lung carcinoma    endotheliitis    b-cell chronic lymphocytic leukemia
    hemangioma    chronic myeloid leukemia    kaposi's sarcoma    leiomyoma
    myelodysplastic syndromes    pheochromocytoma    myeloid leukemia    acute leukemia


    TIE1 for disorders           About GeneDecksing

    10/22 Novoseek inferred disease relationships for TIE1 gene (see all 22)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    inflammatory breast cancer 49.5 2 15585631 (2)
    neovascularization 44.1 1 12853700 (1)
    cns tumors 31.5 1 7856749 (1)
    tumors 31.4 32 12853700 (5), 11501841 (3), 10027415 (2), 7856749 (1) (see all 16)
    rheumatoid arthritis 28.1 7 10913057 (2), 19236867 (1), 11261813 (1), 12010571 (1)
    angiosarcoma 23.8 4 10854238 (3)
    colon tumor 23.3 1 12853700 (1)
    adenocarcinoma gastric 22.5 1 14987226 (1)
    atherosclerosis 12.4 3 18448073 (1), 19236867 (1)
    carcinoma ductal 11.2 1 12853700 (1)

    Genetic Association Database (GAD): TIE1
    Human Genome Epidemiology (HuGE) Navigator: TIE1 (5 documents)

    Export disorders for TIE1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for TIE1 gene, integrated from 9 sources (see all 149):
    (articles sorted by number of sources associating them with TIE1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. A novel endothelial cell surface receptor tyrosine kinase with extracellular epidermal growth factor homology domains. (PubMed id 1312667)1, 2, 3 Partanen J.... Alitalo K. (1992)
    2. Novel splice variants derived from the receptor tyrosine kinase superfamily are potential therapeutics for rheumatoid arthritis. (PubMed id 18593464)1, 2, 9 Jin P.... Paleolog E.M. (2008)
    3. Genetic Risk Factors for Hepatopulmonary Syndrome in Patients With Advanced Liver Disease. (PubMed id 20346360)1, 4 Roberts K.E....Fallon M.B. (2010)
    4. Tie1-Tie2 interactions mediate functional differences between angiopoietin ligands. (PubMed id 20227369)1, 2 Seegar T.C....Barton W.A. (2010)
    5. Variation at the NFATC2 locus increases the risk of t hiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipr il and rosiglitazone Medication (DREAM) study. (PubMed id 20628086)1, 4 Bailey S.D....Anand S. (2010)
    6. Signal peptide prediction based on analysis of experimentally verified cleavage sites. (PubMed id 15340161)1, 2 Zhang Z. and Henzel W.J. (2004)
    7. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    8. Regulated proteolytic processing of Tie1 modulates ligand responsiveness of the receptor-tyrosine kinase Tie2. (PubMed id 17728252)1, 9 Marron M.B....Brindle N.P. (2007)
    9. Evidence for heterotypic interaction between the receptor tyrosine kinases TIE-1 and TIE-2. (PubMed id 10995770)1, 9 Marron M.B....Brindle N.P. (2000)
    10. Prognostic significance of Tie-1 protein expression in patients with early chronic phase chronic myeloid leukemia. (PubMed id 11920509)1, 9 Verstovsek S....Albitar M. (2002)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 7075 HGNC: 11809 AceView: TIE Ensembl:ENSG00000066056 euGenes: HUgn7075
    ECgene: TIE1 H-InvDB: TIE1

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for TIE1 Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for TIE1 Genetics and Cytogenetics in Oncology and Haematology

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for TIE1 gene:
    Search GeneIP for patents involving TIE1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     Browse Small Molecules at EMD Millipore
     Browse for Gene Knock-down Tools from EMD Millipore
     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     Browse Purified and Recombinant Proteins at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of TIE1
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Antibodies for TIE1 (Tie-1)   Browse Cell Culture Products  
     ELISAs for TIE1 (Tie-1)   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Multiplex/Array Assay Kits/Reagents for TIE1 (Tie-1)  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Recombinant/Natural Proteins for TIE1 (Tie-1)  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     cDNA Clones for TIE1 (Tie-1)   Proteome Profiler Antibody Arrays for TIE1 (Tie-1)  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for TIE1  
     OriGene qPCR primer pairs and template standards for TIE1   OriGene Protein Over-expression Lysate for TIE1  
     OriGene MassSpec something-or-other for TIE1   OriGene clones in human, mouse for TIE1  
     OriGene qSTAR qPCR primer pairs in human, mouse for TIE1   OriGene Purified Protein for TIE1  
     OriGene ORF clones in mouse, rat for TIE1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for TIE1   OriGene Custom Protein Services for TIE1  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat TIE1
     QIAGEN SeqTarget long-range PCR primers for resequencing TIE1
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TIE1
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TIE1
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TIE1
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TIE1
     GenScript Custom Purified and Recombinant Proteins Services for TIE1 GenScript cDNA clones with any tag delivered in your preferred vector for TIE1
     GenScript Custom Assay Services for TIE1 GenScript Custom Superior Antibodies Services for TIE1
     GenScript Custom overexpressing Cell Line Services for TIE1 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in TIE1 promoter
     Search Chromatin IP Primers for TIE1
     RT2 qPCR Primer Assay in human, mouse, rat TIE1
     GNC Network for TIE1
     SABiosciences PCR Arrays including human, mouse, rat TIE1
     Search Tocris compounds for TIE1
     Proteins and Antibodies for TIE1
     Cell Lysates for TIE1
     cDNA Clones for TIE1
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     TIE1 antibodies
     TIE1 lysates
     Antibodies for TIE1
     See all of Abcam's Antibodies, Kits and Proteins for TIE1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Recombinant Protein for TIE1




     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.
     Search LifeMap BioReagents cell lines for TIE1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TIE1
     SwitchGear 3'UTR luciferase reporter plasmids for TIE1
     SwitchGear Promoter luciferase reporter plasmids for TIE1
     ThermoFisher Antibodies for TIE1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TIE1
     inGenious Targeting Laboratory - Custom generated mouse model solutions for TIE1
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for TIE1
    Customized:
     lentivirus for stable overexpression of TIE1
     lentivirus expression plasmids for stable overexpression of TIE1
     adenovirus for overexpression of TIE1
     LSBio Antibodies in human, mouse, rat for TIE1
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      TIE1 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4