Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

TDP1 Gene

protein-coding   GIFtS: 63
GCID: GC14P090422

tyrosyl-DNA phosphodiesterase 1

 Explore 20 diseases affiliated with
TDP1 via our new
 Human Malady Compendium 
Biological research products
for TDP1
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Tyrosyl-DNA Phosphodiesterase 11 2
Tyr-DNA Phosphodiesterase 12 3
FLJ110901
SCAN11
EC 3.1.4.-3
EC 3.1.48

External Ids:    HGNC: 188841   Entrez Gene: 557752   Ensembl: ENSG000000420887   OMIM: 6071985   UniProtKB: Q9NUW83   

Export aliases for TDP1 gene to outside databases

Previous GC identifers: GC14P087927 GC14P084237 GC14P088411 GC14P088412 GC14P089492 GC14P070596


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for TDP1:
The protein encoded by this gene is involved in repairing stalled topoisomerase I-DNA complexes by catalyzing the
hydrolysis of the phosphodiester bond between the tyrosine residue of topoisomerase I and the 3-prime phosphate of
DNA. This protein may also remove glycolate from single-stranded DNA containing 3-prime phosphoglycolate, suggesting a
role in repair of free-radical mediated DNA double-strand breaks. This gene is a member of the phospholipase D family
and contains two PLD phosphodiesterase domains. Mutations in this gene are associated with the disease spinocerebellar
ataxia with axonal neuropathy (SCAN1). While several transcript variants may exist for this gene, the full-length
natures of only two have been described to date. These two represent the major variants of this gene and encode the
same isoform. (provided by RefSeq, Jul 2008)

UniProtKB/Swiss-Prot: TYDP1_HUMAN, Q9NUW8
Function: DNA repair enzyme that can remove a variety of covalent adducts from DNA through hydrolysis of a
3'-phosphodiester bond, giving rise to DNA with a free 3' phosphate. Catalyzes the hydrolysis of dead-end complexes
between DNA and the topoisomerase I active site tyrosine residue. Hydrolyzes 3'-phosphoglycolates on protruding 3'
ends on DNA double-strand breaks due to DNA damage by radiation and free radicals. Acts on blunt-ended double-strand
DNA breaks and on single-stranded DNA. Has low 3'exonuclease activity and can remove a single nucleoside from the
3'end of DNA and RNA molecules with 3'hydroxyl groups. Has no exonuclease activity towards DNA or RNA with a
3'phosphate

Gene Wiki entry for TDP1


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000014.8  NC_018925.1  NT_026437.12  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the TDP1 gene promoter:
         AML1a   HSF1 (long)   MyoD   CUTL1   Nkx2-5   CBF-C   CBF-A   HSF1short   CBF(2)   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): TDP1 promoter sequence
   Search SABiosciences Chromatin IP Primers for TDP1

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TDP1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 14q32.11   Ensembl cytogenetic band:  14q32.11   HGNC cytogenetic band: 14q32.11

TDP1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TDP1 gene location

GeneLoc information about chromosome 14         GeneLoc Exon Structure

GeneLoc location for GC14P090422:  view genomic region     (about GC identifiers)

Start:
90,421,283 bp from pter      End:
90,511,108 bp from pter
Size:
89,826 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: TYDP1_HUMAN, Q9NUW8 (See protein sequence)
Recommended Name: Tyrosyl-DNA phosphodiesterase 1  
Size: 608 amino acids; 68420 Da
Subunit: Monomer
Subcellular location: Nucleus. Cytoplasm
6/12 PDB 3D structures from and Proteopedia for TDP1 (see all 12):
1JY1 (3D)        1MU7 (3D)        1MU9 (3D)        1NOP (3D)        1QZQ (3D)        1RFF (3D)    
Secondary accessions: Q2HXX4 Q96BK7 Q9NZM7 Q9NZM8

Explore the universe of human proteins at neXtProt for TDP1: NX_Q9NUW8

Post-translational modifications:

  • Phosphorylated on serine and/or threonine residues, but not on tyrosine residues1
  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q9NUW8

  • 2 DME Specific Peptides for TDP1 (Q9NUW8)
     FGTHHTKM  PHIKTYMR 

    TDP1 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins (2 alternative transcripts): 
    NP_001008744.1  NP_060789.2  

    ENSEMBL proteins: 
     ENSP00000452042   ENSP00000377098   ENSP00000450872   ENSP00000377099   ENSP00000450708  
     ENSP00000337353   ENSP00000452279   ENSP00000451358   ENSP00000452333   ENSP00000444587  
     ENSP00000452363   ENSP00000452183   ENSP00000450628   ENSP00000451767   ENSP00000450795  
     ENSP00000349952  
    Reactome Protein details: Q9NUW8
    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Proteins (see all 2): TDP1
    OriGene Protein Over-expression Lysate (see all 2): TDP1
    OriGene Custom Protein Services for TDP1 
    GenScript Custom Purified and Recombinant Proteins Services for TDP1
    Novus Biologicals TDP1 Proteins
    Novus Biologicals TDP1 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for TDP1

    Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IEA--
    GO:0005737cytoplasm IDA17948061


    TDP1 for ontologies           About GeneDecksing



    TDP1 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies: TDP1
    OriGene Custom Antibody Services for TDP1 
    GenScript Custom Superior Antibodies Services for TDP1
    Novus Biologicals TDP1 Antibodies
    Search for Antibodies for TDP1 at Abcam  
    Uscn Antibodies for TDP1
    Search ThermoFisher Antibodies for TDP1

    Assay Products for TDP1: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for TDP1
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for TDP1


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TDP1 for domains           About GeneDecksing

    1 InterPro domain/family:
     IPR010347 Tyr-DNA_phospho

    Graphical View of Domain Structure for InterPro Entry Q9NUW8

    ProtoNet protein and cluster: Q9NUW8

    1 Blocks protein family: IPB010347 Tyrosyl-DNA phosphodiesterase

    UniProtKB/Swiss-Prot: TYDP1_HUMAN, Q9NUW8
    Similarity: Belongs to the tyrosyl-DNA phosphodiesterase family


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: TYDP1_HUMAN, Q9NUW8
    Function: DNA repair enzyme that can remove a variety of covalent adducts from DNA through hydrolysis of a
    3'-phosphodiester bond, giving rise to DNA with a free 3' phosphate. Catalyzes the hydrolysis of dead-end complexes
    between DNA and the topoisomerase I active site tyrosine residue. Hydrolyzes 3'-phosphoglycolates on protruding 3'
    ends on DNA double-strand breaks due to DNA damage by radiation and free radicals. Acts on blunt-ended double-strand
    DNA breaks and on single-stranded DNA. Has low 3'exonuclease activity and can remove a single nucleoside from the
    3'end of DNA and RNA molecules with 3'hydroxyl groups. Has no exonuclease activity towards DNA or RNA with a
    3'phosphate
    Biophysicochemical properties: Kinetic parameters: KM=0.08 uM for 14-mer single-stranded oligo with a 3'-
    phosphotyrosine; Note=kcat is 7 sec(-1) with single-stranded 5'-tyrosyl DNA as substrate;

    Enzyme Numbers (IUBMB): EC 3.1.4.-1 EC 3.1.42

    miRNA
    Products:
        
    miRTarBase miRNAs that target TDP1:
    hsa-mir-1 (MIRT002780)

    OriGene 3'-UTR Clone (see all 2): TDP1
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TDP1
    6 QIAGEN miScript miRNA Assays for microRNAs that regulate TDP1:
    hsa-miR-548t hsa-miR-581 hsa-miR-3658 hsa-miR-513a-3p hsa-miR-3653 hsa-miR-548n
    SwitchGear 3'UTR luciferase reporter plasmidTDP1 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TDP1 (see all 7)
    OriGene shRNA RFP: TDP1
    OriGene siRNA: TDP1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TDP1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for TDP1

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TDP1 (see all 5)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TDP1 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 3): TDP1 (NM_001202504)
    Sino Biological Human cDNA Clone for TDP1
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TDP1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TDP1 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for TDP1
    Search LifeMap BioReagents cell lines for TDP1

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TDP1

    Gene Ontology (GO): 5/6 molecular function terms (GO ID links to tree view) (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003690double-stranded DNA binding IDA15811850
    GO:0003697single-stranded DNA binding IDA15811850
    GO:0004527exonuclease activity IEA--
    GO:0005515protein binding IPI15744309
    GO:0008081phosphoric diester hydrolase activity ----


    TDP1 for ontologies           About GeneDecksing


    1 GenomeRNAi human phenotype for TDP1:
     Synthetic lethal with Ras 

    Animal Models:
         4 MGI mutant phenotypes (inferred from 1 allele(MGI details for Tdp1):
     behavior/neurological  cellular  homeostasis/metabolism  nervous system 

    TDP1 for phenotypes           About GeneDecksing


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways  About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Processing of DNA ends prior to end rejoining
    Processing of DNA ends prior to end rejoining1.00
    Nonhomologous End-joining (NHEJ)0.67
    2Homologous Recombination Repair
    Double-Strand Break Repair0.71
    3Nucleotide Excision Repair
    DNA Repair0.46

    Pathway sources
    See GeneCards unified pathways
    Show all pathways


    4        Reactome Pathways for TDP1
        DNA Repair
    Nonhomologous End-joining (NHEJ)
    Double-Strand Break Repair
    Processing of DNA ends prior to end rejoining



    TDP1 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for TDP1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 14)

    5/17 Interacting proteins for TDP1 (Q9NUW82, 3 ENSP000003373534) via UniProtKB, MINT, STRING, and/or I2D (see all 17)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    H2AFXP161042, 3, ENSP000003643104MINT-7543405 MINT-7543888 MINT-7542699 I2D: score=1 STRING: ENSP00000364310
    ATMQ133152, 3, ENSP000002786164MINT-7543535 I2D: score=2 STRING: ENSP00000278616
    XRCC1P188872, 3, ENSP000002628874MINT-7543877 I2D: score=1 STRING: ENSP00000262887
    LIG3P499163, ENSP000003677874I2D: score=3 STRING: ENSP00000367787
    TOP1P113873, ENSP000003545224I2D: score=1 STRING: ENSP00000354522
    About this table

    Gene Ontology (GO): 4 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000012single strand break repair IMP17600775
    GO:0006281DNA repair IDA17948061
    GO:0006302double-strand break repair IDA12023295
    GO:0008219cell death IEA--


    TDP1 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    TDP1 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for TDP1
    7 Novoseek chemical compound relationships for TDP1 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    tdp-1 99.4 298 19883083 (10), 20097655 (9), 16141202 (9), 17576665 (9) (see all 36)
    phosphonate 83.8 10 15333697 (1), 15811850 (1), 12618186 (1), 15494395 (1) (see all 9)
    camptothecin 80 17 15920477 (3), 16935573 (2), 16793421 (1), 16751265 (1) (see all 7)
    phosphodiester 76.7 9 20097655 (2), 14967139 (1), 12470949 (1), 11839309 (1) (see all 8)
    vanadate 57.3 9 14761185 (3), 12618186 (2), 12470949 (2), 19963390 (1)
    tyrosine 39.1 13 14761185 (3), 12618186 (2), 15333697 (1), 15647511 (1) (see all 9)
    oligonucleotide 19.5 3 12618186 (1), 14761185 (1)

    Search CenterWatch for drugs/clinical trials and news about TDP1 / TYDP1 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for TDP1 gene (2 alternative transcripts): 
    NM_001008744.1  NM_018319.3  

    Unigene Cluster for TDP1:

    Tyrosyl-DNA phosphodiesterase 1
    Hs.209945  [show with all ESTs]
    Unigene Representative Sequence: NM_018319
    18 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000554976 ENST00000393452 ENST00000554180 ENST00000393454 ENST00000553617
    ENST00000335725(uc010atm.3 uc001xxy.3 uc001xxz.3 uc010atn.3 uc001xya.3 uc001xyb.3)
    ENST00000555565 ENST00000556867 ENST00000553569 ENST00000553527 ENST00000553989
    ENST00000545686 ENST00000555178 ENST00000556498 ENST00000555880 ENST00000557782
    ENST00000556063(uc001xyd.1) ENST00000357382

    miRNA
    Products:
         
    OriGene 3'-UTR Clone (see all 2): TDP1
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TDP1
    6 QIAGEN miScript miRNA Assays for microRNAs that regulate TDP1:
    hsa-miR-548t hsa-miR-581 hsa-miR-3658 hsa-miR-513a-3p hsa-miR-3653 hsa-miR-548n
    SwitchGear 3'UTR luciferase reporter plasmidTDP1 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TDP1 (see all 7)
    OriGene shRNA RFP: TDP1
    OriGene siRNA: TDP1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TDP1
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TDP1 (see all 5)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TDP1 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 3): TDP1 (NM_001202504)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TDP1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TDP1 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TDP1
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TDP1
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TDP1
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TDP1

    Additional cDNA sequence: 

    AF182002.1 AF182003.1 AK001952.1 AK023514.1 AK093235.1 AK315549.1 AL832288.1 BC006083.1 
    BC015474.1 BC107877.1 BX161451.1 

    17 DOTS entries:

    DT.100792498  DT.212817  DT.100774287  DT.100792501  DT.120784327  DT.91761821  DT.95375417  DT.100792497 
    DT.100737228  DT.100809028  DT.100661909  DT.40277777  DT.100736927  DT.104142  DT.100018747  DT.91761819 
    DT.95141859 

    24/192 AceView cDNA sequences (see all 192):

    BX161451 BX352942 BQ049211 BE613472 CR618058 BC006083 BU185781 AA514317 
    AW849814 BM789444 BQ233509 AA609339 CR602214 AA769506 BX357935 CR622999 
    AK093235 AA620407 AA479654 BX407827 BQ214685 CR605014 BM661793 CR615550 

    GeneLoc Exon Structure

    5/10 Alternative Splicing Database (ASD) splice patterns (SP) for TDP1 (see all 10)    About this scheme

    ExUns: 1 ^ 2a · 2b ^ 3a · 3b ^ 4a · 4b ^ 5 ^ 6a · 6b · 6c ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12a · 12b ^ 13 ^ 14 ^ 15a · 15b ^ 16 ^ 17 ^ 18 ^ 19 ^
    SP1:                    -     -     -           -                       -                                   -     -                       -                     
    SP2:                                            -                       -                                   -                                                   
    SP3:        -     -     -     -     -           -                                                                 -                       -                     
    SP4:                    -     -     -     -     -                       -                                   -     -                       -                     
    SP5:                                            -                       -                                   -     -                       -                     

    ExUns: 20 ^ 21 ^ 22 ^ 23a · 23b ^ 24a · 24b
    SP1:                          -               
    SP2:              -           -               
    SP3:              -           -               
    SP4:              -           -               
    SP5:              -           -               


    ECgene alternative splicing isoforms for TDP1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TDP1 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: GAATCTCTTC

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image
    See TDP1 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for TDP1

    SOURCE GeneReport for Unigene cluster: Hs.209945

    UniProtKB/Swiss-Prot: TYDP1_HUMAN, Q9NUW8
    Tissue specificity: Ubiquitously expressed. Similar expression throughout the central nervous system (whole brain,
    amygdala, caudate nucleus, cerebellum, cerebral cortex, frontal lobe, hippocampus, medulla oblongata, occipital lobe,
    putamen, substantia nigra, temporal lobe, thalamus, nucleus accumbens and spinal cord) and increased expression in
    testis and thymus

        SABiosciences Custom PCR Arrays for TDP1
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TDP1
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TDP1
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TDP1
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TDP1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TDP1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for TDP1 gene from 9/29 species (see all 29)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Tdp11 , 5 tyrosyl-DNA phosphodiesterase 11, 5 81.25(n)1
    81.58(a)1
      12 (50.43 cM)5
    1048841  NM_028354.41  NP_082630.21 
     998845175 
    chicken
    (Gallus gallus)
    Aves TDP11 tyrosyl-DNA phosphodiesterase 1 68.89(n)
    70.22(a)
      423403  XM_421313.3  XP_421313.1 
    lizard
    (Anolis carolinensis)
    Reptilia TDP16
    --
    63(a)
    1 ↔ 1
    1(12789082-12816502)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.168782 Xenopus laevis transcribed sequence with weak similarity more 75.24(n)    BU905625.1 
    zebrafish
    (Danio rerio)
    Actinopterygii tdp11 tyrosyl-DNA phosphodiesterase 1 61.71(n)
    60.17(a)
      571485  XM_695082.4  XP_700174.2 
    fruit fly
    (Drosophila melanogaster)
    Insecta gkt1 glaikit 48.19(n)
    39.78(a)
      33530  NM_078741.3  NP_523465.2 
    worm
    (Caenorhabditis elegans)
    Secernentea F52C12.11 , 3 Protein F52C12.11 34(a)3
    46.85(n)1
    38.57(a)1
      IV(1959862-1963128)3
    1769961  NM_067748.31  NP_500149.11 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons TDP11 tyrosyl-DNA phosphodiesterase 1 48.88(n)
    39.96(a)
      831369  NM_121521.3  NP_197021.2 
    rice
    (Oryza sativa)
    Liliopsida Os.99872 Oryza sativa (japonica cultivar-group) cDNA cloneJ more 70.69(n)    AK069279.1 


    ENSEMBL Gene Tree for TDP1 (if available)
    TreeFam Gene Tree for TDP1 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/1783 NCBI SNPs in TDP1 are shown (see all 1783    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 14 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs345765331,2
    C,--70594327(+) TTTATT/CACTAG 2 -- us2k15Minor allele frequency- C:0.00NS 188
    rs344957171,2
    C,--70594578(+) GTGAGG/ACAAAG 2 -- us2k15Minor allele frequency- A:0.00NS 188
    rs355115291,2
    C,--70594610(+) AGAGAT/CGCAGA 2 -- us2k15Minor allele frequency- C:0.00NS 188
    rs118487121,2
    C,F,H,--70596090(+) ACCCGG/ACGGGC 2 -- us2k111Minor allele frequency- A:0.10NA NS WA 314
    rs1134925061,2
    C,--70596094(+) GGCGGG/TCTTTA 2 -- us2k12Minor allele frequency- T:0.04NA WA 120
    rs22775201,2
    C,F,H,--70596110(-) GCCCAC/ACGCTG 2 -- us2k16Minor allele frequency- A:0.02EA NS 2040
    rs360843731,2
    F--70596117(+) GGGCT-/TTAGGACCC
    AGCGGTGGGCT
    CTCCG
    2 -- us2k15Minor allele frequency- TTAGGACCCAGCGGTGGGCT:0.06NS 186
    rs22775191,2
    C,F,--70596140(-) TCGAGG/ACCCGG 2 -- us2k18Minor allele frequency- A:0.06NS NA WA 308
    rs352107681,2
    F--70596200(+) CGCCG-/CCGAAGGG 2 -- ut515Minor allele frequency- CCG:0.15NS 186
    rs343357111,2
    C,F,--70596255(+) TTGGGC/AGGCAG 2 -- int15Minor allele frequency- A:0.01NS 186

    HapMap Linkage Disequilibrium report for TDP1 (90421283 - 90511108 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 1 variation for TDP1
         1 CNV: 4844
    Human Gene Mutation Database (HGMD): TDP1

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing TDP1
    DNA2.0 Custom Variant and Variant Library Synthesis for TDP1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TDP1 for disorders           About GeneDecksing

    OMIM gene information: 607198   
    OMIM disorders: 607250  
    UniProtKB/Swiss-Prot: TYDP1_HUMAN, Q9NUW8
  • Defects in TDP1 are the cause of spinocerebellar ataxia autosomal recessive with axonal neuropathy (SCAN1)
  • [MIM:607250]. SCAN1 is an autosomal recessive cerebellar ataxia (ARCA) associated with peripheral axonal motor and
    sensory neuropathy, distal muscular atrophy, pes cavus and steppage gait as seen in Charcot-Marie-Tooth neuropathy.
    All affected individuals have normal intelligence

    20 diseases for TDP1:    About MalaCards
    axonal neuropathy    spinocerebellar ataxia    spinocerebellar ataxia with axonal neuropathy, autosomal recessive    charcot-marie-tooth neuropathy
    ataxia    neuropathy    dna topoisomerase i    spinocerebellar degeneration
    ollier disease    cerebellar ataxia    ataxia telangiectasia    muscular atrophy
    neurodegenerative disease    hereditary ataxia    colon carcinoma    neurodegeneration
    meningioma    lung cancer    cerebritis    carcinoma

    3 diseases from the University of Copenhagen DISEASES database for TDP1:
    Axonal neuropathy     Spinocerebellar ataxia     Ollier disease

    6 Novoseek disease relationships for TDP1 gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    scan1 98.9 25 17600775 (4), 15920477 (4), 15647511 (3), 15744309 (3) (see all 7)
    spinocerebellar ataxias 87.3 17 16141202 (2), 16793421 (1), 17600775 (1), 20009512 (1) (see all 11)
    spinocerebellar degenerations 78.3 5 16793421 (1), 20009512 (1), 15920477 (1), 18473723 (1)
    neurodegenerative diseases 43.4 5 15744309 (1), 17045754 (1), 16141202 (1), 19794497 (1)
    cancer 2.73 2 19883083 (1), 15494395 (1)
    tumors 0 1 15379698 (1)

    GeneTests: TDP1
    Spinocerebellar Ataxia with Axonal Neuropathy, Autosomal Recessive

    Human Genome Epidemiology (HuGE) Navigator: TDP1 (3 documents)

    Export disorders for TDP1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for TDP1 gene, integrated from 9 sources (see all 69):
    (articles sorted by number of sources associating them with TDP1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. The crystal structure of human tyrosyl-DNA phosphodiesterase, Tdp1. (PubMed id 11839309)1, 2, 3, 9 Davies D.R.... Hol W.G.J. (2002)
    2. Mutation of TDP1, encoding a topoisomerase I-dependent DNA damage repair enzyme, in spinocerebellar ataxia with axonal neuropathy. (PubMed id 12244316)1, 2, 3 Takashima H.... Lupski J.R. (2002)
    3. Human Tdp1 cleaves a broad spectrum of substrates, including phosphoamide linkages. (PubMed id 16141202)1, 2, 9 Interthal H.... Champoux J.J. (2005)
    4. Substrate specificity of tyrosyl-DNA phosphodiesterase I (Tdp1). (PubMed id 15811850)1, 2, 9 Raymond A.C.... Burgin A.B. Jr. (2005)
    5. SCAN1 mutant Tdp1 accumulates the enzyme--DNA intermediate and causes camptothecin hypersensitivity. (PubMed id 15920477)1, 2, 9 Interthal H....Champoux J.J. (2005)
    6. Deficiency in 3'-phosphoglycolate processing in human cells with a hereditary mutation in tyrosyl-DNA phosphodiesterase (TDP1). (PubMed id 15647511)1, 2, 9 Zhou T....Povirk L.F. (2005)
    7. Insights into substrate binding and catalytic mechanism of human tyrosyl-DNA phosphodiesterase (Tdp1) from vanadate and tungstate- inhibited structures. (PubMed id 12470949)1, 2, 9 Davies D.R.... Hol W.G.J. (2002)
    8. Explorations of peptide and oligonucleotide binding sites of tyrosyl-DNA phosphodiesterase using vanadate complexes. (PubMed id 14761185)1, 2, 9 Davies D.R....Hol W.G. (2004)
    9. Crystal structure of a transition state mimic for TDP1 assembled from vanadate, DNA, and a topoisomerase I-derived peptide. (PubMed id 12618186)1, 2, 9 Davies D.R.... Hol W.G.J. (2003)
    10. Analysis of human tyrosyl-DNA phosphodiesterase I catalytic residues. (PubMed id 15111055)1, 2, 9 Raymond A.C.... Burgin A.B. Jr. (2004)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 55775 HGNC: 18884 AceView: TDP1 Ensembl:ENSG00000042088 euGenes: HUgn55775
    ECgene: TDP1 H-InvDB: TDP1

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for TDP1 Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for TDP1 Genetics and Cytogenetics in Oncology and Haematology
    NIEHS-SNPshttp://egp.gs.washington.edu/data/tdp1/

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for TDP1 gene:
    Search GeneIP for patents involving TDP1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     OriGene Antibodies for TDP1   OriGene shRNA RFP for TDP1  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for TDP1   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for TDP1  
     OriGene Protein Over-expression Lysate for TDP1   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for TDP1   OriGene 3'-UTR Clone for TDP1  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for TDP1   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for TDP1  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for TDP1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for TDP1   OriGene Custom Protein Services for TDP1  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat TDP1
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing TDP1
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TDP1
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TDP1
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TDP1
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TDP1
     GenScript Custom Purified and Recombinant Proteins Services for TDP1 GenScript cDNA clones with any tag delivered in your preferred vector for TDP1
     GenScript Custom Assay Services for TDP1 GenScript Custom Superior Antibodies Services for TDP1
     GenScript Custom overexpressing Cell Line Services for TDP1 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in TDP1 promoter
     Search Chromatin IP Primers for TDP1
     RT2 qPCR Primer Assay in human, mouse, rat TDP1
     GNC Network for TDP1
     SABiosciences Custom PCR Arrays for TDP1
     Search Tocris compounds for TDP1
     Browse Sino Biological Proteins and Antibodies
     cDNA Clones for TDP1
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     TDP1 antibodies
     TDP1 proteins
     TDP1 lysates
     Search for Antibodies for TDP1 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for TDP1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     TDP1 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for TDP1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TDP1
     SwitchGear 3'UTR luciferase reporter plasmids for TDP1
     SwitchGear Promoter luciferase reporter plasmids for TDP1
     Search ThermoFisher Antibodies for TDP1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TDP1
           
    GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      TDP1 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4