Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



THEM5 Gene

protein-coding   GIFtS: 47
GCID: GC01M151819

Thioesterase Superfamily Member 5

  See THEM5-related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Thioesterase Superfamily Member 51 2 3
ACOT152 3 5
Acyl-CoA Thioesterase THEM52 3
Acyl-Coenzyme A Thioesterase 152 3
Acyl-Coenzyme A Thioesterase THEM52
EC 3.1.2.23

External Ids:    HGNC: 267551   Entrez Gene: 2844862   Ensembl: ENSG000001964077   OMIM: 6156535   UniProtKB: Q8N1Q83   

Export aliases for THEM5 gene to outside databases

Previous GC identifers: GC01M148632 GC01M150084 GC01M151818 GC01M123196


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

GeneCards Summary for THEM5 Gene:
THEM5 (thioesterase superfamily member 5) is a protein-coding gene. Diseases associated with THEM5 include median rhomboid glossitis, and glossitis. GO annotations related to this gene include palmitoyl-CoA hydrolase activity. An important paralog of this gene is THEM4.

UniProtKB/Swiss-Prot: ACO15_HUMAN, Q8N1Q8
Function: Has acyl-CoA thioesterase activity towards long-chain (C16 and C18) fatty acyl-CoA substrates, with a
preference for linoleyl-CoA and other unsaturated long-chain fatty acid-CoA esters. Plays an important role in
mitochondrial fatty acid metabolism, and in remodeling of the mitochondrial lipid cardiolipin. Required for
normal mitochondrial function




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000001.10  NT_004487.20  NC_018912.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the THEM5 gene promoter:
         c-Fos   AP-1   Fra-1   FosB   Evi-1   C/EBPalpha   FOXO4   c-Jun   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidTHEM5 promoter sequence
   Search Chromatin IP Primers for THEM5

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat THEM5


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 1q21.3   Ensembl cytogenetic band:  1q21.3   HGNC cytogenetic band: 1q21.3

THEM5 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
THEM5 gene location

GeneLoc information about chromosome 1         GeneLoc Exon Structure

GeneLoc location for GC01M151819:  view genomic region     (about GC identifiers)

Start:
151,819,577 bp from pter      End:
151,826,173 bp from pter
Size:
6,597 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., and/or eBioscience,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., and/or eBioscience, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: ACO15_HUMAN, Q8N1Q8 (See protein sequence)
Recommended Name: Acyl-coenzyme A thioesterase THEM5  
Size: 247 amino acids; 27677 Da
Subunit: Homodimer
1 PDB 3D structure from and Proteopedia for THEM5:
4AE7 (3D)    
Secondary accessions: Q5T1C3

Explore the universe of human proteins at neXtProt for THEM5: NX_Q8N1Q8

Explore proteomics data for THEM5 at MOPED


See THEM5 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

REFSEQ proteins: NP_872384.1  
ENSEMBL proteins: 
 ENSP00000357807   ENSP00000406809  

THEM5 Human Recombinant Protein Products:

Browse Purified and Recombinant Proteins at EMD Millipore
Browse R&D Systems for human recombinant proteins
Browse recombinant and purified proteins available from Enzo Life Sciences
OriGene Purified Protein for THEM5
OriGene Protein Over-expression Lysate for THEM5
OriGene MassSpec for THEM5
OriGene Custom Protein Services for THEM5
GenScript Custom Purified and Recombinant Proteins Services for THEM5
Novus Biologicals THEM5 Protein
Novus Biologicals THEM5 Lysates
Browse Sino Biological Recombinant Proteins
Browse Sino Biological Cell Lysates
Browse ProSpec Recombinant Proteins
Cloud-Clone Corp. Proteins for THEM5

 
Search eBioscience for Proteins for THEM5 

THEM5 Antibody Products:

Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
Browse R&D Systems for Antibodies
Browse OriGene Antibodies
OriGene Custom Antibody Services for THEM5
Novus Biologicals THEM5 Antibodies
Abcam antibodies for THEM5
Cloud-Clone Corp. Antibodies for THEM5
Search ThermoFisher Antibodies for THEM5
LSBio Antibodies in human, mouse, rat for THEM5

THEM5 Assay Products:

Browse Kits and Assays available from EMD Millipore
OriGene Custom Assay Services for THEM5
Browse R&D Systems for biochemical assays
GenScript Custom Assay Services for THEM5
Browse Enzo Life Sciences for kits & assays
Cloud-Clone Corp. ELISAs for THEM5
Cloud-Clone Corp. CLIAs for THEM5
Search eBioscience for ELISAs for THEM5 


(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

TryGeneCards Plus
1 InterPro protein domain:
 IPR006683 Thioestr_supf

Graphical View of Domain Structure for InterPro Entry Q8N1Q8

ProtoNet protein and cluster: Q8N1Q8

UniProtKB/Swiss-Prot: ACO15_HUMAN, Q8N1Q8
Similarity: Belongs to the THEM4/THEM5 thioesterase family


Find genes that share domains with THEM5           About GenesLikeMe


(According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus

Molecular Function:

     UniProtKB/Swiss-Prot Summary: ACO15_HUMAN, Q8N1Q8
Function: Has acyl-CoA thioesterase activity towards long-chain (C16 and C18) fatty acyl-CoA substrates, with a
preference for linoleyl-CoA and other unsaturated long-chain fatty acid-CoA esters. Plays an important role in
mitochondrial fatty acid metabolism, and in remodeling of the mitochondrial lipid cardiolipin. Required for
normal mitochondrial function
Catalytic activity: Palmitoyl-CoA + H(2)O = CoA + palmitate
Biophysicochemical properties: Kinetic parameters: KM=2.4 uM for palmitoyl-CoA (C16:0); KM=4.2 uM for stearoyl-CoA
(C18:0); KM=2.9 uM for oleoyl-CoA (C18:1); KM=4.2 uM for linoleyl-CoA (C18:2);

     Enzyme Number (IUBMB): EC 3.1.2.21

     Gene Ontology (GO): 1 molecular function term:    About this table

GO IDQualified GO termEvidencePubMed IDs
GO:0016290palmitoyl-CoA hydrolase activity IDA--
     
Find genes that share ontologies with THEM5           About GenesLikeMe


Phenotypes:
     3 MGI mutant phenotypes (inferred from 1 allele(MGI details for Them5):
 cellular  homeostasis/metabolism  liver/biliary system 

Find genes that share phenotypes with THEM5           About GenesLikeMe

Animal Models:
     MGI mouse knock-out Them5tm1Hem for THEM5

   inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for THEM5
   inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for THEM5

   genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for THEM5
   genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for THEM5

miRNA
Products:
    
Block miRNA regulation of human, mouse, rat THEM5 using miScript Target Protectors
Search for qRT-PCR Assays for microRNAs that regulate THEM5
SwitchGear 3'UTR luciferase reporter plasmidTHEM5 3' UTR sequence
Inhib. RNA
Products:
    
OriGene RNAi products in human, mouse, rat for THEM5
Predesigned siRNA for gene silencing in human, mouse, rat THEM5

Gene Editing
Products:
DNA2.0 Custom Protein Engineering Service for THEM5

Clone
Products:
     
OriGene clones in human, mouse for THEM5 (see all 5)
OriGene ORF clones in mouse, rat for THEM5
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript: all cDNA clones in your preferred vector: THEM5 (NM_182578)
Sino Biological Human cDNA Clone for THEM5
DNA2.0 Custom Codon Optimized Gene Synthesis Service for THEM5
Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat THEM5

Cell Line
Products:
     
GenScript Custom overexpressing Cell Line Services for THEM5
Browse ESI BIO Cell Lines and PureStem Progenitors for THEM5 
In Situ Assay
Products:
   

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for THEM5


(According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus

Subcellular locations from UniProtKB/Swiss-Prot
ACO15_HUMAN, Q8N1Q8: Mitochondrion matrix
Subcellular locations from COMPARTMENTS: 

CompartmentConfidence
mitochondrion5
cytosol2
extracellular1
golgi apparatus1
nucleus1
peroxisome1

Gene Ontology (GO): 2 cellular component terms:    About this table

GO IDQualified GO termEvidencePubMed IDs
GO:0005739mitochondrion ----
GO:0005759mitochondrial matrix IDA--

Find genes that share ontologies with THEM5           About GenesLikeMe


(SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
About This Section

TryGeneCards Plus




    Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for THEM5
Interactions:

    Search GeneGlobe Interaction Network for THEM5

STRING Interaction Network Preview (showing 5 interactants - click image to see 6)

Selected Interacting proteins for THEM5 (ENSP000003578074) via UniProtKB, MINT, STRING, and/or I2D (see all 6)
InteractantInteraction Details
GeneCardExternal ID(s)
FBXO18ENSP000003693354STRING: ENSP00000369335
PRAMEF13ENSP000003653024STRING: ENSP00000365302
HIBCHENSP000003527064STRING: ENSP00000352706
MINOS1ENSP000003255624STRING: ENSP00000325562
SUPV3L1ENSP000003526784STRING: ENSP00000352678
About this table

Gene Ontology (GO): 3 biological process terms:    About this table

GO IDQualified GO termEvidencePubMed IDs
GO:0006631fatty acid metabolic process IEA--
GO:0035336long-chain fatty-acyl-CoA metabolic process IDA--
GO:0035965cardiolipin acyl-chain remodeling ISS--

Find genes that share ontologies with THEM5           About GenesLikeMe



(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
About This Section

TryGeneCards Plus
Browse Small Molecules at EMD Millipore
   Browse drugs & compounds from Enzo Life Sciences
  Browse compounds at ApexBio 

Browse Tocris compounds for THEM5 (ACO15)



(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
About This Section

TryGeneCards Plus

REFSEQ mRNAs for THEM5 gene: 
NM_182578.3  

Unigene Cluster for THEM5:

Thioesterase superfamily member 5
Hs.132648  [show with all ESTs]
Unigene Representative Sequence: AK095283
2 Ensembl transcripts including schematic representations, and UCSC links where relevant:
ENST00000368817(uc021oyw.1) ENST00000453881
miRNA
Products:
     
Block miRNA regulation of human, mouse, rat THEM5 using miScript Target Protectors
Search for qRT-PCR Assays for microRNAs that regulate THEM5
SwitchGear 3'UTR luciferase reporter plasmidTHEM5 3' UTR sequence
Inhib. RNA
Products:
     
OriGene RNAi products in human, mouse, rat for THEM5
Predesigned siRNA for gene silencing in human, mouse, rat THEM5
Clone
Products:
     
OriGene clones in human, mouse for THEM5 (see all 5)
OriGene ORF clones in mouse, rat for THEM5
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript: all cDNA clones in your preferred vector: THEM5 (NM_182578)
DNA2.0 Custom Codon Optimized Gene Synthesis Service for THEM5
Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat THEM5
Primer
Products:
    
OriGene qSTAR qPCR primer pairs in human, mouse for THEM5
Pre-validated RT2 qPCR Primer Assay in human, mouse, rat THEM5
  QuantiTect SYBR Green Assays in human, mouse, rat THEM5
  QuantiFast Probe-based Assays in human, mouse, rat THEM5

Additional mRNA sequence: 

AK095283.1 BC101610.1 BC112239.1 

3 DOTS entries:

DT.100009058  DT.100723753  DT.40129428 

3 AceView cDNA sequences:

BX093845 AI032980 CD103453 

GeneLoc Exon Structure


(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

TryGeneCards Plus

THEM5 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>2/3
CGAP TAG: TGGCAAGTGC
THEM5 Expression
About this image


THEM5 expression in embryonic tissues and stem cells    About this table
Data from LifeMap, the Embryonic Development and Stem Cells Database
 selected tissues (see all 2) fully expand
 
 Epidermis (Integumentary System)
         Stratified Epidermis
 
 Epiblast (Early Embryonic Tissues)
         Epiblast Stem Cell line 5
THEM5 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

THEM5 Protein Expression

SOURCE GeneReport for Unigene cluster: Hs.132648
    Custom PCR Arrays for THEM5
Primer
Products:
OriGene qSTAR qPCR primer pairs in human, mouse for THEM5
Pre-validated RT2 qPCR Primer Assay in human, mouse, rat THEM5
QuantiTect SYBR Green Assays in human, mouse, rat THEM5
QuantiFast Probe-based Assays in human, mouse, rat THEM5
In Situ
Assay Products:
 

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for THEM5

(Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

TryGeneCards Plus

This gene was present in the common ancestor of chordates.

Orthologs for THEM5 gene from Selected species (see all 10)    About this table
Organism Taxonomic
classification
Gene Description Human
Similarity
Orthology
Type
Details
mouse
(Mus musculus)
Mammalia Them51 , 5 thioesterase superfamily member 51, 5 83.4(n)1
78.14(a)1
  3 (40.52 cM)5
661981  NM_025416.31  NP_079692.11 
 943420995 
chicken
(Gallus gallus)
Aves --
Uncharacterized protein
32(a)
1 → many
25(2161976-2163503)
lizard
(Anolis carolinensis)
Reptilia --
Uncharacterized protein
30(a)
1 → many
GL344049.1(19514-22505)
zebrafish
(Danio rerio)
Actinopterygii THEM46
thioesterase superfamily member 4
29(a)
1 → many
16(19826911-19861475) ENSDARG00000061621


ENSEMBL Gene Tree for THEM5 (if available)
TreeFam Gene Tree for THEM5 (if available)

(Paralogs according to 1HomoloGene,
2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
About This Section

TryGeneCards Plus
Paralogs for THEM5 gene
THEM42  
1 SIMAP similar gene for THEM5 using alignment to 2 protein entries:     ACO15_HUMAN (see all proteins):
THEM4

Find genes that share paralogs with THEM5           About GenesLikeMe



(SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
About This Section

TryGeneCards Plus

Selected SNPs for THEM5 (see all 187)    About this table                                 

Genomic DataTranscription Related DataAllele Frequencies
SNP IDValidClinical
significance
Chr 1 posSequence#AA
Chg
TypeMore#Allele
freq
PopTotal
sample
More
----------
rs1131621171,2
Cuntested1151824856(+) ACAGGC/TTCAGC 2 N S mis11Minor allele frequency- T:0.50NA 2
rs1924269481,2
--151819157(+) TTTGTC/TTTACT 1 -- ds50010--------
rs1158701251,2
F--151819280(+) GCTTTT/CGTAGA 1 -- ds50011Minor allele frequency- C:0.01NA 120
rs1407079151,2
--151819496(+) CAGTCA/GGTGCT 1 -- ds50010--------
rs1502725321,2
--151819521(+) GTATGG/TGAGAT 1 -- ds50010--------
rs1833818581,2
--151819607(+) AGAGAA/GAAGGG 1 -- ut310--------
rs1159958651,2
C,F--151819621(+) TTTCCC/GTCGCC 1 -- ut311Minor allele frequency- G:0.04WA 118
rs1873851431,2
--151819628(+) CGCCTC/TACCAA 1 -- ut310--------
rs678133031,2
C--151819774(+) GCAGG-/CAGGGGAGGCAGGAGGCAGG/CAGGGGAGGCAG
GAGGCAGGAGGCAGGCAGGGGAGGCAGGAGGCAGG
AGGCA
3 -- ut311NA 2
rs1389237371,2
C--151819919(+) CTGCAA/GGAGCT 1 -- int10--------

HapMap Linkage Disequilibrium report for THEM5 (151819577 - 151826173 bp)

Structural Variations
     Database of Genomic Variants (DGV) 3 variations for THEM5:    About this table    
Variant IDTypeSubtypePubMed ID
esv2717906CNV Deletion23290073
esv2717918CNV Deletion23290073
nsv516369CNV Gain19592680

Site Specific Mutation Identification with PCR Assays
SeqTarget long-range PCR primers for resequencing THEM5
DNA2.0 Custom Variant and Variant Library Synthesis for THEM5

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

TryGeneCards Plus
OMIM gene information: 615653    OMIM disorders: --

2 diseases for THEM5:    
About MalaCards
median rhomboid glossitis    glossitis

1 disease from the University of Copenhagen DISEASES database for THEM5:
Median rhomboid glossitis

Find genes that share disorders with THEM5           About GenesLikeMe

Genetic Association Database (GAD): THEM5
Human Genome Epidemiology (HuGE) Navigator: THEM5 (3 documents)

Export disorders for THEM5 gene to outside databases

(in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
About This Section

TryGeneCards Plus

PubMed articles for THEM5 gene integrated from 10 sources:
(articles sorted by number of sources associating them with THEM5)
    Utopia: connect your pdf to the dynamic
world of online information

  1. Acyl coenzyme A thioesterase Them5/Acot15 is involved in cardiolipin remodeling and fatty liver development. (PubMed id 22586271)1, 2 Zhuravleva E.... Hemmings B.A. (Mol. Cell. Biol. 2012)
  2. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PubMed id 20877624)1, 4 Hendrickson S.L....O'Brien S.J. (PLoS ONE 2010)
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (Nat. Genet. 2004)
  4. New genetic associations detected in a host response study to hepatitis B vaccine. (PubMed id 20237496)1 Davila S....Seielstad M. (Genes Immun. 2010)
  5. The DNA sequence and biological annotation of human chromosome 1. (PubMed id 16710414)2 Gregory S.G.... Bentley D.R. (Nature 2006)
  6. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)2 Gerhard D.S.... Malek J. (Genome Res. 2004)
  7. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

TryGeneCards Plus
 ANDOR
Aliases
Free Text  

  Query String
PubMed
OMIM
NCBI Bookshelf
  (Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

TryGeneCards Plus
Entrez Gene: 284486 HGNC: 26755 AceView: FLJ37964 Ensembl:ENSG00000196407 euGenes: HUgn284486
ECgene: THEM5 H-InvDB: THEM5

(According to HUGE)
About This Section

TryGeneCards Plus
  --

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
About This Section

TryGeneCards Plus
NameDescription
PharmGKB entry for THEM5 Pharmacogenomics, SNPs, Pathways

(Patent information from GeneIP,
Licensable technologies from WIS Yeda, Salk, Tufts,
IP news from LifeMap Sciences, Inc.)
About This Section

TryGeneCards Plus
Patent Information for THEM5 gene:
Search GeneIP for patents involving THEM5

GeneCards and IP:
Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, eBioscience, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
About This Section

TryGeneCards Plus

 
 EMD Millipore genomic analysis products

  
 Browse Antibodies   Browse Cell Culture Products  
 Browse ELISAs   Browse Flow Cytometry Kits  
 Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
 Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
 Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
 Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
 Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
 Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
 Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
 Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for THEM5  
 Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for THEM5  
 OriGene MassSpec something-or-other for THEM5   OriGene clones in human, mouse for THEM5  
 OriGene qSTAR qPCR primer pairs in human, mouse for THEM5   OriGene Purified Protein for THEM5  
 OriGene ORF clones in mouse, rat for THEM5   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
 OriGene Custom Antibody Services for THEM5   OriGene Custom Protein Services for THEM5  

 
 
 Block miRNA regulation of human, mouse, rat THEM5 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing THEM5
 DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat THEM5 Predesigned siRNA for gene silencing in human, mouse, rat THEM5
 QuantiFast Probe-based Assays in human, mouse, rat THEM5 QuantiTect SYBR Green Assays in human, mouse, rat THEM5
 Custom PCR Arrays for THEM5 Search Chromatin IP Primers for THEM5
 Pre-validated RT2 qPCR Primer Assay in human, mouse, rat THEM5  Search GeneGlobe Interaction Network for THEM5
 Regulatory tfbs in THEM5 promoter
 GenScript Custom Purified and Recombinant Proteins Services for THEM5 GenScript cDNA clones with any tag delivered in your preferred vector for THEM5
 GenScript Custom Assay Services for THEM5 GenScript Custom overexpressing Cell Line Services for THEM5
 CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
 Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
 Plasmid Preparation Custom Peptide Services
 Search for Antibodies & Assays

 Search Tocris compounds for THEM5 (ACO15)
 Browse Sino Biological Proteins
 Browse Sino Biological Cell Lysates
 cDNA Clones for THEM5
 4000+ Proteins
 Search Sino Biological for antibodies, proteins & pathways
 Protein Production Services
 Transfection Reagents
 Protein A/G/L resins
 Isotyping reagents
 Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

 Novus Tissue Slides
 THEM5 antibodies
 THEM5 proteins
 THEM5 lysates
 Antibodies for THEM5
 See all of Abcam's Antibodies, Kits and Proteins for THEM5
 Custom Antibody / Protein Production Service
 Bulk Purchasing
 Advantages of Rabbit Monoclonal antibodies
 Abcam protocols and scientific support
 Browse ProSpec Recombinant Proteins
 Proteins for THEM5
 Antibodies for THEM5
 ELISAs for THEM5
 CLIAs for THEM5



 Browse ESI BIO Cell Lines and PureStem Progenitors for THEM5
 Gene Synthesis
 Protein Engineering
 Variant Library Synthesis
 Codon Optimization
 Protein Production and Purification
 Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for THEM5
 SwitchGear 3'UTR luciferase reporter plasmids for THEM5
 SwitchGear Promoter luciferase reporter plasmids for THEM5
 Search ThermoFisher Antibodies for THEM5
 Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat THEM5
 inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for THEM5
 inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for THEM5
 LSBio Antibodies in human, mouse, rat for THEM5
Customized transgenic rodents for:
 Humanization
 Biomarker expression
 Off-target effect monitoring
 Translational medicine
 Tissue-specific gene expresssion
 Time-controlled gene expresssion
 Browse compounds at ApexBio
 Search Addgene for plasmids for THEM5
  Search eBioscience for proteins for THEM5
  Search eBioscience for elisas for THEM5
  eBioscience FlowRNA Probe Sets
       
GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014

View Random Gene

Category
(GIFtS: )
GIFtS Group
The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes      Disease genes      THEM5 gene at Home site.
Version: 3.12.212 17 Sep 2014
hostname: 356980-web2.xennexinc.com index build: 128 solr: 1.4