Aliases for TBC1D30 Gene
Aliases for TBC1D30 Gene
External Ids for TBC1D30 Gene
- HGNC: 29164
- Entrez Gene: 23329
- Ensembl: ENSG00000111490
- OMIM: 615077
- UniProtKB: Q9Y2I9
Previous GeneCards Identifiers for TBC1D30 Gene
- GC12P063460
- GC12P065174
- GC12P062225
Summaries for TBC1D30 Gene
GeneCards Summary for TBC1D30 Gene
TBC1D30 (TBC1 Domain Family Member 30) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include GTPase activator activity and Rab GTPase binding.
UniProtKB/Swiss-Prot for TBC1D30 Gene
-
GTPase-activating protein (GAP) with broad specificity. Acts as a GAP for RAB3A. Also exhibits significant GAP activity toward RAB22A, RAB27A, and RAB35 in vitro.
Additional gene information for TBC1D30 Gene
No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TBC1D30 Gene
Genomics for TBC1D30 Gene
GeneHancer (GH) Regulatory Elements for TBC1D30 Gene
- Top Transcription factor binding sites by QIAGEN in the TBC1D30 gene promoter:
Regulatory Element Products
Genomic Locations for TBC1D30 Gene
- chr12:64,781,193-64,881,032
- (GRCh38/hg38)
- Size:
- 99,840 bases
- Orientation:
- Plus strand
- chr12:65,174,589-65,274,812
- (GRCh37/hg19)
Genomic View for TBC1D30 Gene
- Cytogenetic band:
-
- 12q14.3 by Ensembl
- 12q14.3 by Entrez Gene
- 12q14.3 by HGNC


RefSeq DNA sequence for TBC1D30 Gene
Proteins for TBC1D30 Gene
-
Protein details for TBC1D30 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q9Y2I9-TBC30_HUMAN
- Recommended name:
- TBC1 domain family member 30
- Protein Accession:
- Q9Y2I9
- B3KP01
- B9A6M9
- E7EMW4
- F5GYJ9
Protein attributes for TBC1D30 Gene
- Size:
- 924 amino acids
- Molecular mass:
- 102743 Da
- Quaternary structure:
- No Data Available
- SequenceCaution:
-
- Sequence=BAA76828.1; Type=Erroneous initiation; Evidence={ECO:0000305};
Protein Expression for TBC1D30 Gene
Post-translational modifications for TBC1D30 Gene
Other Protein References for TBC1D30 Gene
Antibody Products
- Novus Biologicals Antibodies for TBC1D30
- Invitrogen Antibodies for TBC1D30
- Search GeneTex for Antibodies for TBC1D30
Protein Products
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for TBC1D30
- Origene Custom Protein Services for TBC1D30
- Novus Biologicals proteins for TBC1D30
- antibodies-online: Search results for 2 available TBC1D30 Proteins ranked by validation data
- Compare Top TBC1D30 Proteins
-
Quality Products:
- Search GeneTex for Proteins for TBC1D30
Assay Products
No data available for DME Specific Peptides for TBC1D30 Gene
Domains & Families for TBC1D30 Gene
Gene Families for TBC1D30 Gene
- Human Protein Atlas (HPA):
-
- Predicted intracellular proteins
- Predicted membrane proteins
Protein Domains for TBC1D30 Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for TBC1D30 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
No data available for UniProtKB/Swiss-Prot for TBC1D30 Gene
Function for TBC1D30 Gene
Molecular function for TBC1D30 Gene
- UniProtKB/Swiss-Prot Function:
- GTPase-activating protein (GAP) with broad specificity. Acts as a GAP for RAB3A. Also exhibits significant GAP activity toward RAB22A, RAB27A, and RAB35 in vitro.
Phenotypes From GWAS Catalog for TBC1D30 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005096 | GTPase activator activity | IDA | 17646400 |
GO:0017137 | Rab GTPase binding | IPI | 17646400 |
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for TBC1D30
-
-
ViGene Biosciences lentiviral particle packaged cDNA for TBC1D30 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for TBC1D30 gene
- Search ViGene Biosciences for TBC1D30
CRISPR Products
-
OriGene CRISPR knockouts for TBC1D30
- genomics-online: gRNA clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
- Applied Biological Materials CRISPR for TBC1D30
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for TBC1D30
- GenScript: Design CRISPR guide RNA sequences for TBC1D30
miRNA for TBC1D30 Gene
- miRTarBase miRNAs that target TBC1D30
miRNA Products
- Search ViGene Biosciences for TBC1D30
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for TBC1D30
- Browse OriGene Inhibitory RNA Products For TBC1D30
- genomics-online: shRNA clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for TBC1D30 gene
Clone Products
- VectorBuilder custom plasmid, inducible vectors for TBC1D30
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for TBC1D30
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for TBC1D30
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for TBC1D30
-
ViGene Biosciences adenoviral particle packaged cDNA for TBC1D30 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for TBC1D30 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for TBC1D30 gene
No data available for Enzyme Numbers (IUBMB) , Phenotypes , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for TBC1D30 Gene
Localization for TBC1D30 Gene
Subcellular locations from UniProtKB/Swiss-Prot for TBC1D30 Gene
- Cell membrane; Peripheral membrane protein.
- Cytosol (2)
- Plasma membrane (2)
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005829 | cytosol | IDA | -- |
GO:0005886 | plasma membrane | IDA,IEA | -- |
GO:0005929 | cilium | IDA | 17646400 |
GO:0012505 | endomembrane system | IBA | -- |
GO:0016020 | membrane | IEA | -- |
Pathways & Interactions for TBC1D30 Gene
Interacting Proteins for TBC1D30 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0006886 | intracellular protein transport | IBA | -- |
GO:0031338 | regulation of vesicle fusion | IBA | -- |
GO:0043547 | positive regulation of GTPase activity | IDA | 17646400 |
GO:0090630 | activation of GTPase activity | IBA | -- |
GO:1902018 | negative regulation of cilium assembly | IMP | 17646400 |
No data available for Pathways by source and SIGNOR curated interactions for TBC1D30 Gene
Transcripts for TBC1D30 Gene
mRNA/cDNA for TBC1D30 Gene
- (10) REFSEQ mRNAs :
- (5) Additional mRNA sequences :
- (62) Selected AceView cDNA sequences:
- (6) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for TBC1D30 Gene
CRISPR Products
-
OriGene CRISPR knockouts for TBC1D30
- genomics-online: gRNA clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
- Applied Biological Materials CRISPR for TBC1D30
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for TBC1D30
- GenScript: Design CRISPR guide RNA sequences for TBC1D30
miRNA Products
- Search ViGene Biosciences for TBC1D30
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for TBC1D30
- Browse OriGene Inhibitory RNA Products For TBC1D30
- genomics-online: shRNA clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for TBC1D30 gene
Clone Products
- VectorBuilder custom plasmid, inducible vectors for TBC1D30
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for TBC1D30
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for TBC1D30
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for TBC1D30 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
- Adipose (Muscoskeletal System)
mRNA differential expression in normal tissues according to GTEx for TBC1D30 Gene
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TBC1D30 Gene
NURSA nuclear receptor signaling pathways regulating expression of TBC1D30 Gene:
TBC1D30SOURCE GeneReport for Unigene cluster for TBC1D30 Gene:
Hs.192492Evidence on tissue expression from TISSUES for TBC1D30 Gene
- Nervous system(4.7)
Primer Products
- genomics-online: primer clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for TBC1D30 Gene
Orthologs for TBC1D30 Gene
This gene was present in the common ancestor of animals and fungi.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | LOC467055 33 |
|
||
TBC1D30 34 |
|
OneToOne | |||
dog (Canis familiaris) |
Mammalia | TBC1D30 33 34 |
|
||
cow (Bos Taurus) |
Mammalia | TBC1D30 33 34 |
|
||
oppossum (Monodelphis domestica) |
Mammalia | TBC1D30 34 |
|
OneToOne | |
mouse (Mus musculus) |
Mammalia | Tbc1d30 33 16 34 |
|
||
rat (Rattus norvegicus) |
Mammalia | Tbc1d30 33 |
|
||
platypus (Ornithorhynchus anatinus) |
Mammalia | TBC1D30 34 |
|
OneToOne | |
chicken (Gallus gallus) |
Aves | TBC1D30 33 34 |
|
||
lizard (Anolis carolinensis) |
Reptilia | TBC1D30 34 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | tbc1d30 33 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | tbc1d30 33 34 |
|
||
fruit fly (Drosophila melanogaster) |
Insecta | CG42795 34 |
|
OneToOne | |
worm (Caenorhabditis elegans) |
Secernentea | tbc-19 34 |
|
ManyToMany | |
tbc-9 34 |
|
ManyToMany | |||
baker's yeast (Saccharomyces cerevisiae) |
Saccharomycetes | MDR1 34 |
|
OneToMany | |
sea squirt (Ciona savignyi) |
Ascidiacea | -- 34 |
|
OneToOne |
- Species where no ortholog for TBC1D30 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Paralogs for TBC1D30 Gene
(1) SIMAP similar genes for TBC1D30 Gene using alignment to 5 proteins:
No data available for Paralogs for TBC1D30 Gene
Variants for TBC1D30 Gene
SNP ID | Clin | Chr 12 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs145477737 | uncertain-significance, Sanfilippo syndrome | 64,759,444(+) | GGGGG/GGGGGG | upstream_transcript_variant | |
rs200441930 | uncertain-significance, not specified, Sanfilippo syndrome | 64,759,273(+) | G/A/C | upstream_transcript_variant | |
rs540537083 | uncertain-significance, Sanfilippo syndrome | 64,759,204(+) | C/G/T | upstream_transcript_variant | |
rs559286032 | uncertain-significance, Sanfilippo syndrome | 64,759,301(+) | CGGGACGGGACGGGACGG/CGGGACGGGACGGGACGGGACGG | upstream_transcript_variant | |
rs61743823 | uncertain-significance, benign, Sanfilippo syndrome, not specified | 64,759,256(+) | G/C | upstream_transcript_variant |
Additional Variant Information for TBC1D30 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TBC1D30 Gene
Disorders for TBC1D30 Gene
Additional Disease Information for TBC1D30
- Genetic Association Database
- (GAD)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No disorders were found for TBC1D30 Gene.
No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TBC1D30 Gene
Publications for TBC1D30 Gene
- Common genetic variation and performance on standardized cognitive tests. (PMID: 20125193) Cirulli ET … Goldstein DB (European journal of human genetics : EJHG 2010) 3 44 58
- Identification and characterization of a novel Tre-2/Bub2/Cdc16 (TBC) protein that possesses Rab3A-GAP activity. (PMID: 19077034) Ishibashi K … Fukuda M (Genes to cells : devoted to molecular & cellular mechanisms 2009) 3 4 58
- Functional dissection of Rab GTPases involved in primary cilium formation. (PMID: 17646400) Yoshimura S … Barr FA (The Journal of cell biology 2007) 2 3 58
- Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
- GAPs galore! A survey of putative Ras superfamily GTPase activating proteins in man and Drosophila. (PMID: 12618308) Bernards A (Biochimica et biophysica acta 2003) 2 3 58
Products for TBC1D30 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Browse OriGene Antibodies
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for TBC1D30
- Origene Custom Protein Services for TBC1D30
- Origene shrna, sirna, and RNAi products in human, mouse, rat for TBC1D30
- Browse OriGene Inhibitory RNA Products For TBC1D30
- Browse OriGene qPCR primer pairs and template standards
- OriGene CRISPR knockouts for TBC1D30
- OriGene ORF clones in human for TBC1D30
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For TBC1D30
- GenScript: Next-day shipping of latest version cDNA ORF clones for TBC1D30 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for TBC1D30
- GenScript Custom Assay Services for TBC1D30
- GenScript Custom overexpressing Cell Line Services for TBC1D30
- GenScript: Design CRISPR guide RNA sequences for TBC1D30
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for TBC1D30
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for TBC1D30
- Novus Biologicals proteins for TBC1D30
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Invitrogen Antibodies for TBC1D30
- Cyagen custom Knockout/knockin (KOKI) mouse models for TBC1D30
- VectorBuilder custom plasmid, inducible vectors for TBC1D30
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for TBC1D30
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for available TBC1D30 related products ranked by validation data
- antibodies-online: Search results for available TBC1D30 related products ranked by validation data
- antibodies-online: Search results for 2 available TBC1D30 Proteins ranked by validation data
- Compare Top TBC1D30 Proteins
- Quality Products:
- Search GeneTex for Antibodies for TBC1D30
- Search GeneTex for Proteins for TBC1D30
- ViGene Biosciences adenoviral particle packaged cDNA for TBC1D30 gene
- ViGene Biosciences lentiviral particle packaged cDNA for TBC1D30 gene
- ViGene Biosciences ready-to-package AAV shRNAs for TBC1D30 gene
- Search ViGene Biosciences for TBC1D30
- Horizon Cell Lines for TBC1D30
- genomics-online: cdna clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
- orf clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
- genomics-online: gRNA clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
- genomics-online: primer clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
- genomics-online: shRNA clones - Search results for 44 available TBC1D30 gene related products
- Overview of 44 available TBC1D30 gene related products
Sources for TBC1D30 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew