Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TBC1D30 Gene

Aliases for TBC1D30 Gene

  • TBC1 Domain Family Member 30 2 3 5
  • TBC1 Domain Family, Member 30 2
  • KIAA0984 4

External Ids for TBC1D30 Gene

Previous GeneCards Identifiers for TBC1D30 Gene

  • GC12P063460
  • GC12P065174
  • GC12P062225

Summaries for TBC1D30 Gene

GeneCards Summary for TBC1D30 Gene

TBC1D30 (TBC1 Domain Family Member 30) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include GTPase activator activity and Rab GTPase binding.

UniProtKB/Swiss-Prot for TBC1D30 Gene

  • GTPase-activating protein (GAP) with broad specificity. Acts as a GAP for RAB3A. Also exhibits significant GAP activity toward RAB22A, RAB27A, and RAB35 in vitro.

Additional gene information for TBC1D30 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TBC1D30 Gene

Genomics for TBC1D30 Gene

GeneHancer (GH) Regulatory Elements for TBC1D30 Gene

Promoters and enhancers for TBC1D30 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12I064778 Promoter/Enhancer 1.7 FANTOM5 Ensembl ENCODE 550.8 -0.5 -450 4.7 SIN3A ZNF2 GLIS2 RUNX3 ZNF202 SP3 SMARCB1 SMARCA4 ZNF585B GLIS1 TBC1D30 TBK1 GNS PABPC1P4 LEMD3 LOC100420899 RASSF3 GC12P064764 ENSG00000215159 GC12P064723
GH12I064824 Promoter/Enhancer 1.4 EPDnew Ensembl 550.3 +43.9 43905 1.9 PKNOX1 SIN3A ZBTB7B GLIS2 ZNF213 ZNF143 ZNF548 RUNX3 ZNF214 SP3 TBC1D30 LEMD3 LOC100420899 TBK1 ENSG00000250280 RNU6-166P GC12M064868 GC12P064711
GH12I064796 Enhancer 0.9 ENCODE 0.4 +15.4 15352 0.9 PKNOX1 ATF1 FOXA2 ARID4B NEUROD1 SIN3A BMI1 RAD21 RARA RFX5 TBC1D30 GC12M064868 GC12P064723 GC12P064711
GH12I064797 Enhancer 0.7 ENCODE 0.4 +16.2 16183 0.1 FOXA2 CEBPG RARA GATA3 NR2F6 FOSL2 FOS CREM THAP11 GATAD2A RNU6-166P TBC1D30 GC12M064868 GC12P064723 GC12P064711
GH12I064800 Enhancer 0.7 FANTOM5 0.4 +19.6 19643 0.4 IKZF1 JUNB EBF1 IKZF2 ATF2 RUNX3 RELA TBK1 RNU6-166P RASSF3 LEMD3 GNS TBC1D30 GC12M064868 GC12P064723 GC12P064711
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TBC1D30 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the TBC1D30 gene promoter:

Genomic Locations for TBC1D30 Gene

Genomic Locations for TBC1D30 Gene
99,840 bases
Plus strand

Genomic View for TBC1D30 Gene

Genes around TBC1D30 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TBC1D30 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TBC1D30 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TBC1D30 Gene

Proteins for TBC1D30 Gene

  • Protein details for TBC1D30 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    TBC1 domain family member 30
    Protein Accession:
    Secondary Accessions:
    • B3KP01
    • B9A6M9
    • E7EMW4
    • F5GYJ9

    Protein attributes for TBC1D30 Gene

    924 amino acids
    Molecular mass:
    102743 Da
    Quaternary structure:
    No Data Available
    • Sequence=BAA76828.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for TBC1D30 Gene


neXtProt entry for TBC1D30 Gene

Post-translational modifications for TBC1D30 Gene

No Post-translational modifications

No data available for DME Specific Peptides for TBC1D30 Gene

Domains & Families for TBC1D30 Gene

Gene Families for TBC1D30 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Predicted membrane proteins

Protein Domains for TBC1D30 Gene

Suggested Antigen Peptide Sequences for TBC1D30 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with TBC1D30: view

No data available for UniProtKB/Swiss-Prot for TBC1D30 Gene

Function for TBC1D30 Gene

Molecular function for TBC1D30 Gene

UniProtKB/Swiss-Prot Function:
GTPase-activating protein (GAP) with broad specificity. Acts as a GAP for RAB3A. Also exhibits significant GAP activity toward RAB22A, RAB27A, and RAB35 in vitro.

Phenotypes From GWAS Catalog for TBC1D30 Gene

Gene Ontology (GO) - Molecular Function for TBC1D30 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005096 GTPase activator activity IDA 17646400
GO:0017137 Rab GTPase binding IPI 17646400
genes like me logo Genes that share ontologies with TBC1D30: view

Animal Model Products

miRNA for TBC1D30 Gene

miRTarBase miRNAs that target TBC1D30

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for TBC1D30 Gene

Localization for TBC1D30 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TBC1D30 Gene

Cell membrane; Peripheral membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TBC1D30 gene
Compartment Confidence
plasma membrane 5
cytoskeleton 5
cytosol 5
nucleus 3

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Plasma membrane (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for TBC1D30 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005829 cytosol IDA --
GO:0005886 plasma membrane IDA,IEA --
GO:0005929 cilium IDA 17646400
GO:0012505 endomembrane system IBA --
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with TBC1D30: view

Pathways & Interactions for TBC1D30 Gene

SuperPathways for TBC1D30 Gene

No Data Available

Gene Ontology (GO) - Biological Process for TBC1D30 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006886 intracellular protein transport IBA --
GO:0031338 regulation of vesicle fusion IBA --
GO:0043547 positive regulation of GTPase activity IDA 17646400
GO:0090630 activation of GTPase activity IBA --
GO:1902018 negative regulation of cilium assembly IMP 17646400
genes like me logo Genes that share ontologies with TBC1D30: view

No data available for Pathways by source and SIGNOR curated interactions for TBC1D30 Gene

Drugs & Compounds for TBC1D30 Gene

No Compound Related Data Available

Transcripts for TBC1D30 Gene

Unigene Clusters for TBC1D30 Gene

TBC1 domain family, member 30:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TBC1D30 Gene

No ASD Table

Relevant External Links for TBC1D30 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TBC1D30 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TBC1D30 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for TBC1D30 Gene

This gene is overexpressed in Pancreas (x4.3).

Protein differential expression in normal tissues from HIPED for TBC1D30 Gene

This gene is overexpressed in Adipocyte (41.4) and Pancreas (27.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TBC1D30 Gene

Protein tissue co-expression partners for TBC1D30 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of TBC1D30 Gene:


SOURCE GeneReport for Unigene cluster for TBC1D30 Gene:


Evidence on tissue expression from TISSUES for TBC1D30 Gene

  • Nervous system(4.7)
genes like me logo Genes that share expression patterns with TBC1D30: view

No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for TBC1D30 Gene

Orthologs for TBC1D30 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for TBC1D30 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia LOC467055 33
  • 99.42 (n)
TBC1D30 34
  • 99 (a)
(Canis familiaris)
Mammalia TBC1D30 33 34
  • 89.06 (n)
(Bos Taurus)
Mammalia TBC1D30 33 34
  • 88.89 (n)
(Monodelphis domestica)
Mammalia TBC1D30 34
  • 86 (a)
(Mus musculus)
Mammalia Tbc1d30 33 16 34
  • 84.76 (n)
(Rattus norvegicus)
Mammalia Tbc1d30 33
  • 84.06 (n)
(Ornithorhynchus anatinus)
Mammalia TBC1D30 34
  • 73 (a)
(Gallus gallus)
Aves TBC1D30 33 34
  • 76.52 (n)
(Anolis carolinensis)
Reptilia TBC1D30 34
  • 64 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia tbc1d30 33
  • 70.63 (n)
(Danio rerio)
Actinopterygii tbc1d30 33 34
  • 66.1 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG42795 34
  • 9 (a)
(Caenorhabditis elegans)
Secernentea tbc-19 34
  • 8 (a)
tbc-9 34
  • 7 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes MDR1 34
  • 10 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 52 (a)
Species where no ortholog for TBC1D30 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TBC1D30 Gene

Gene Tree for TBC1D30 (if available)
Gene Tree for TBC1D30 (if available)

Paralogs for TBC1D30 Gene

(1) SIMAP similar genes for TBC1D30 Gene using alignment to 5 proteins:

genes like me logo Genes that share paralogs with TBC1D30: view

No data available for Paralogs for TBC1D30 Gene

Variants for TBC1D30 Gene

Sequence variations from dbSNP and Humsavar for TBC1D30 Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs145477737 uncertain-significance, Sanfilippo syndrome 64,759,444(+) GGGGG/GGGGGG upstream_transcript_variant
rs200441930 uncertain-significance, not specified, Sanfilippo syndrome 64,759,273(+) G/A/C upstream_transcript_variant
rs540537083 uncertain-significance, Sanfilippo syndrome 64,759,204(+) C/G/T upstream_transcript_variant
rs559286032 uncertain-significance, Sanfilippo syndrome 64,759,301(+) CGGGACGGGACGGGACGG/CGGGACGGGACGGGACGGGACGG upstream_transcript_variant
rs61743823 uncertain-significance, benign, Sanfilippo syndrome, not specified 64,759,256(+) G/C upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for TBC1D30 Gene

Variant ID Type Subtype PubMed ID
nsv52978 CNV deletion 16902084
nsv973085 CNV duplication 23825009

Variation tolerance for TBC1D30 Gene

Gene Damage Index Score: 2.67; 45.97% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TBC1D30 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TBC1D30 Gene

Disorders for TBC1D30 Gene

Additional Disease Information for TBC1D30

No disorders were found for TBC1D30 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TBC1D30 Gene

Publications for TBC1D30 Gene

  1. Common genetic variation and performance on standardized cognitive tests. (PMID: 20125193) Cirulli ET … Goldstein DB (European journal of human genetics : EJHG 2010) 3 44 58
  2. Identification and characterization of a novel Tre-2/Bub2/Cdc16 (TBC) protein that possesses Rab3A-GAP activity. (PMID: 19077034) Ishibashi K … Fukuda M (Genes to cells : devoted to molecular & cellular mechanisms 2009) 3 4 58
  3. Functional dissection of Rab GTPases involved in primary cilium formation. (PMID: 17646400) Yoshimura S … Barr FA (The Journal of cell biology 2007) 2 3 58
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  5. GAPs galore! A survey of putative Ras superfamily GTPase activating proteins in man and Drosophila. (PMID: 12618308) Bernards A (Biochimica et biophysica acta 2003) 2 3 58

Products for TBC1D30 Gene

Sources for TBC1D30 Gene

Loading form....