Aliases for TBC1D30 Gene
Aliases for TBC1D30 Gene
External Ids for TBC1D30 Gene
- HGNC: 29164
- Entrez Gene: 23329
- Ensembl: ENSG00000111490
- OMIM: 615077
- UniProtKB: Q9Y2I9
Previous GeneCards Identifiers for TBC1D30 Gene
- GC12P063460
- GC12P065174
- GC12P062225
Summaries for TBC1D30 Gene
GeneCards Summary for TBC1D30 Gene
TBC1D30 (TBC1 Domain Family Member 30) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include GTPase activator activity and Rab GTPase binding.
UniProtKB/Swiss-Prot for TBC1D30 Gene
-
GTPase-activating protein (GAP) with broad specificity. Acts as a GAP for RAB3A. Also exhibits significant GAP activity toward RAB22A, RAB27A, and RAB35 in vitro.
Additional gene information for TBC1D30 Gene
No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TBC1D30 Gene
Genomics for TBC1D30 Gene
GeneHancer (GH) Regulatory Elements for TBC1D30 Gene
Promoters and enhancers for TBC1D30 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data dump
GeneHancers around TBC1D30 on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the TBC1D30 gene promoter:
Regulatory Element Products
Genomic Locations for TBC1D30 Gene
Genomic Locations for TBC1D30 Gene
- chr12:64,781,193-64,881,032
- (GRCh38/hg38)
- Size:
- 99,840 bases
- Orientation:
- Plus strand
- chr12:65,174,589-65,274,812
- (GRCh37/hg19)
Genomic View for TBC1D30 Gene
Genes around TBC1D30 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 12q14.3 by Ensembl
- 12q14.3 by Entrez Gene
- 12q14.3 by HGNC
TBC1D30 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for TBC1D30 Gene
Proteins for TBC1D30 Gene
-
Protein details for TBC1D30 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q9Y2I9-TBC30_HUMAN
- Recommended name:
- TBC1 domain family member 30
- Protein Accession:
- Q9Y2I9
- B3KP01
- B9A6M9
- E7EMW4
- F5GYJ9
Protein attributes for TBC1D30 Gene
- Size:
- 924 amino acids
- Molecular mass:
- 102743 Da
- Quaternary structure:
- No Data Available
- SequenceCaution:
-
- Sequence=BAA76828.1; Type=Erroneous initiation; Evidence={ECO:0000305};
Protein Expression for TBC1D30 Gene
Post-translational modifications for TBC1D30 Gene
No Post-translational modifications
Other Protein References for TBC1D30 Gene
Antibody Products
- Novus Biologicals Antibodies for TBC1D30
- Invitrogen Antibodies for TBC1D30
- Search GeneTex for Antibodies for TBC1D30
Protein Products
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for TBC1D30
- Origene Custom Protein Services for TBC1D30
- Novus Biologicals proteins for TBC1D30
- antibodies-online: Search results for 2 available TBC1D30 Proteins ranked by validation data
- Compare Top TBC1D30 Proteins
-
Quality Products:
- Search GeneTex for Proteins for TBC1D30
Assay Products
No data available for DME Specific Peptides for TBC1D30 Gene
Domains & Families for TBC1D30 Gene
Gene Families for TBC1D30 Gene
- Human Protein Atlas (HPA):
-
- Predicted intracellular proteins
- Predicted membrane proteins
Protein Domains for TBC1D30 Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for TBC1D30 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
No data available for UniProtKB/Swiss-Prot for TBC1D30 Gene
Function for TBC1D30 Gene
Molecular function for TBC1D30 Gene
- UniProtKB/Swiss-Prot Function:
- GTPase-activating protein (GAP) with broad specificity. Acts as a GAP for RAB3A. Also exhibits significant GAP activity toward RAB22A, RAB27A, and RAB35 in vitro.
Phenotypes From GWAS Catalog for TBC1D30 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005096 | GTPase activator activity | IDA | 17646400 |
| GO:0017137 | Rab GTPase binding | IPI | 17646400 |
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for TBC1D30
-
-
ViGene Biosciences lentiviral particle packaged cDNA for TBC1D30 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for TBC1D30 gene
- Search ViGene Biosciences for TBC1D30
CRISPR Products
-
OriGene CRISPR knockouts for TBC1D30
- genomics-online: gRNA clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
- Applied Biological Materials CRISPR for TBC1D30
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for TBC1D30
- GenScript: Design CRISPR guide RNA sequences for TBC1D30
miRNA for TBC1D30 Gene
- miRTarBase miRNAs that target TBC1D30
miRNA Products
- Search ViGene Biosciences for TBC1D30
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for TBC1D30
- Browse OriGene Inhibitory RNA Products For TBC1D30
- genomics-online: shRNA clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for TBC1D30 gene
Clone Products
- VectorBuilder custom plasmid, inducible vectors for TBC1D30
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for TBC1D30
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for TBC1D30
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for TBC1D30
-
ViGene Biosciences adenoviral particle packaged cDNA for TBC1D30 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for TBC1D30 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for TBC1D30 gene
No data available for Enzyme Numbers (IUBMB) , Phenotypes , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for TBC1D30 Gene
Localization for TBC1D30 Gene
Subcellular locations from UniProtKB/Swiss-Prot for TBC1D30 Gene
- Cell membrane; Peripheral membrane protein.
| Compartment | Confidence |
|---|---|
| plasma membrane | 5 |
| cytoskeleton | 5 |
| cytosol | 5 |
| nucleus | 3 |
- Cytosol (2)
- Plasma membrane (2)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005829 | cytosol | IDA | -- |
| GO:0005886 | plasma membrane | IDA,IEA | -- |
| GO:0005929 | cilium | IDA | 17646400 |
| GO:0012505 | endomembrane system | IBA | -- |
| GO:0016020 | membrane | IEA | -- |
Pathways & Interactions for TBC1D30 Gene
No Data Available
Interacting Proteins for TBC1D30 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0006886 | intracellular protein transport | IBA | -- |
| GO:0031338 | regulation of vesicle fusion | IBA | -- |
| GO:0043547 | positive regulation of GTPase activity | IDA | 17646400 |
| GO:0090630 | activation of GTPase activity | IBA | -- |
| GO:1902018 | negative regulation of cilium assembly | IMP | 17646400 |
No data available for Pathways by source and SIGNOR curated interactions for TBC1D30 Gene
Transcripts for TBC1D30 Gene
mRNA/cDNA for TBC1D30 Gene
- (10) REFSEQ mRNAs :
- (5) Additional mRNA sequences :
- (62) Selected AceView cDNA sequences:
- (6) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for TBC1D30 Gene
CRISPR Products
-
OriGene CRISPR knockouts for TBC1D30
- genomics-online: gRNA clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
- Applied Biological Materials CRISPR for TBC1D30
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for TBC1D30
- GenScript: Design CRISPR guide RNA sequences for TBC1D30
miRNA Products
- Search ViGene Biosciences for TBC1D30
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for TBC1D30
- Browse OriGene Inhibitory RNA Products For TBC1D30
- genomics-online: shRNA clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for TBC1D30 gene
Clone Products
- VectorBuilder custom plasmid, inducible vectors for TBC1D30
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for TBC1D30
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for TBC1D30
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for TBC1D30 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
- Adipose (Muscoskeletal System)
mRNA differential expression in normal tissues according to GTEx for TBC1D30 Gene
This gene is overexpressed in Pancreas (x4.3).
This gene is overexpressed in Adipocyte (41.4) and Pancreas (27.6).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TBC1D30 Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of TBC1D30 Gene:
TBC1D30SOURCE GeneReport for Unigene cluster for TBC1D30 Gene:
Hs.192492Evidence on tissue expression from TISSUES for TBC1D30 Gene
- Nervous system(4.7)
Primer Products
- genomics-online: primer clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for TBC1D30 Gene
Orthologs for TBC1D30 Gene
This gene was present in the common ancestor of animals and fungi.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | LOC467055 33 |
|
||
| TBC1D30 34 |
|
OneToOne | |||
| dog (Canis familiaris) |
Mammalia | TBC1D30 33 34 |
|
||
| cow (Bos Taurus) |
Mammalia | TBC1D30 33 34 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | TBC1D30 34 |
|
OneToOne | |
| mouse (Mus musculus) |
Mammalia | Tbc1d30 33 16 34 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Tbc1d30 33 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | TBC1D30 34 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | TBC1D30 33 34 |
|
||
| lizard (Anolis carolinensis) |
Reptilia | TBC1D30 34 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | tbc1d30 33 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | tbc1d30 33 34 |
|
||
| fruit fly (Drosophila melanogaster) |
Insecta | CG42795 34 |
|
OneToOne | |
| worm (Caenorhabditis elegans) |
Secernentea | tbc-19 34 |
|
ManyToMany | |
| tbc-9 34 |
|
ManyToMany | |||
| baker's yeast (Saccharomyces cerevisiae) |
Saccharomycetes | MDR1 34 |
|
OneToMany | |
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 34 |
|
OneToOne |
- Species where no ortholog for TBC1D30 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Paralogs for TBC1D30 Gene
(1) SIMAP similar genes for TBC1D30 Gene using alignment to 5 proteins:
No data available for Paralogs for TBC1D30 Gene
Variants for TBC1D30 Gene
| SNP ID | Clin | Chr 12 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs145477737 | uncertain-significance, Sanfilippo syndrome | 64,759,444(+) | GGGGG/GGGGGG | upstream_transcript_variant | |
| rs200441930 | uncertain-significance, not specified, Sanfilippo syndrome | 64,759,273(+) | G/A/C | upstream_transcript_variant | |
| rs540537083 | uncertain-significance, Sanfilippo syndrome | 64,759,204(+) | C/G/T | upstream_transcript_variant | |
| rs559286032 | uncertain-significance, Sanfilippo syndrome | 64,759,301(+) | CGGGACGGGACGGGACGG/CGGGACGGGACGGGACGGGACGG | upstream_transcript_variant | |
| rs61743823 | uncertain-significance, benign, Sanfilippo syndrome, not specified | 64,759,256(+) | G/C | upstream_transcript_variant |
Gene Damage Index Score:
2.67;
45.97% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for TBC1D30 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TBC1D30 Gene
Disorders for TBC1D30 Gene
Additional Disease Information for TBC1D30
- Genetic Association Database
- (GAD)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No disorders were found for TBC1D30 Gene.
No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TBC1D30 Gene
Publications for TBC1D30 Gene
- Common genetic variation and performance on standardized cognitive tests. (PMID: 20125193) Cirulli ET … Goldstein DB (European journal of human genetics : EJHG 2010) 3 44 58
- Identification and characterization of a novel Tre-2/Bub2/Cdc16 (TBC) protein that possesses Rab3A-GAP activity. (PMID: 19077034) Ishibashi K … Fukuda M (Genes to cells : devoted to molecular & cellular mechanisms 2009) 3 4 58
- Functional dissection of Rab GTPases involved in primary cilium formation. (PMID: 17646400) Yoshimura S … Barr FA (The Journal of cell biology 2007) 2 3 58
- Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
- GAPs galore! A survey of putative Ras superfamily GTPase activating proteins in man and Drosophila. (PMID: 12618308) Bernards A (Biochimica et biophysica acta 2003) 2 3 58
Products for TBC1D30 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Browse OriGene Antibodies
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for TBC1D30
- Origene Custom Protein Services for TBC1D30
- Origene shrna, sirna, and RNAi products in human, mouse, rat for TBC1D30
- Browse OriGene Inhibitory RNA Products For TBC1D30
- Browse OriGene qPCR primer pairs and template standards
- OriGene CRISPR knockouts for TBC1D30
- OriGene ORF clones in human for TBC1D30
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For TBC1D30
- GenScript: Next-day shipping of latest version cDNA ORF clones for TBC1D30 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for TBC1D30
- GenScript Custom Assay Services for TBC1D30
- GenScript Custom overexpressing Cell Line Services for TBC1D30
- GenScript: Design CRISPR guide RNA sequences for TBC1D30
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for TBC1D30
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for TBC1D30
- Novus Biologicals proteins for TBC1D30
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Invitrogen Antibodies for TBC1D30
- Cyagen custom Knockout/knockin (KOKI) mouse models for TBC1D30
- VectorBuilder custom plasmid, inducible vectors for TBC1D30
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for TBC1D30
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for available TBC1D30 related products ranked by validation data
- antibodies-online: Search results for available TBC1D30 related products ranked by validation data
- antibodies-online: Search results for 2 available TBC1D30 Proteins ranked by validation data
- Compare Top TBC1D30 Proteins
- Quality Products:
- Search GeneTex for Antibodies for TBC1D30
- Search GeneTex for Proteins for TBC1D30
- ViGene Biosciences adenoviral particle packaged cDNA for TBC1D30 gene
- ViGene Biosciences lentiviral particle packaged cDNA for TBC1D30 gene
- ViGene Biosciences ready-to-package AAV shRNAs for TBC1D30 gene
- Search ViGene Biosciences for TBC1D30
- Horizon Cell Lines for TBC1D30
- genomics-online: cdna clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
- orf clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
- genomics-online: gRNA clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
- genomics-online: primer clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
- genomics-online: shRNA clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
Sources for TBC1D30 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew