Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

TERT Gene

protein-coding   GIFtS: 74
GCID: GC05M001253

Telomerase Reverse Transcriptase

Microbiology & Infectious Diseases Congress
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Telomerase Reverse Transcriptase1 2     CMM92
EST22 3 5     DKCA22
TCS12 3 5     DKCB42
Telomerase Catalytic Subunit2 3     PFBMFT12
Telomerase-Associated Protein 22 3     hEST22
TP22 3     hTRT2
TRT2 3     HEST23
EC 2.7.7.493 8     EC 2.7.78

External Ids:    HGNC: 117301   Entrez Gene: 70152   Ensembl: ENSG000001643627   OMIM: 1872705   UniProtKB: O147463   

Export aliases for TERT gene to outside databases

Previous GC identifers: GC05P001643 GC05M001282 GC05M001306


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for TERT Gene:
Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat
TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and
an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in
cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening
of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in
mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere
repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of
telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been
determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase
activity. (provided by RefSeq, Jul 2008)

GeneCards Summary for TERT Gene: 
TERT (telomerase reverse transcriptase) is a protein-coding gene. Diseases associated with TERT include aplastic anemia, and tert-related familial pulmonary fibrosis, and among its related super-pathways are Telomere C-strand (Lagging Strand) Synthesis and Cell Cycle, Mitotic. GO annotations related to this gene include telomerase activity and protein homodimerization activity.

UniProtKB/Swiss-Prot: TERT_HUMAN, O14746
Function: Telomerase is a ribonucleoprotein enzyme essential for the replication of chromosome termini in most
eukaryotes. Active in progenitor and cancer cells. Inactive, or very low activity, in normal somatic cells.
Catalytic component of the teleromerase holoenzyme complex whose main activity is the elongation of telomeres by
acting as a reverse transcriptase that adds simple sequence repeats to chromosome ends by copying a template
sequence within the RNA component of the enzyme. Catalyzes the RNA-dependent extension of 3'-chromosomal termini
with the 6-nucleotide telomeric repeat unit, 5'-TTAGGG-3'. The catalytic cycle involves primer binding, primer
extension and release of product once the template boundary has been reached or nascent product translocation
followed by further extension. More active on substrates containing 2 or 3 telomeric repeats. Telomerase activity
is regulated by a number of factors including telomerase complex-associated proteins, chaperones and polypeptide
modifiers. Modulates Wnt signaling. Plays important roles in aging and antiapoptosis

summary for TERT Gene:
Telomerase is a ribonucleoprotein composed of an internal telomerase RNA template (TERC) and the enzyme,
telomerase reverse transcriptase (TERT). Telomerase adds small repeat sequences of DNA (TTAGGG) to the end
of chromosomes - multiple repeats of this hexanucleotide sequence over a 5kb span are known as a telomere.
During normal cellular replication, telomeres are eroded and thus protect the coding sequences of the DNA.
The erosion of telomeric sequences is thought to form the basis of the cellular clock which eventually
signals for the cell to exit the cell cycle and undergo senescence. Expression of telomerase is low in most
normal cells although it is thought to be active in embryonic cells and some rapidly dividing cells of the
immune system. Overexpression of telomerase is key component of the transformation process in many malignant
cancer cells.

Gene Wiki entry for TERT (Telomerase reverse transcriptase) Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000005.9  NT_006576.16  NC_018916.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the TERT gene promoter:
         Egr-3   AP-1   Sp1   p53   STAT3   
         Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids
   Search SABiosciences Chromatin IP Primers for TERT

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TERT


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 5p15.33   Ensembl cytogenetic band:  5p15.33   HGNC cytogenetic band: 5p15.33

TERT Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TERT gene location

GeneLoc information about chromosome 5         GeneLoc Exon Structure

GeneLoc location for GC05M001253:  view genomic region     (about GC identifiers)

Start:
1,253,262 bp from pter      End:
1,295,184 bp from pter
Size:
41,923 bases      Orientation:
minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: TERT_HUMAN, O14746 (See protein sequence)
Recommended Name: Telomerase reverse transcriptase  
Size: 1132 amino acids; 126997 Da
Subunit: Homodimer; dimerization is required to produce a functional complex. Oligomer; can form oligomers in the
absence of the telomerase RNA template component (TERC). Catalytic subunit of the telomerase holoenzyme complex
composed minimally of TERT and TERC. The telomerase complex is composed of TERT, DKC1, WDR79/TCAB1, NOP10, NHP2,
GAR1, TEP1, EST1A, POT1 and a telomerase RNA template component (TERC). The molecular chaperone HSP90/P23 complex
is required for correct assembly and stabilization of the active telomerase. Interacts directly with HSP90A and
PTGES3. Interacts with HSPA1A; the interaction occurs in the absence of TERC and dissociates once the complex has
formed. Interacts with RAN; the interaction promotes nuclear export of TERT. Interacts with XPO1. Interacts with
PTPN11; the interaction retains TERT in the nucleus. Interacts with NCL (via RRM1 and C-terminal
RRM4/Arg/Gly-rich domains); the interaction is important for nucleolar localization of TERT. Interacts with
SMARCA4 (via the bromodomain); the interaction regulates Wnt-mediated signaling. Interacts with MCRS1 (isoform
MCRS2); the interaction inhibits in vitro telomerase activity. Interacts with PIF1; the interaction has no effect
on the elongation activity of TERT. Interacts with PML; the interaction recruits TERT to PML bodies and inhibits
telomerase activity. Interacts with GNL3L (By similarity)
Subcellular location: Nucleus, nucleolus. Nucleus, nucleoplasm. Nucleus. Chromosome, telomere. Cytoplasm. Nucleus,
PML body. Note=Shuttling between nuclear and cytoplasm depends on cell cycle, phosphorylation states,
transformation and DNA damage. Diffuse localization in the nucleoplasm. Enriched in nucleoli of certain cell
types. Translocated to the cytoplasm via nuclear pores in a CRM1/RAN-dependent manner involving oxidative
stress-mediated phosphorylation at Tyr-707. Dephosphorylation at this site by SHP2 retains TERT in the nucleus.
Translocated to the nucleus by phosphorylation by AKT
1 PDB 3D structure from and Proteopedia for TERT:
2BCK (3D)    
Secondary accessions: O14783 Q2XS35 Q8N6C3 Q8NG46
Alternative splicing: 3 isoforms:  O14746-1   O14746-2   O14746-3   (May be produced at very low levels due to a premature stop codon in the mRNA, leading to nonsense-mediated mRNA decay. No experimental confirmation available)

Explore the universe of human proteins at neXtProt for TERT: NX_O14746

Explore proteomics data for TERT at MOPED 

Post-translational modifications:

  • UniProtKB: Ubiquitinated, leading to proteasomal degradation
  • UniProtKB: Phosphorylation at Tyr-707 under oxidative stress leads to translocation of TERT to the cytoplasm and reduces its
    antiapoptotic activity. Dephosphorylated by SHP2/PTPN11 leading to nuclear retention. Phosphorylation at Ser-227
    by the AKT pathway promotes nuclear location
  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_O14746

  • 4/7 DME Specific Peptides for TERT (O14746) (see all 7)
     LRELSEAE  LVAQCLVC  LFLDLQVN  RYWQMRPLF 

    TERT Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    TERT Protein Expression
    REFSEQ proteins (2 alternative transcripts): 
    NP_001180305.1  NP_937983.2  

    ENSEMBL proteins: 
     ENSP00000309572   ENSP00000425003   ENSP00000334346   ENSP00000426042   ENSP00000296820  
    Reactome Protein details: O14746
    Human Recombinant Protein Products for TERT: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for TERT
    OriGene Custom MassSpec 
    OriGene Custom Protein Services for TERT
    GenScript Custom Purified and Recombinant Proteins Services for TERT
    Novus Biologicals TERT Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for TERT 

    Gene Ontology (GO): 5/8 cellular component terms (GO ID links to tree view) (see all 8):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000781chromosome, telomeric region IC12135483
    GO:0000783nuclear telomere cap complex IC15632080
    GO:0005634nucleus ----
    GO:0005654nucleoplasm TAS--
    GO:0005697telomerase holoenzyme complex IDA12135483

    TERT for ontologies           About GeneDecksing



    TERT Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of TERT
    R&D Systems Antibodies for TERT
    OriGene Antibodies for TERT
    OriGene Custom Antibody Services for TERT
    GenScript Custom Superior Antibodies Services for TERT
    Novus Biologicals TERT Antibodies
    Abcam antibodies for TERT
    Cloud-Clone Corp. Antibodies for TERT 
    ThermoFisher Antibody for TERT
    LSBio Antibodies in human, mouse, rat for TERT 

    Assay Products for TERT: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for TERT
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for TERT
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for TERT 
    Cloud-Clone Corp. CLIAs for TERT


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    3 InterPro protein domains:
     IPR003545 Telomerase_RT
     IPR000477 RVT
     IPR021891 Telomerase_RBD

    Graphical View of Domain Structure for InterPro Entry O14746

    ProtoNet protein and cluster: O14746

    1 Blocks protein domain: IPB003545 Telomere reverse transcriptase signature

    UniProtKB/Swiss-Prot: TERT_HUMAN, O14746
    Domain: The primer grip sequence in the RT domain is required for telomerase activity and for stable association
    with short telomeric primers
    Domain: The RNA-interacting domain 1 (RD1)/N-terminal extension (NTE) is required for interaction with the
    pseudoknot-template domain of each of TERC dimers. It contains anchor sites that bind primer nucleotides upstream
    of the RNA-DNA hybrid and is thus an essential determinant of repeat addition processivity
    Domain: The RNA-interacting domain 2 (RD2) is essential for both interaction with the CR4-CR5 domain of TERC and
    for DNA synthesis
    Similarity: Belongs to the reverse transcriptase family. Telomerase subfamily
    Similarity: Contains 1 reverse transcriptase domain


    TERT for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: TERT_HUMAN, O14746
    Function: Telomerase is a ribonucleoprotein enzyme essential for the replication of chromosome termini in most
    eukaryotes. Active in progenitor and cancer cells. Inactive, or very low activity, in normal somatic cells.
    Catalytic component of the teleromerase holoenzyme complex whose main activity is the elongation of telomeres by
    acting as a reverse transcriptase that adds simple sequence repeats to chromosome ends by copying a template
    sequence within the RNA component of the enzyme. Catalyzes the RNA-dependent extension of 3'-chromosomal termini
    with the 6-nucleotide telomeric repeat unit, 5'-TTAGGG-3'. The catalytic cycle involves primer binding, primer
    extension and release of product once the template boundary has been reached or nascent product translocation
    followed by further extension. More active on substrates containing 2 or 3 telomeric repeats. Telomerase activity
    is regulated by a number of factors including telomerase complex-associated proteins, chaperones and polypeptide
    modifiers. Modulates Wnt signaling. Plays important roles in aging and antiapoptosis
    Catalytic activity: Deoxynucleoside triphosphate + DNA(n) = diphosphate + DNA(n+1)
    Induction: Activated by cytotoxic events and down-regulated during aging. In peripheral T-lymphocytes, induced By
    CD3 and by PMA/ionomycin. Inhibited by herbimycin B

         Genatlas biochemistry entry for TERT:
    telomerase,catalytic subunit,yeast Est2 homolog,100kDa,involved in telomere maintenance,putative up-regulated
    c-Myc target gene,protein activity deleted in cancer,repressed in normal tissues

         Enzyme Numbers (IUBMB): EC 2.7.7.491 2 EC 2.7.72

         Gene Ontology (GO): 5/9 molecular function terms (GO ID links to tree view) (see all 9):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003720telomerase activity IDA12135483
    GO:0003721telomeric template RNA reverse transcriptase activity TAS14991929
    GO:0003723RNA binding ----
    GO:0003964RNA-directed DNA polymerase activity ----
    GO:0005515protein binding IPI12699629
         
    TERT for ontologies           About GeneDecksing


    Phenotypes:
         14 MGI mutant phenotypes (inferred from 8 alleles(MGI details for Tert):
     cellular  digestive/alimentary  endocrine/exocrine gland  growth/size  hematopoietic system 
     homeostasis/metabolism  immune system  mortality/aging  nervous system  normal 
     reproductive system  skeleton  taste/olfaction  tumorigenesis 

    TERT for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-outs for TERT: Terttm1Sear Terttm1Fish Terttm1Rdp Terttm1Yjc Terttm1Leah

       inGenious Targeting Laboratory - Custom generated mouse model solutions for TERT 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for TERT

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for TERT 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for TERT 

    miRNA
    Products:
        
    miRTarBase miRNAs that target TERT:
    hsa-mir-138 (MIRT003991)

    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TERT
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate TERT
    SwitchGear 3'UTR luciferase reporter plasmidTERT 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for TERT
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TERT

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for TERT
    Sirion Biotech Customized adenovirus for overexpression of TERT

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for TERT (see all 12)
    OriGene ORF clones in mouse, rat for TERT
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): TERT (NM_198253)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TERT
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TERT
    Sirion Biotech Customized lentivirus for stable overexpression of TERT 
                         Customized lentivirus expression plasmids for stable overexpression of TERT 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for TERT
    Search LifeMap BioReagents cell lines for TERT
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TERT


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for TERT About   (see all 15)                                                                                              See pathways by source

    SuperPathContained pathways About
    1Lagging Strand Synthesis
    Extension of Telomeres0.92
    2Cell Cycle
    Cell Cycle0.84
    3Apoptotic Pathways in Synovial Fibroblasts
    Telomerase Components in Cell Signaling0.72
    4Packaging Of Telomere Ends
    Telomere Maintenance0.56
    5Meiotic Synapsis
    Chromosome Maintenance0.56

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    3 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for TERT
        Telomerase Components in Cell Signaling
    14-3-3 and Regulation of BAD Activity
    Telomere Extension by Telomerase

    5/6 BioSystems Pathways for TERT (see all 6)
        Id Signaling Pathway
    HIF-1-alpha transcription factor network
    IL2 signaling events mediated by PI3K
    Regulation of Telomerase
    Validated targets of C-MYC transcriptional activation

    5        Reactome Pathways for TERT
        Extension of Telomeres
    Telomere Maintenance
    Cell Cycle
    Chromosome Maintenance
    Telomere Extension By Telomerase


    1         Kegg Pathway  (Kegg details for TERT):
        HTLV-I infection


    TERT for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for TERT

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/93 Interacting proteins for TERT (O147461, 2, 3 ENSP000003095724) via UniProtKB, MINT, STRING, and/or I2D (see all 93)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    UPF1Q929002, 3, ENSP000002628034MINT-8286561 MINT-8286551 MINT-8286579 I2D: score=1 STRING: ENSP00000262803
    AKT1P317492, 3, ENSP000002702024MINT-6742762 I2D: score=3 STRING: ENSP00000270202
    RUVBL1Q9Y2651, 3, ENSP000003182974EBI-1772203,EBI-353675 I2D: score=1 STRING: ENSP00000318297
    CIB1Q998283, ENSP000003338734I2D: score=2 STRING: ENSP00000333873
    MCRS1Q96EZ83, ENSP000003496404I2D: score=2 STRING: ENSP00000349640
    About this table

    Gene Ontology (GO): 5/7 biological process terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000723telomere maintenance TAS12135483
    GO:0006278RNA-dependent DNA replication ----
    GO:0007004telomere maintenance via telomerase TAS--
    GO:0022616DNA strand elongation IDA16043710
    GO:0032203telomere formation via telomerase IDA16043710

    TERT for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    TERT for compounds           About GeneDecksing

    EMD Millipore small molecules for TERT:
    Small Molecule - inhibitor
    Enzo Life Sciences drugs & compounds for TERT

    Compounds for TERT available from Tocris Bioscience    About this table
    CompoundAction CAS #
    TMPyP4 tosylateInhibitor of human telomerase[36951-72-1]
    BIBR 1532Selective telomerase inhibitor[321674-73-1]
    CostunolideInhibitor of human telomerase activity[553-21-9]

    2 HMDB Compounds for TERT    About this table
    CompoundSynonyms CAS #PubMed Ids
    Phosphoric acidacide phosphorique (FRENCH) (see all 20)7664-38-2--
    Pyrophosphate(4-)Diphosphoric acid ion (see all 10)14000-31-8--

    1 DrugBank Compound for TERT    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    ZidovudineAzidothymidine (see all 3)30516-87-1targetinhibitor23303810

    10/50 Novoseek inferred chemical compound relationships for TERT gene (see all 50)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    tin(2+) 59.3 7 12007281 (2), 11494028 (1), 19419704 (1), 18669893 (1)
    lipofectamine 36.4 1 17495775 (1)
    ganciclovir 26.4 4 19328781 (1), 15312323 (1), 17407070 (1), 19809268 (1)
    retinoic acid 25.4 12 12529350 (2), 15236314 (2), 12939463 (1), 14592454 (1) (see all 7)
    ly294002 24.5 2 16093915 (1)
    depsipeptide 22.8 2 17610380 (1), 15791453 (1)
    oligonucleotide 17.5 5 12838868 (1), 17991312 (1), 12519411 (1)
    cisplatin 16.5 4 11877097 (1), 17923759 (1), 19639202 (1), 11384107 (1)
    etoposide 14 3 12594176 (1), 11718848 (1)
    5-aza-2'deoxycytidine 13.9 2 15805278 (1)

    Search CenterWatch for drugs/clinical trials and news about TERT

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for TERT gene (4 alternative transcripts): 
    NM_001193376.1  NM_198253.2  NM_198254.1  NM_198255.2  

    Unigene Cluster for TERT:

    Telomerase reverse transcriptase
    Hs.492203  [show with all ESTs]
    Unigene Representative Sequence: AF018167
    8 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000484238(uc003jbz.1 uc021xvz.1) ENST00000310581(uc003jcb.1 uc003jcc.1 uc003jca.1 uc003jcd.1 uc003jce.1)
    ENST00000460137 ENST00000334602 ENST00000503656 ENST00000508104 ENST00000522877
    ENST00000296820(uc021xwa.1 uc021xwb.1 uc021xwc.1)
    Congresses - knowledge worth sharing:  
    European Congress of Clinical Microbiology and Infectious Diseases (ECCMID) 10 - 13 May 2014

    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TERT
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate TERT
    SwitchGear 3'UTR luciferase reporter plasmidTERT 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for TERT
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TERT
    Clone
    Products:
         
    OriGene clones in human, mouse for TERT (see all 12)
    OriGene ORF clones in mouse, rat for TERT
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): TERT (NM_198253)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TERT
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TERT
    Sirion Biotech Customized lentivirus for stable overexpression of TERT 
                         Customized lentivirus expression plasmids for stable overexpression of TERT 
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for TERT
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TERT
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TERT
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TERT

    Additional mRNA sequence: 

    AB085628.1 AF015950.1 AF018167.1 BC062321.1 JF896280.1 JF896281.1 JF896282.1 JF896283.1 
    JF896284.1 JF896285.1 JF896286.1 

    3 DOTS entries:

    DT.108983  DT.101961620  DT.40268927 

    24/29 AceView cDNA sequences (see all 29):

    AX810038 NM_003219 AW276315 AX810036 AB086950 NM_198254 NM_198253 BC062321 
    AF015950 NM_198255 AI824948 AB085628 AB086379 AF018167 BE514188 AX810378 
    BE514070 AW270031 BM453198 AA281296 AA811084 AX810043 AA311750 BM824748 

    GeneLoc Exon Structure

    5 Alternative Splicing Database (ASD) splice patterns (SP) for TERT    About this scheme

    ExUns: 1a · 1b ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16a · 16b
    SP1:                    -                                                                                                   
    SP2:                    -                                                           -                                       
    SP3:                    -                                   -     -                 -                                       
    SP4:                    -                       -           -     -                 -                                       
    SP5:                                                        -     -                                                         


    ECgene alternative splicing isoforms for TERT

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TERT expression in normal human tissues (normalized intensities)      TERT embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TCCGGCTGAA
    TERT Expression
    About this image


    TERT expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/9 selected tissues (see all 9) fully expand
     
     Inner Cell Mass (Early Embryonic Tissues)    fully expand to see all 10 entries
             Line H7 (WA07)
     
     Bone (Muscoskeletal System)    fully expand to see all 2 entries
             GLP-transfected mesenchymal stem cells
     
     Ovary (Reproductive System)    fully expand to see all 2 entries
             Ovarian tissue-dissociated cells (human)
     
     Uterus (Reproductive System)
             Endometrial regenerative cells
     
     Heart (Cardiovascular System)
             Cardiac progenitor cells (Sca1+)

    See TERT Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for TERT

    SOURCE GeneReport for Unigene cluster: Hs.492203

    UniProtKB/Swiss-Prot: TERT_HUMAN, O14746
    Tissue specificity: Expressed at a high level in thymocyte subpopulations, at an intermediate level in tonsil
    T-lymphocytes, and at a low to undetectable level in peripheral blood T-lymphocytes

        SABiosciences Expression via Pathway-Focused PCR Arrays including TERT (see all 9): 
              Lung Cancer in human mouse rat
              Stem Cell Transcription Factors in human mouse rat
              Liver Cancer in human mouse rat
              Stem Cells in human mouse rat
              Cancer Drug Targets in human mouse rat

    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for TERT
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TERT
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TERT
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TERT
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TERT

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for TERT gene from 8/14 species (see all 14)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Tert1 , 5 telomerase reverse transcriptase1, 5 70.97(n)1
    64.53(a)1
      13 (40.12 cM)5
    217521  NM_009354.11  NP_033380.11 
     736270015 
    chicken
    (Gallus gallus)
    Aves TERT1 telomerase reverse transcriptase 56.89(n)
    52.89(a)
      420972  NM_001031007.1  NP_001026178.1 
    lizard
    (Anolis carolinensis)
    Reptilia TERT6
    Telomerase reverse transcriptase
    39(a)
    1 ↔ 1
    4(68147845-68189376)
    African clawed frog
    (Xenopus laevis)
    Amphibia tert-A2 telomerase reverse transcriptase 71.34(n)    AF212299.1 
    zebrafish
    (Danio rerio)
    Actinopterygii tert1 telomerase reverse transcriptase 47.95(n)
    37.75(a)
      796551  NM_001083866.1  NP_001077335.1 
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes EST2(YLR318W)4 Reverse transcriptase subunit of the telomerase holoenzyme, more   --   12(766542-769196) 851028  NP_013422.1 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons TERT1 telomerase reverse transcriptase 41.22(n)
    28.78(a)
      831548  NM_121691.3  NP_197187.1 
    rice
    (Oryza sativa)
    Liliopsida Os12g02931001 hypothetical protein 39.61(n)
    30.21(a)
      4352024  NM_001073142.1  NP_001066610.1 


    ENSEMBL Gene Tree for TERT (if available)
    TreeFam Gene Tree for TERT (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for TERT gene
    1 SIMAP similar gene for TERT using alignment to 8 protein entries:     TERT_HUMAN (see all proteins):
    hTERT

    TERT for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    1293/1753 SNPs in TERT are shown (see all 1753)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 5 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0625444
    Dyskeratosis congenita, autosomal dominant, 2 (DKCA2)4--see VAR_0625442 F L mis40--------
    VAR_0368704
    Pulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4--see VAR_0368702 V M mis40--------
    VAR_0687984
    Pulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4--see VAR_0687982 K R mis40--------
    VAR_0368634
    Pulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4--see VAR_0368632 A T mis40--------
    VAR_0368684
    Pulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4--see VAR_0368682 R H mis40--------
    VAR_0368694
    Dyskeratosis congenita, autosomal dominant, 2 (DKCA2)4--see VAR_0368692 K N mis40--------
    VAR_0625384
    Dyskeratosis congenita, autosomal recessive, 4 (DKCB4)4--see VAR_0625382 P R mis40--------
    VAR_0687994
    Pulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4--see VAR_0687992 P L mis40--------
    VAR_0687924
    Pulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4--see VAR_0687922 V M mis40--------
    VAR_0625404
    Dyskeratosis congenita, autosomal recessive, 4 (DKCB4)4--see VAR_0625402 R C mis40--------
    VAR_0368664
    Pulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4--see VAR_0368662 V M mis40--------
    VAR_0688004
    Pulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4--see VAR_0688002 V F mis40--------
    VAR_0625424
    Dyskeratosis congenita, autosomal dominant, 2 (DKCA2)4--see VAR_0625422 R W mis40--------
    VAR_0368674
    Pulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4--see VAR_0368672 Y C mis40--------
    VAR_0687934
    Dyskeratosis congenita, autosomal recessive, 4 (DKCB4)4--see VAR_0687932 P S mis40--------
    VAR_0625414
    Dyskeratosis congenita, autosomal recessive, 4 (DKCB4)4--see VAR_0625412 R W mis40--------
    VAR_0687974
    Pulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4--see VAR_0687972 V M mis40--------
    VAR_0687964
    Pulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4--see VAR_0687962 L F mis40--------
    VAR_0687944
    Pulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4--see VAR_0687942 A T mis40--------
    rs1414259411,2,4
    CPulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4 --1272311(+) GATGAC/TGACGG 4 I V mis10--------
    rs340947201,2,4
    CPulmonary fibrosis, and/or bone marrow failure, telomere-related, 1 (PFBMFT1)4 pathogenic11293767(-) AGACGC/TACTGC 4 H Y mis16Minor allele frequency- T:0.00NS NA 192
    rs339546911,2
    C,Fnon-pathogenic11255520(-) TTTCAC/TGCATG 4 H syn115Minor allele frequency- T:0.13MN NA NS EA EU 2214
    rs1994222881,2
    Cnon-pathogenic11278864(-) CTCACA/GGAGGT 4 T syn10--------
    rs339636171,2
    C,Fnon-pathogenic11279439(-) CGGGCC/TCAGGA 4 A syn112Minor allele frequency- T:0.01MN NS NA EA 830
    rs27360981,2
    C,F,A,Hnon-pathogenic11294086(-) CACGCG/AGGCCC 4 /A syn1 ese319Minor allele frequency- A:0.21MN NS EA NA WA 3726
    rs1219186641,2
    Cpathogenic11254510(-) CCTACA/GTGCCA 4 M V mis10--------
    rs357199401,2,4
    C,Fpathogenic11254594(-) GCGCCG/ACCGGC 4 /T /A mis18Minor allele frequency- A:0.01NS NA EU 1499
    rs1219186651,2
    Cpathogenic11264656(-) CGGAAC/GACAGT 3 N K mis1 int10--------
    rs1219186661,2
    Cpathogenic11266639(-) CCTGCA/GTTTGG 4 H R mis10--------
    rs1219186631,2
    Cpathogenic11272367(-) GCCGTA/GCATGC 4 Y C mis10--------
    rs1495668581,2
    Cpathogenic11278865(+) CCTCCG/ATGAGC 4 /T /M mis11Minor allele frequency- A:0.00NA 4552
    rs1219186621,2
    Cpathogenic11279456(-) CCTTCA/GTGCTG 4 M V mis10--------
    rs617481811,2,4
    C,Fpathogenic11294166(+) TTCGGC/TGGGTC 4 T A mis13Minor allele frequency- T:0.02NA EU 4097
    rs1219186611,2
    Cpathogenic11294397(-) AACGGA/GCCTGG 4 T A mis10--------
    rs1115767401,2
    Cuntested11266652(+) CAGCCC/TAAAAT 2 -- spa10--------
    VAR_0627804
    ----see VAR_0627802 P A mis40--------
    VAR_0627814
    ----see VAR_0627812 V M mis40--------
    VAR_0625364
    ----see VAR_0625362 K N mis40--------
    VAR_0625434
    ----see VAR_0625432 T M mis40--------
    VAR_0627834
    ----see VAR_0627832 R Q mis40--------
    VAR_0627824
    ----see VAR_0627822 R K mis40--------
    VAR_0625354
    ----see VAR_0625352 L Q mis40--------
    VAR_0625374
    ----see VAR_0625372 G D mis40--------
    VAR_0625394
    ----see VAR_0625392 T M mis40--------
    VAR_0627844
    ----see VAR_0627842 P L mis40--------
    rs3740834571,2
    C--1252897(+) CCAGCA/C/TCCCCC 2 -- ds50010--------
    rs2007457291,2
    --1252946(+) TGCCA-/CCCCTG 2 -- ds50010--------
    rs28536911,2
    C,F,A,H--1252950(-) TGGCCA/GGGGTG 2 -- ds500116Minor allele frequency- G:0.37NS EA NA WA 968
    rs355350531,2
    C,F--1252972(-) GCGGCG/AGGGAT 2 -- ds50015Minor allele frequency- A:0.00NS 186
    rs1867004551,2
    --1252976(+) CCGCCA/GCCCAA 2 -- ds50010--------
    rs345276011,2
    C,F,H--1253592(-) CTGGCG/ACTCGG 2 -- ut317Minor allele frequency- A:0.01NS NA 362
    rs1428699011,2
    --1253689(+) TCAGCC/TGGACA 2 -- ut310--------
    rs1140121421,2
    C,F--1253690(+) CAGCCG/AGACAT 2 -- ut311Minor allele frequency- A:0.04WA 118
    rs1477039381,2
    --1253700(+) TGCAGA/GCCTCG 2 -- ut310--------
    rs28536901,2
    C,F,A,H--1253744(-) AGGCCC/TGCACC 2 -- ut31 ese323Minor allele frequency- T:0.22MN NS WA CSA NA 2282
    rs50310491,2
    C,F,H--1253780(-) CTCTAC/TGTCCC 2 -- ut31 ese315Minor allele frequency- T:0.01MN NS EA WA 1122
    rs1923776761,2
    C--1253891(+) GCTGCA/GGCCTC 4 A syn10--------
    rs2001026061,2
    C--1253909(+) GTCAGC/TGTCGT 4 T syn11Minor allele frequency- T:0.00EU 693
    rs1858299891,2
    --1253916(+) TCGTCC/TCCGGG 4 E G mis10--------
    rs350335011,2
    C,F--1253918(-) CTCCCG/AGGGAC 4 /P syn16Minor allele frequency- A:0.02NS EU 861
    rs1142785981,2
    F--1254015(+) AGGACG/ATGTGG 2 -- int11Minor allele frequency- A:0.03WA 118
    rs1883504101,2
    C--1254048(+) CACCTC/TGTGGC 2 -- int10--------
    rs345061581,2
    C,F--1254247(-) CGATGG/CCTCCC 2 -- int18Minor allele frequency- C:0.10NS NA CSA WA 311
    rs349967801,2
    C,F--1254251(-) GGGGCG/AATGGC 2 -- int17Minor allele frequency- A:0.10NS CSA WA 286
    rs1932035191,2
    --1254426(+) CAGGGC/TGTTCA 2 -- int10--------
    rs347426441,2
    C,F--1254451(-) GCCCCA/GCCTGC 2 -- int17Minor allele frequency- G:0.02NS WA EU 1577
    rs2021693261,2
    C--1254458(+) GGGCCC/TGCACT 2 -- int10--------
    rs2012354791,2
    C--1254558(+) GTGGCA/CCAGCC 4 G C mis10--------
    rs2010677061,2
    --1254592(+) GGGCCA/GGCGGC 4 A syn10--------
    rs2021667691,2
    C--1254598(+) GCGGCG/ACCCTT 4 /G syn11Minor allele frequency- A:0.00EU 1087
    rs2013302131,2
    C--1254614(+) CCAGCA/GACATC 4 S L mis10--------
    rs2000023301,2
    C--1254619(+) GACATC/TCCTGG 4 G syn10--------
    rs1851946711,2
    --1254682(+) GACACC/TGGAAA 2 -- int10--------
    rs1885172141,2
    C--1254714(+) GCGGGG/TTGGCT 2 -- int10--------
    rs1467689751,2
    --1254737(+) GTCCCA/GACCCA 2 -- int10--------
    rs350800811,2
    C,F--1254753(-) TGACTC/TCTGCG 2 -- int17Minor allele frequency- T:0.04NS CSA WA 290
    rs1813292121,2
    --1254830(+) AAGCTG/TTTAAG 2 -- int10--------
    rs343219481,2
    C,F--1254873(-) GATCCG/ATCTGA 2 -- int15Minor allele frequency- A:0.01NS 190
    rs1883993181,2
    --1254874(+) CAGACA/GGATCA 2 -- int10--------
    rs350134471,2
    C,F--1254943(-) GCGCCG/ATCCTC 2 -- int17Minor allele frequency- A:0.09NS CSA WA 309
    rs1393186121,2
    C--1254969(+) TGATAC/TGCGGC 2 -- int10--------
    rs1818743141,2
    --1255155(+) GCCCCC/TCAGCG 2 -- int10--------
    rs1876406871,2
    --1255166(+) CTTCCC/TCAGGC 2 -- int10--------
    rs1136045591,2
    C--1255297(+) TGATGG/CGAAAA 2 -- int11Minor allele frequency- C:0.50CSA 2
    rs1899722221,2
    --1255298(+) GATGCA/GAAAAG 2 -- int10--------
    rs359709231,2
    C,F--1255361(-) CCTGCC/TTGCTG 2 -- int15Minor allele frequency- T:0.01MN 408
    rs1816125361,2
    C,F--1255454(+) GAGATG/AACGCG 4 /V syn11Minor allele frequency- A:0.00EU 1321
    rs1995172361,2
    C--1255559(+) GAAAGA/G/TCTCCT 2 -- int11EU 1265
    rs2004206881,2
    C--1255563(+) GGCCTC/TCTAAT 2 -- int10--------
    rs1867827141,2
    C--1255589(+) GGTGTA/GGGCAT 2 -- int10--------
    rs350834121,2
    C,F--1255622(-) CATTCA/GTGCAC 2 -- int18Minor allele frequency- G:0.09NS CSA WA 276
    rs1899623481,2
    --1255696(+) GTGTGC/TGCTTG 2 -- int10--------
    rs1136953841,2
    C--1255719(+) GCTGCA/G/TTGTCT 2 -- int11CSA 2
    rs1504916681,2
    --1255746(+) ACTGCA/GTTTCT 2 -- int10--------
    rs353878651,2
    C,F--1255844(-) TTCCCG/AGAACA 2 -- int17Minor allele frequency- A:0.02NS NA 270
    rs1383678491,2
    --1255845(+) GTTCCA/GGGAAG 2 -- int10--------
    rs1168365431,2
    F--1255908(+) ATCATG/AAATCC 2 -- int11Minor allele frequency- A:0.04WA 118
    rs1825978621,2
    --1255922(+) CCTTCC/GTCAGA 2 -- int10--------
    rs359761051,2
    C,F--1256228(-) GGATCA/GCTTGA 2 -- int16Minor allele frequency- G:0.06NS CSA 191
    rs345395091,2
    C,F--1256256(-) TTCCAA/GTACTT 2 -- int17Minor allele frequency- G:0.02NS CSA WA 309
    rs1379395601,2
    --1256275(+) GCACAC/TCACCA 2 -- int10--------
    rs1849876261,2
    --1256300(+) TTGTTC/TTTATT 2 -- int10--------
    rs1898815341,2
    --1256303(+) TTTTTA/GTTTTT 2 -- int10--------
    rs340420511,2
    C,F--1256393(-) CCAGCA/GCTTTG 2 -- int16Minor allele frequency- G:0.01NS CSA 192
    rs354128951,2
    C--1256545(-) GGGGGC/TTCTGA 2 -- int15Minor allele frequency- T:0.00NS 190
    rs1425319931,2
    --1256561(+) CCTGGC/TCTGAC 2 -- int10--------
    rs1460048511,2
    --1256564(+) GGTCTC/GACCCT 2 -- int10--------
    rs344687581,2
    C,F--1256569(-) GGCAGA/TGGGTC 2 -- int15Minor allele frequency- T:0.01NS 188
    rs28536871,2
    C,F--1256585(-) GTACAC/TGGGGG 2 -- int19Minor allele frequency- T:0.22NS WA NA EA 550
    rs353540891,2
    C,F--1256604(-) AGGCAC/GTGGGT 2 -- int16Minor allele frequency- G:0.00NS NA 188
    rs342409341,2
    C,F--1256652(-) TACACG/AGGGGG 2 -- int16Minor allele frequency- A:0.03NS WA 304
    rs1838724141,2
    --1256653(+) CCCCCA/GTGTAC 2 -- int10--------
    rs1508105751,2
    --1256672(+) ACCCAC/GTGCCT 2 -- int10--------
    rs1392493031,2
    --1256690(+) CCATGC/TACCTG 2 -- int10--------
    rs352955421,2
    C,F--1256809(-) GCTAAA/GTGGGG 2 -- int15Minor allele frequency- G:0.00NS 184
    rs349277741,2
    C,F--1256906(-) GTTTCC/TCTCCT 2 -- int15Minor allele frequency- T:0.00NS 186
    rs340445861,2
    C,F--1257024(-) GGCTCG/AGCCTT 2 -- int16Minor allele frequency- A:0.09NS WA 306
    rs1152208531,2
    --1257035(+) CCAGCA/GGATTT 2 -- int10--------
    rs361155941,2
    C,F--1257175(-) GGCACG/ATGGAA 2 -- int15Minor allele frequency- A:0.00NS 186
    rs361075451,2
    C,F--1257183(-) CAGAGT/CCAGGC 2 -- int18Minor allele frequency- C:0.04NS CSA WA 308
    rs1931114401,2
    --1257208(+) CCGTGA/GCCCAT 2 -- int10--------
    rs350829321,2
    C,F--1257215(-) AGATGC/TGATGG 2 -- int15Minor allele frequency- T:0.01NS 184
    rs1835388251,2
    --1257240(+) CTACCA/CAATCA 2 -- int10--------
    rs350411951,2
    C,F--1257288(-) AGGGCG/AGCTGA 2 -- int18Minor allele frequency- A:0.10NS NA EA 418
    rs357384321,2
    C,F--1257335(-) GGGTCT/CCTAGC 2 -- int17Minor allele frequency- C:0.04NS CSA WA 300
    rs1447868651,2
    --1257478(+) AAGCAC/TGCCAG 2 -- int10--------
    rs1135513281,2
    F--1257564(+) TTTCCA/G/TGAAAG 2 -- int11CSA 2
    rs344390461,2
    C,F--1257587(-) CCCTCG/ATGCAA 2 -- int17Minor allele frequency- A:0.02NS CSA WA 303
    rs27361221,2
    C,F,H--1257621(-) TCCCTC/TGTTTG 2 -- int136Minor allele frequency- T:0.21NA NS EA WA 3507
    rs1875940541,2
    --1257643(+) AGAGAC/GAGAAG 2 -- int10--------
    rs1438155381,2
    --1257676(+) CCGGAC/TGCACC 2 -- int10--------
    rs1162096371,2
    F--1257804(+) CATTTT/ACATGG 2 -- int11Minor allele frequency- A:0.05WA 118
    rs351677231,2
    C,F--1257813(-) AAGGTC/GGTACC 2 -- int16Minor allele frequency- G:0.02NS WA 298
    rs1917065511,2
    --1257889(+) TCAAGC/TGTGCA 2 -- int10--------
    rs344527281,2
    F--1257904(-) CTGCGC/TGAATT 2 -- int15Minor allele frequency- T:0.01NS 186
    rs345996101,2
    C,F--1257905(-) GCTGCG/ACGAAT 2 -- int17Minor allele frequency- A:0.05NS CSA WA 306
    rs1842991241,2
    --1257953(+) CAGCCC/TTCATG 2 -- int10--------
    rs1882440891,2
    C--1258064(+) GCCCCA/GAGGCT 2 -- int10--------
    rs1928070941,2
    --1258184(+) CCAGCC/GAGGAC 2 -- int10--------
    rs1843622111,2
    --1258208(+) GGAGCA/TCAGCC 2 -- int10--------
    rs356892901,2
    C,F--1258231(-) GCCAGC/GACCTG 2 -- int15Minor allele frequency- G:0.01NS 184
    rs1118086351,2
    F--1258235(+) TGCTGG/ACCGGG 2 -- int11Minor allele frequency- A:0.50CSA 2
    rs1821735321,2
    --1258313(+) ACCTCA/GGCCCT 2 -- int10--------
    rs1400477851,2
    --1258457(+) ATGACA/GTCCCA 2 -- int10--------
    rs358670911,2
    C,F--1258559(-) TCTGT-/GTTCGCG 2 -- int15Minor allele frequency- GT:0.06NS 186
    rs1125194661,2
    C--1258560(+) GCGAA-/AC/CA 
            
    CAGAA
    2 -- int11CSA 2
    rs1868498581,2
    --1258644(+) AGCCCC/TGGGTC 2 -- int10--------
    rs350928661,2
    C,F--1258667(-) CCCTCC/TGCGCT 2 -- int16Minor allele frequency- T:0.02NS EA 308
    rs1114667351,2
    C--1258687(+) GCTGGG/ACCTGC 2 -- int11Minor allele frequency- A:0.50CSA 2
    rs1452701951,2
    C--1258803(+) GAAACA/GGTAGA 2 -- int10--------
    rs1379192281,2
    C--1258907(+) TTCCCA/GGTGAA 2 -- int10--------
    rs1434874281,2
    --1258968(+) GACTC-/TGTGTCA 2 -- int10--------
    rs353004121,2
    C,F--1258974(-) GCAGAT/CGACAC 2 -- int18Minor allele frequency- C:0.03NS NA CSA WA 288
    rs1890399971,2
    --1259096(+) GGATGC/TCCACA 2 -- int10--------
    rs131656301,2
    A--1259108(+) GAGAGA/GGGGAG 2 -- int1 trp30--------
    rs602057701,2
    C--1259225(+) CGGACA/GCCCAC 2 -- int10--------
    rs1139693931,2
    F--1259358(+) GGAGAG/TGGAGT 2 -- int12Minor allele frequency- T:0.50CSA 4
    rs1811729291,2
    --1259444(+) AGAGGA/GAGTGG 2 -- int10--------
    rs1856649721,2
    --1259482(+) CAGACA/GCAGAT 2 -- int10--------
    rs1447043781,2
    C--1259489(+) AGATGC/TCCACA 2 -- int10--------
    rs1901278241,2
    --1259762(+) AGAGAA/GGGAGT 2 -- int10--------
    rs1826575251,2
    --1259860(+) GGACGC/TGGATG 2 -- int10--------
    rs1860174971,2
    --1259895(+) CAGACA/GCCCAC 2 -- int10--------
    rs1493085741,2
    C--1259963(+) CAGGAA/GGGGGG 2 -- int10--------
    rs285762701,2
    C,F--1260033(+) GTGGAT/CGCGGA 2 -- int12Minor allele frequency- C:0.21CSA WA 119
    rs1921751241,2
    --1260036(+) GATGCA/GGATGC 2 -- int10--------
    rs27361181,2
    C,F,H--1260195(-) ACAGGA/GTGAGA 2 -- int125Minor allele frequency- G:0.32NS EA NA WA CSA 2519
    rs1840187861,2
    --1260242(+) AACACA/GAGGAC 2 -- int10--------
    rs340189701,2
    C,F--1260331(-) CGTGCA/GCAGTC 2 -- int18Minor allele frequency- G:0.04NS CSA WA 306
    rs1484825731,2
    --1260335(+) GTGCAC/TGAACA 2 -- int10--------
    rs1438043911,2
    --1260364(+) GCATTC/TGCATG 2 -- int10--------
    rs342380501,2
    C,F--1260449(-) ACACGT/CGAGCA 2 -- int17Minor allele frequency- C:0.04NS CSA WA 306
    rs346936151,2
    C,F--1260450(-) TACACG/ATGAGC 2 -- int15Minor allele frequency- A:0.01NS 186
    rs357034551,2
    C,F--1260461(-) ATGTAC/TGCATA 2 -- int18Minor allele frequency- T:0.04NS CSA WA 308
    rs357357381,2
    C--1260513(-) GTGCGC/TGCGTG 2 -- int15Minor allele frequency- T:0.01NS 186
    rs353119941,2
    C,F--1260514(-) TGTGCG/ACGCGT 2 -- int15Minor allele frequency- A:0.01NS 186
    rs773392711,2
    C--1260539(+) CTTGCG/ACACAC 2 -- int12Minor allele frequency- A:0.00NA EU 713
    rs2016897701,2
    --1260613(+) CTGTGA/GCACTT 4 C syn10--------
    rs1446977901,2
    C--1260675(+) GCCGCA/GGTTGA 4 R C mis10--------
    rs340628851,2,4
    C,F--1260715(-) CTCAGC/ATATGC 4 /R /S mis12Minor allele frequency- A:0.40NA 10
    rs356059071,2
    C,F--1260837(-) TGCAGC/TGCATG 2 -- int18Minor allele frequency- T:0.04NS CSA WA 310
    rs345557891,2
    C,F--1260846(-) CCCTCG/AGGCTG 2 -- int15Minor allele frequency- A:0.00NS 188
    rs355500961,2
    C,F--1260877(-) CATTTG/TGAGTC 2 -- int17Minor allele frequency- T:0.04NS CSA WA 308
    rs340261531,2
    C,F--1260957(-) CGTGCG/AAGGTT 2 -- int15Minor allele frequency- A:0.02NS 188
    rs360490211,2
    C,F--1260961(-) CGGCCG/ATGCGA 2 -- int17Minor allele frequency- A:0.04NS CSA WA 308
    rs356214721,2
    C--1260982(-) CAGATG/CATGAG 2 -- int15Minor allele frequency- C:0.01NS 188
    rs1118540381,2
    F--1261035(+) AAACTG/CTGGAG 2 -- int11Minor allele frequency- C:0.50CSA 2
    rs340417361,2
    C,F--1261051(-) CGCCCG/AGGAGC 2 -- int15Minor allele frequency- A:0.01NS 188
    rs111337151,2
    C,F,A,H--1261052(+) CTCCCG/AGGCGT 2 -- int114Minor allele frequency- A:0.23NS NA WA CSA EA 558
    rs1869838181,2
    --1261115(+) TGGGCA/GTGGGG 2 -- int10--------
    rs1927246251,2
    C--1261208(+) CATGGC/TGTCTC 2 -- int10--------
    rs360773951,2
    C,F,H--1261220(-) CCTGCC/TCCTCT 2 -- int18Minor allele frequency- T:0.02NS NA 710
    rs345246511,2
    C,F--1261317(-) CTGCCG/ATGGAT 2 -- int15Minor allele frequency- A:0.00NS 188
    rs340607261,2
    C,F--1261460(-) CTAAGG/CAGATA 2 -- int18Minor allele frequency- C:0.04NS CSA WA 310
    rs1453933161,2
    C--1261479(+) TTGGGC/TAGGTT 2 -- int10--------
    rs1492233571,2
    --1261501(+) GTGGCA/CAGTCC 2 -- int10--------
    rs1451823861,2
    --1261540(+) TAAGAC/TCCGTG 2 -- int10--------
    rs1843062661,2
    --1261666(+) GCTGGC/TTCTTG 2 -- int10--------
    rs354120241,2
    C,F--1261749(-) GACCCA/GTCCCT 2 -- int18Minor allele frequency- G:0.04NS CSA WA 310
    rs348539031,2
    C,F--1261803(-) CTTGGG/AAAGGT 2 -- int15Minor allele frequency- A:0.00NS 188
    rs1464162451,2
    --1261853(+) CAACAC/TGACCT 2 -- int10--------
    rs339874551,2
    C,F--1261866(+) GGCTCC/TGGCTC 2 -- int19Minor allele frequency- T:0.02NA NS 314
    rs351226681,2
    C,F--1262002(-) GGAAAG/AGCTCC 2 -- int15Minor allele frequency- A:0.00NS 188
    rs340749351,2
    C,F--1262404(-) GCACAG/ACTGAT 2 -- int17Minor allele frequency- A:0.04NS CSA WA 306
    rs1446659041,2
    --1262452(+) CTTCCA/GTTTTG 2 -- int10--------
    rs348649191,2
    C,F--1262492(-) TGGTAG/AAATGT 2 -- int16Minor allele frequency- A:0.01NS EA 304
    rs346531671,2
    C,F--1262667(-) TGGTTC/TGCCAT 2 -- int17Minor allele frequency- T:0.04NS CSA WA 302
    rs347141501,2
    C,F--1263016(-) CTCTTC/TGCCTC 2 -- int16Minor allele frequency- T:0.02NS EA 296
    rs349090021,2
    C,F--1263042(-) TTCCAC/GATTTC 2 -- int18Minor allele frequency- G:0.04NS CSA WA 298
    rs361196741,2
    C,F--1263053(-) GTCTGC/AATGAT 2 -- int17Minor allele frequency- A:0.04NS CSA WA 294
    rs1482229571,2
    --1263077(+) GCCAGG/TACCAG 2 -- int10--------
    rs1412320551,2
    --1263130(+) AGACCA/GGCATC 2 -- int10--------
    rs1503553151,2
    --1263258(+) TCCACA/TCCTGC 2 -- int10--------
    rs1932310001,2
    --1263305(+) GAAAGA/GGGCAA 2 -- int10--------
    rs352281871,2
    C,F--1263322(-) CAGTCC/GAGATC 2 -- int17Minor allele frequency- G:0.04NS CSA WA 307
    rs360775241,2
    F--1263339(-) CTGTCG/ATTCTG 2 -- int15Minor allele frequency- A:0.01NS 188
    rs27361161,2
    H--1263378(-) TGGTGG/AATGGT 2 -- int15Minor allele frequency- A:0.00NS EA NA 481
    rs345290951,2
    C,F--1263408(-) AAGGCA/GCACCT 2 -- int16Minor allele frequency- G:0.03NS NA 308
    rs1848164911,2
    --1263454(+) CAGCAC/TCAGTA 2 -- int10--------
    rs356175241,2
    C,F--1263471(-) TGTCCT/CTCGAT 2 -- int16Minor allele frequency- C:0.04NS WA 306
    rs359993281,2
    C,F--1263477(-) TTATTC/TTGTCC 2 -- int16Minor allele frequency- T:0.04NS WA 296
    rs348955171,2
    F--1263587(-) GAGCCG/AAGATC 2 -- int15Minor allele frequency- A:0.01NS 184
    rs342896111,2
    C,F--1263650(-) TCCCCG/ACTATG 2 -- int16Minor allele frequency- A:0.02NS WA 300
    rs1380684231,2
    C--1263699(+) TTTTTA/TAAGTA 2 -- int10--------
    rs1889295611,2
    --1263833(+) TTGATA/GCTTTT 2 -- int10--------
    rs1813765461,2
    --1263911(+) TGAGAC/TGGGGC 2 -- int10--------
    rs352094541,2
    C,F--1263987(-) GGGGAC/TAGGGC 2 -- int15Minor allele frequency- T:0.01NS 188
    rs1437135401,2
    --1264006(+) CACACA/GTGATC 2 -- int10--------
    rs27361151,2
    C,F,A,H--1264068(-) TCTCCG/ACTGTG 2 -- int110Minor allele frequency- A:0.22NS NA WA EA 548
    rs345551011,2
    F--1264105(-) AACCCGAGACCCTGGGGCCCTGCTGG
    GCGTGAGTCTCTCCGAACCC
    /-
    AGAGA
    2 -- int15Minor allele frequency- -:0.03NS 188
    rs1472256071,2
    --1264121(+) GACTCA/GCGCCC 2 -- int10--------
    rs1143830371,2
    F--1264138(+) GCCCCA/TGGGTC 2 -- int11Minor allele frequency- T:0.11WA 118
    rs1407089731,2
    --1264140(+) CCCAGG/TGTCTC 2 -- int10--------
    rs1430418691,2
    --1264143(+) AGGGTC/TTCGGG 2 -- int10--------
    rs28536851,2
    C,F--1264152(-) CCCTCT/CGAACC 2 -- int113Minor allele frequency- C:0.31NS NA CSA WA EA 545
    rs1447089921,2
    --1264156(+) CAGAGA/GGACTC 2 -- int10--------
    rs1126070931,2
    F--1264163(+) ACTCAT/CGCCCA 2 -- int12Minor allele frequency- C:0.10CSA WA 119
    rs340572681,2
    --1264218(+) GGGCCC/TGGGCG 2 -- int10--------
    rs579100421,2
    C--1264218(+) GGGCCC/TGGGCG 2 -- int11Minor allele frequency- T:0.50WA 2
    rs346560591,2
    C,F--1264290(-) AAAAGG/AAAATG 2 -- int16Minor allele frequency- A:0.01NS WA 296
    rs1897088741,2
    --1264388(+) GGGGCA/GCCCTG 2 -- int10--------
    rs344581821,2
    C--1264483(-) TGCCCG/AGCTGG 2 -- int15Minor allele frequency- A:0.01NS 166
    rs1997414931,2
    --1264549(+) GGGTCC/TGGGTA 3 Q R mis1 int10--------
    rs2013228721,2
    --1264560(+) TCCAGA/CAGCAG 3 L syn1 int10--------
    rs345281191,2
    C,F--1264587(-) GCCCAC/TGGCCT 3 H syn1 int12Minor allele frequency- T:0.01NA EU 1387
    rs2001749901,2
    C--1264593(+) TGGGCC/TGGCAT 3 P syn1 int10--------
    rs2020332691,2
    --1264618(+) TGCCAC/TCCAGG 3 D G mis1 int10--------
    rs3739524211,2
    C--1264674(+) ACCACA/GCAGCC 3 C syn1 int10--------
    rs3717447681,2
    C--1264739(+) CAGGAC/TGCGGG 2 -- int10--------
    rs1131928431,2
    C,F--1264899(+) CTCCCG/AGGCAG 2 -- int12Minor allele frequency- A:0.07CSA WA 120
    rs1485402761,2
    --1265054(+) GGTCCA/GGGGCA 2 -- int10--------
    rs1429072621,2
    --1265118(+) CTCAAC/TGACTT 2 -- int10--------
    rs27361141,2
    C,F,A,H--1265204(-) GTCCCA/GCGCCT 2 -- int124Minor allele frequency- N:0.00EA NA NS WA CSA 2542
    rs1162932241,2
    C,F--1265216(+) TGGCTG/AGGCTG 2 -- int11Minor allele frequency- A:0.06WA 118
    rs27361131,2
    C,F,A,H--1265373(-) GGGGCC/TACAGC 2 -- int18Minor allele frequency- T:0.22NA WA EA 496
    rs1127736971,2
    C,F--1265425(+) CGGCCA/GGCTGC 2 -- int12Minor allele frequency- G:0.07CSA WA 119
    rs1146933351,2
    C,F--1265489(+) GGCTGC/TCGACT 2 -- int11Minor allele frequency- T:0.02WA 118
    rs77303031,2
    C,F,H--1265664(+) GCTCCC/TCCCGA 2 -- int115Minor allele frequency- T:0.13NS CSA WA 1570
    rs1422682941,2
    C--1265760(+) GCGGC-/CCTGG 
    AGGGTGGA
    CCTGG
    2 -- int10--------
    rs348643371,2
    C,F--1265853(-) TGGCCG/ACCAGG 2 -- int15Minor allele frequency- A:0.03NS 154
    rs1813601911,2
    --1265890(+) TTTCAA/GGGTTT 2 -- int10--------
    rs1860062061,2
    --1265906(+) CCCTCA/GTCAAA 2 -- int10--------
    rs27361111,2
    C,F,H--1265935(-) AGAGCC/TGGTGG 2 -- int19Minor allele frequency- T:0.22NS NA WA EA 546
    rs1138028451,2
    F--1265936(+) CACCGG/CCTCTG 2 -- int11Minor allele frequency- C:0.50CSA 2
    rs1823642441,2
    --1266061(+) TCTCCA/GTGGTT 2 -- int10--------
    rs1126015871,2
    C--1266130(+) AGGAAC/TGTGAC 2 -- int11Minor allele frequency- T:0.50CSA 2
    rs348237601,2
    C,F--1266141(-) CGTTCG/ACTGCG 2 -- int17Minor allele frequency- A:0.04NS CSA WA 310
    rs1123582001,2
    C--1266145(+) GCGAAC/TGCTGT 2 -- int11Minor allele frequency- T:0.50CSA 2
    rs92828691,2
    F--1266223(-) GCRGGG/ACCGAG 2 -- int15Minor allele frequency- A:0.01MN 404
    rs28536841,2
    C,F,A,H--1266226(-) CCTGCA/GGGGCC 2 -- int123Minor allele frequency- G:0.25MN NS NA WA CSA EA 2069
    rs20757861,2
    C,F,A,H--1266310(-) TGACCC/TGGCTC 2 -- int129Minor allele frequency- N:0.00EA MN NA NS WA CSA 2862
    rs360700591,2
    C,F--1266425(-) TGGCCG/ATGCAC 2 -- int15Minor allele frequency- A:0.01NS 188
    rs1910391571,2
    --1266453(+) GGATCC/TAGCAC 2 -- int10--------
    rs2011591971,2
    --1266634(+) ATCCAA/C/TCAAAC 4 M V mis10--------
    rs1114368181,2
    C--1266653(+) AGCCTA/GAAATA 2 -- int10--------
    rs1828771461,2
    --1266770(+) CAAAGC/TGGTTA 2 -- int10--------
    rs1875727511,2
    --1266771(+) AAAGCA/GGTTAA 2 -- int10--------
    rs1913103631,2
    --1266806(+) ACAGAC/GGAGCT 2 -- int10--------
    rs1468911301,2
    --1266901(+) GAAGAC/TGAACG 2 -- int10--------
    rs1831152281,2
    --1266921(+) AGGCGC/TGGCCC 2 -- int10--------
    rs1114697521,2
    C,F--1266929(+) CCCCAC/GTTCTC 2 -- int12Minor allele frequency- G:0.05CSA WA 120
    rs359711391,2
    F--1267059(-) GGATCT/CGGGTC 2 -- int15Minor allele frequency- C:0.01NS 188
    rs38910541,2
    C,F,A--1267202(-) TCTGGG/CATTTG 2 -- int116Minor allele frequency- C:0.14NA NS CSA WA EA 683
    rs341944911,2
    C,F--1267213(-) ACACAA/GCTTGC 2 -- int16Minor allele frequency- G:0.01NS NA 306
    rs1877996651,2
    C--1267337(+) AAGATA/GCACAG 2 -- int10--------
    rs1407595601,2
    --1267352(+) AACCCA/GGAGTC 2 -- int10--------
    rs42467421,2
    C,F,A,H--1267356(-) CGAAGA/TCTCCG 2 -- int136Minor allele frequency- T:0.28EA NA NS WA CSA 3475
    rs1925153871,2
    --1267458(+) TGCTGC/TCCACA 2 -- int10--------
    rs119563301,2
    C,F,H--1267497(+) ctgttG/Agtggg 2 -- int16Minor allele frequency- A:0.02NA NS 186
    rs353597681,2
    C,F--1267659(-) CCGCAA/GTAAAC 2 -- int15Minor allele frequency- G:0.01NS 178
    rs1488545391,2
    C--1267676(+) TCACAA/GTAGCA 2 -- int10--------
    rs1435159661,2
    --1267690(+) ACTTGC/GAACCA 2 -- int10--------
    rs344767481,2
    C,F--1267736(-) GTGCCA/CCATTT 2 -- int15Minor allele frequency- C:0.00NS 176
    rs1875687691,2
    --1267743(+) GCACAC/TATACA 2 -- int10--------
    rs357066851,2
    C,F--1267747(-) GTGGTG/CTATAT 2 -- int15Minor allele frequency- C:0.01NS 176
    rs1112981571,2
    C--1267753(+) ACCACG/AGAATA 2 -- int11Minor allele frequency- A:0.50CSA 2
    rs358120741,2
    C,F--1267881(-) CACCTG/CTGAGT 2 -- int15Minor allele frequency- C:0.02NS 162
    rs1422138011,2
    --1267973(+) AGGGAC/TAGCAT 2 -- int10--------
    rs1842492831,2
    --1268064(+) TGCACA/GTCGTG 2 -- int10--------
    rs1901105871,2
    --1268066(+) CACGTC/TGTGCA 2 -- int10--------
    rs1461301011,2
    --1268076(+) ACATGC/TACCCT 2 -- int10--------
    rs1389356741,2
    --1268081(+) TACCCC/TAGAAC 2 -- int10--------
    rs1812470691,2
    C--1268159(+) TGGCAA/C/TGATAT 2 -- int10--------
    rs1849456801,2
    --1268193(+) TAGACA/CCCATG 2 -- int