Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TBX1 Gene

Aliases for TBX1 Gene

  • T-Box 1 2 3 5
  • Testis-Specific T-Box Protein 3 4
  • T-Box Transcription Factor TBX1 3
  • T-Box 1 Transcription Factor C 3
  • Velocardiofacial Syndrome 2
  • T-Box Protein 1 4
  • Brachyury 3
  • CATCH22 3
  • TBX1C 3
  • DORV 3
  • CTHM 3
  • CAFS 3
  • DGCR 3
  • VCFS 3
  • DGS 3
  • VCF 3
  • TGA 3

External Ids for TBX1 Gene

Previous HGNC Symbols for TBX1 Gene

  • VCF

Previous GeneCards Identifiers for TBX1 Gene

  • GC22P016684
  • GC22P018118
  • GC22P003364

Summaries for TBX1 Gene

Entrez Gene Summary for TBX1 Gene

  • This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene product shares 98% amino acid sequence identity with the mouse ortholog. DiGeorge syndrome (DGS)/velocardiofacial syndrome (VCFS), a common congenital disorder characterized by neural-crest-related developmental defects, has been associated with deletions of chromosome 22q11.2, where this gene has been mapped. Studies using mouse models of DiGeorge syndrome suggest a major role for this gene in the molecular etiology of DGS/VCFS. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

GeneCards Summary for TBX1 Gene

TBX1 (T-Box 1) is a Protein Coding gene. Diseases associated with TBX1 include Velocardiofacial Syndrome and Digeorge Syndrome. Among its related pathways are Mesodermal Commitment Pathway and FTO Obesity Variant Mechanism. GO annotations related to this gene include transcription factor activity, sequence-specific DNA binding and sequence-specific DNA binding. An important paralog of this gene is TBX10.

UniProtKB/Swiss-Prot for TBX1 Gene

  • Probable transcriptional regulator involved in developmental processes. Is required for normal development of the pharyngeal arch arteries (By similarity).

Additional gene information for TBX1 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TBX1 Gene

Genomics for TBX1 Gene

Regulatory Elements for TBX1 Gene

Enhancers for TBX1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH22H020078 2 FANTOM5 Ensembl ENCODE dbSUPER 11.8 +324.8 324819 5.2 HNRNPUL1 HDGF PKNOX1 MLX ARNT ZFP64 ARID4B SIN3A DMAP1 ZNF2 DGCR8 TRMT2A LZTR1 RPL8P5 MED15 UFD1 RPL7AP70 ENSG00000273300 LOC100420177 RANBP1
GH22H019982 1.8 FANTOM5 Ensembl ENCODE dbSUPER 11.8 +227.3 227312 3 HDGF ZNF121 GLIS2 FOS ATF7 SP3 JUNB ZC3H11A TSHZ1 ZNF491 DGCR8 LINC01311 LOC100420177 LZTR1 ARVCF KLHL22 TBX1 TRMT2A ENSG00000273343 ZNF74
GH22H020494 1.8 FANTOM5 ENCODE dbSUPER 11.8 +739.1 739141 2.7 FEZF1 YBX1 YY1 SLC30A9 ZNF416 ZNF143 ZNF548 SP3 ZC3H11A MEF2D LZTR1 DGCR8 MED15 RPL7AP70 TRMT2A LOC100420177 RPL8P5 THAP7-AS1 THAP7 ENSG00000273343
GH22H020506 1.8 FANTOM5 ENCODE dbSUPER 11.1 +752.8 752800 5.8 HNRNPUL1 HDGF ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 ZNF207 ZNF143 MED15 LOC100420177 LZTR1 DGCR8 TRMT2A ZNF74 RPL7AP70 KLHL22 ABHD17AP4 TBX1
GH22H019889 1.6 Ensembl ENCODE dbSUPER 11.8 +135.6 135563 5 HDGF PKNOX1 MLX ARNT ZFP64 ARID4B FEZF1 SLC30A9 ZNF766 CBX5 TBX1 RPL8P5 RTL10 TXNRD2 TANGO2 COMT PIR37139
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around TBX1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for TBX1 Gene

Genomic Locations for TBX1 Gene
26,891 bases
Plus strand

Genomic View for TBX1 Gene

Genes around TBX1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TBX1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TBX1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TBX1 Gene

Proteins for TBX1 Gene

  • Protein details for TBX1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    T-box transcription factor TBX1
    Protein Accession:
    Secondary Accessions:
    • C6G493
    • C6G494
    • O43436
    • Q96RJ2

    Protein attributes for TBX1 Gene

    398 amino acids
    Molecular mass:
    43133 Da
    Quaternary structure:
    • Interacts with DSCR6.

    Three dimensional structures from OCA and Proteopedia for TBX1 Gene

    Alternative splice isoforms for TBX1 Gene

neXtProt entry for TBX1 Gene

Post-translational modifications for TBX1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for TBX1 Gene

Domains & Families for TBX1 Gene

Gene Families for TBX1 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for TBX1 Gene

Suggested Antigen Peptide Sequences for TBX1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with TBX1: view

No data available for UniProtKB/Swiss-Prot for TBX1 Gene

Function for TBX1 Gene

Molecular function for TBX1 Gene

GENATLAS Biochemistry:
murine T-box gene Tbx1 (T,brachyury) homolog,expressed in the lateral plate mesoderm,the branchial arches,the otic vesicles and the optic cup
UniProtKB/Swiss-Prot Function:
Probable transcriptional regulator involved in developmental processes. Is required for normal development of the pharyngeal arch arteries (By similarity).

Phenotypes From GWAS Catalog for TBX1 Gene

Gene Ontology (GO) - Molecular Function for TBX1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003677 DNA binding IEA --
GO:0003700 NOT transcription factor activity, sequence-specific DNA binding IEA,IDA 11111039
GO:0042803 protein homodimerization activity IDA 11111039
GO:0043565 sequence-specific DNA binding IDA 11111039
genes like me logo Genes that share ontologies with TBX1: view
genes like me logo Genes that share phenotypes with TBX1: view

Human Phenotype Ontology for TBX1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for TBX1 Gene

MGI Knock Outs for TBX1:

Animal Model Products

miRNA for TBX1 Gene

miRTarBase miRNAs that target TBX1

Transcription Factor Targets for TBX1 Gene

Selected GeneGlobe predicted Target genes for TBX1

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) and HOMER Transcription for TBX1 Gene

Localization for TBX1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TBX1 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TBX1 gene
Compartment Confidence
nucleus 5
cytosol 2
extracellular 1
mitochondrion 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytoplasmic bodies (2)
  • Nuclear bodies (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for TBX1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IDA 15703190
genes like me logo Genes that share ontologies with TBX1: view

Pathways & Interactions for TBX1 Gene

genes like me logo Genes that share pathways with TBX1: view

Pathways by source for TBX1 Gene

Gene Ontology (GO) - Biological Process for TBX1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001525 angiogenesis ISS --
GO:0001568 blood vessel development ISS --
GO:0001708 cell fate specification ISS --
GO:0001755 neural crest cell migration ISS --
GO:0001934 positive regulation of protein phosphorylation ISS --
genes like me logo Genes that share ontologies with TBX1: view

No data available for SIGNOR curated interactions for TBX1 Gene

Drugs & Compounds for TBX1 Gene

No Compound Related Data Available

Transcripts for TBX1 Gene

Unigene Clusters for TBX1 Gene

T-box 1:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TBX1 Gene

No ASD Table

Relevant External Links for TBX1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TBX1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TBX1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for TBX1 Gene

This gene is overexpressed in Muscle - Skeletal (x11.5) and Testis (x5.2).

Protein differential expression in normal tissues from HIPED for TBX1 Gene

This gene is overexpressed in Serum (68.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TBX1 Gene

Protein tissue co-expression partners for TBX1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of TBX1 Gene:

SOURCE GeneReport for Unigene cluster for TBX1 Gene:

Evidence on tissue expression from TISSUES for TBX1 Gene

  • Muscle(4.5)

Phenotype-based relationships between genes and organs from Gene ORGANizer for TBX1 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • lymphatic
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Head and neck:
  • brain
  • cheek
  • chin
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • hypothalamus
  • jaw
  • larynx
  • lip
  • mandible
  • maxilla
  • middle ear
  • mouth
  • neck
  • nose
  • outer ear
  • parathyroid
  • pharynx
  • pituitary gland
  • skull
  • thyroid
  • tongue
  • tooth
  • vocal cord
  • aorta
  • chest wall
  • clavicle
  • heart
  • heart valve
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
  • thymus
  • abdominal wall
  • biliary tract
  • gallbladder
  • intestine
  • kidney
  • large intestine
  • liver
  • pancreas
  • small intestine
  • pelvis
  • rectum
  • testicle
  • ureter
  • uterus
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
  • blood
  • blood vessel
  • bone marrow
  • coagulation system
  • hair
  • peripheral nerve
  • peripheral nervous system
  • red blood cell
  • skin
  • spinal column
  • vertebrae
  • white blood cell
genes like me logo Genes that share expression patterns with TBX1: view

No data available for mRNA Expression by UniProt/SwissProt for TBX1 Gene

Orthologs for TBX1 Gene

This gene was present in the common ancestor of animals.

Orthologs for TBX1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia TBX1 34 33
  • 97.6 (n)
(Canis familiaris)
Mammalia TBX1 34 33
  • 90.34 (n)
(Mus musculus)
Mammalia Tbx1 33 16 34
  • 85.96 (n)
(Rattus norvegicus)
Mammalia Tbx1 33
  • 85.3 (n)
(Monodelphis domestica)
Mammalia TBX1 34
  • 79 (a)
(Ornithorhynchus anatinus)
Mammalia TBX1 34
  • 61 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia tbx1 33
  • 73.69 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.21661 33
(Danio rerio)
Actinopterygii tbx1 34 33
  • 72.19 (n)
fruit fly
(Drosophila melanogaster)
Insecta org-1 35 34
  • 70 (a)
Doc3 35
  • 47 (a)
(Caenorhabditis elegans)
Secernentea mls-1 33
  • 53.54 (n)
mab-9 35
  • 49 (a)
tbx-7 34
  • 32 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 51 (a)
Species where no ortholog for TBX1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TBX1 Gene

Gene Tree for TBX1 (if available)
Gene Tree for TBX1 (if available)

Paralogs for TBX1 Gene

Paralogs for TBX1 Gene

(12) SIMAP similar genes for TBX1 Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with TBX1: view

Variants for TBX1 Gene

Sequence variations from dbSNP and Humsavar for TBX1 Gene

SNP ID Clin Chr 22 pos Sequence Context AA Info Type
rs28939675 Pathogenic, Conotruncal heart malformations (CTHM) [MIM:217095], Velocardiofacial syndrome (VCFS) [MIM:192430] 19,763,273(+) GCTCT(A/T)CGGCA upstream-variant-2KB, reference, missense
rs41298838 Pathogenic, DiGeorge syndrome (DGS) [MIM:188400] 19,765,921(+) GGCCC(A/G)GCGCA reference, missense
rs74315522 Pathogenic, Velocardiofacial syndrome (VCFS) [MIM:192430] 19,764,224(+) GTGCA(C/G)TACCA upstream-variant-2KB, reference, missense
VAR_036065 A colorectal cancer sample
rs1057518168 Pathogenic 19,766,574(+) CCCCG(-/GCCCAGTCCCCCGAACCCCG)AGCTG intron-variant, reference, frameshift-variant

Structural Variations from Database of Genomic Variants (DGV) for TBX1 Gene

Variant ID Type Subtype PubMed ID
nsv953023 CNV deletion 24416366
nsv834129 CNV loss 17160897
nsv834128 CNV loss 17160897
nsv828948 CNV loss 20364138
nsv828947 CNV gain 20364138
nsv828946 CNV gain 20364138
nsv828943 CNV loss 20364138
nsv828939 CNV loss 20364138
nsv828938 CNV gain 20364138
nsv588236 CNV loss 21841781
nsv588235 CNV loss 21841781
nsv588232 CNV gain 21841781
nsv588231 CNV loss 21841781
nsv588216 CNV gain 21841781
nsv517478 CNV loss 19592680
nsv471181 CNV loss 18288195
nsv1118942 CNV deletion 24896259
nsv1072619 CNV deletion 25765185
esv3893434 CNV gain 25118596
esv3647279 CNV gain 21293372
esv3575428 CNV gain 25503493
esv3575418 CNV gain 25503493
esv3568260 CNV loss 25503493
esv3568258 CNV loss 25503493
esv3568257 CNV loss 25503493
esv2751940 CNV gain 17911159
esv21705 CNV loss 19812545
dgv7983n54 CNV gain 21841781
dgv7982n54 CNV loss 21841781
dgv725n67 CNV gain 20364138

Variation tolerance for TBX1 Gene

Residual Variation Intolerance Score: 13.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 7.93; 83.88% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for TBX1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TBX1 Gene

Disorders for TBX1 Gene

MalaCards: The human disease database

(18) MalaCards diseases for TBX1 Gene - From: HGMD, OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
velocardiofacial syndrome
  • cayler cardiofacial syndrome
digeorge syndrome
  • digeorge sequence
conotruncal heart malformations
  • conotruncal heart malformations, variable
tetralogy of fallot
  • ventricular septal defect with pulmonary stenosis or atresia, dextraposition of aorta, and hypertrophy of right ventricle
chromosome 22q11.2 microduplication syndrome
  • 22q11.2 microduplication syndrome
- elite association - COSMIC cancer census association via MalaCards
Search TBX1 in MalaCards View complete list of genes associated with diseases

  • Conotruncal heart malformations (CTHM) [MIM:217095]: A group of congenital heart defects involving the outflow tracts. Examples include truncus arteriosus communis, double-outlet right ventricle and transposition of great arteries. Truncus arteriosus communis is characterized by a single outflow tract instead of a separate aorta and pulmonary artery. In transposition of the great arteries, the aorta arises from the right ventricle and the pulmonary artery from the left ventricle. In double outlet of the right ventricle, both the pulmonary artery and aorta arise from the right ventricle. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • DiGeorge syndrome (DGS) [MIM:188400]: A congenital syndrome characterized by a wide spectrum of characteristics including parathyroid hypoplasia resulting in hypocalcemia, thymic hypoplasia resulting in T-cell immunodeficiency, defects in the outflow tract of the heart, and craniofacial anomalies. Disturbance of cervical neural crest migration into the derivatives of the pharyngeal arches and pouches can account for the phenotype. {ECO:0000269 PubMed:14585638}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Note=Haploinsufficiency of the TBX1 gene is responsible for most of the physical malformations present in DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS). DGS is characterized by the association of several malformations: hypoplastic thymus and parathyroid glands, congenital conotruncal cardiopathy, and a subtle but characteristic facial dysmorphology. VCFS is marked by the association of congenital conotruncal heart defects, cleft palate or velar insufficiency, facial dysmorpholgy and learning difficulties. It is now accepted that these two syndromes represent two forms of clinical expression of the same entity manifesting at different stages of life.
  • Velocardiofacial syndrome (VCFS) [MIM:192430]: A syndrome characterized by abnormal pharyngeal arch development that results in defective development of the parathyroid glands, thymus, and conotruncal region of the heart. The phenotype is highly variable, with no single clinical feature present in every patient. Affected individuals may present with structural or functional palatal abnormalities, cardiac defects, unique facial characteristics, hypernasal speech, hypotonia, and defective thymic development associated with impaired immune function. In addition, affected individuals may present with learning disabilities, overt developmental delay, and psychiatric disorders. {ECO:0000269 PubMed:14585638, ECO:0000269 PubMed:17273972}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for TBX1

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with TBX1: view

No data available for Genatlas for TBX1 Gene

Publications for TBX1 Gene

  1. Isolation and characterization of a gene from the DiGeorge chromosomal region homologous to the mouse Tbx1 gene. (PMID: 9268629) Chieffo C … Budarf ML (Genomics 1997) 2 3 4 22 60
  2. Single nucleotide polymorphism discovery in TBX1 in individuals with and without 22q11.2 deletion syndrome. (PMID: 19645056) Heike CL … Crawford DC (Birth defects research. Part A, Clinical and molecular teratology 2010) 3 22 45 60
  3. TBX1 gene mutation screening in patients with non-syndromic Fallot tetralogy. (PMID: 17479646) Cabuk F … Tükün A (The Turkish journal of pediatrics 2007) 3 22 45 60
  4. [Single nucleotide polymorphism and haplotype in TBX1 gene of patients with conotruncal defects: analysis of 130 cases]. (PMID: 16854283) Han XM … Sun YX (Zhonghua yi xue za zhi 2006) 3 22 45 60
  5. Understanding velocardiofacial syndrome: how recent discoveries can help you improve your patient outcomes. (PMID: 23000736) Chinnadurai S … Goudy S (Current opinion in otolaryngology & head and neck surgery 2012) 2 3 60

Products for TBX1 Gene

Sources for TBX1 Gene

Loading form....