Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



TBC1D22A Gene

protein-coding   GIFtS: 49
GCID: GC22P047158

TBC1 Domain Family, Member 22A

(Previous name: chromosome 22 open reading frame 4)
(Previous symbol: C22orf4)
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
TBC1 Domain Family, Member 22A1 2
C22orf41 2 3
Chromosome 22 Open Reading Frame 41
HSC79E0212
Putative GTPase Activator2
TBC1 Domain Family Member 22A2

External Ids:    HGNC: 13091   Entrez Gene: 257712   Ensembl: ENSG000000546117   UniProtKB: Q8WUA73   

Export aliases for TBC1D22A gene to outside databases

Previous GC identifers: GC22P045480 GC22P030103


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

GeneCards Summary for TBC1D22A Gene:
TBC1D22A (TBC1 domain family, member 22A) is a protein-coding gene. Diseases associated with TBC1D22A include aids dementia complex, and attention deficit hyperactivity disorder. GO annotations related to this gene include Rab GTPase activator activity and protein homodimerization activity. An important paralog of this gene is TBCK.

UniProtKB/Swiss-Prot: TB22A_HUMAN, Q8WUA7
Function: May act as a GTPase-activating protein for Rab family protein(s) (By similarity)




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000022.11  NT_011520.13  NC_018933.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the TBC1D22A gene promoter:
         c-Fos   SREBP-1a   AP-1   SREBP-1c   ATF-2   c-Jun   SREBP-1b   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): TBC1D22A promoter sequence
   Search Chromatin IP Primers for TBC1D22A

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat TBC1D22A


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 22q13.3   Ensembl cytogenetic band:  22q13.31   HGNC cytogenetic band: 22q13

TBC1D22A Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TBC1D22A gene location

GeneLoc information about chromosome 22         GeneLoc Exon Structure

GeneLoc location for GC22P047158:  view genomic region     (about GC identifiers)

Start:
47,158,518 bp from pter      End:
47,571,342 bp from pter
Size:
412,825 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: TB22A_HUMAN, Q8WUA7 (See protein sequence)
Recommended Name: TBC1 domain family member 22A  
Size: 517 amino acids; 59121 Da
Subunit: Homodimer
Sequence caution: Sequence=CAB46628.1; Type=Erroneous initiation;
1 PDB 3D structure from and Proteopedia for TBC1D22A:
2QFZ (3D)    
Secondary accessions: B0QYI2 Q5TE47 Q6ZUH2 Q92680 Q9BVD6 Q9UGG0 Q9UGT2 Q9UGU6 Q9UH25 Q9Y4W5
Alternative splicing: 3 isoforms:  Q8WUA7-1   Q8WUA7-2   Q8WUA7-3   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for TBC1D22A: NX_Q8WUA7

Explore proteomics data for TBC1D22A at MOPED

Post-translational modifications: 

  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus

  • See TBC1D22A Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (4 alternative transcripts): 
    NP_001271232.1  NP_001271233.1  NP_001271234.1  NP_055161.1  

    ENSEMBL proteins: 
     ENSP00000336724   ENSP00000398828   ENSP00000384036   ENSP00000347932   ENSP00000377964  
     ENSP00000406214   ENSP00000385634   ENSP00000370383  

    TBC1D22A Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec
    OriGene Custom Protein Services for TBC1D22A
    GenScript Custom Purified and Recombinant Proteins Services for TBC1D22A
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for TBC1D22A

    TBC1D22A Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for TBC1D22A
    Novus Biologicals TBC1D22A Antibodies
    Search for Antibodies for TBC1D22A at Abcam
    Cloud-Clone Corp. Antibodies for TBC1D22A
    ThermoFisher Antibodies for TBC1D22A
    LSBio Antibodies in human, mouse, rat for TBC1D22A

    TBC1D22A Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for TBC1D22A
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for TBC1D22A
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for TBC1D22A
    Cloud-Clone Corp. CLIAs for TBC1D22A


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    1 InterPro protein domain:
     IPR000195 Rab-GTPase-TBC_dom

    Graphical View of Domain Structure for InterPro Entry Q8WUA7

    ProtoNet protein and cluster: Q8WUA7

    1 Blocks protein domain: IPB000195 RabGAP/TBC domain

    UniProtKB/Swiss-Prot: TB22A_HUMAN, Q8WUA7
    Similarity: Contains 1 Rab-GAP TBC domain


    TBC1D22A for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: TB22A_HUMAN, Q8WUA7
    Function: May act as a GTPase-activating protein for Rab family protein(s) (By similarity)

         Gene Ontology (GO): 2 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005097Rab GTPase activator activity IEA--
    GO:0042803protein homodimerization activity IDA18186464
         
    TBC1D22A for ontologies           About GeneDecksing


    Phenotypes:
         3 GenomeRNAi human phenotypes for TBC1D22A:
     Decreased Salmonella enterica   Decreased Wnt reporter activit  Increased S DNA content 

    Animal Models:
       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for TBC1D22A
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for TBC1D22A

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for TBC1D22A
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for TBC1D22A

    miRNA
    Products:
        
    miRTarBase miRNAs that target TBC1D22A:
    hsa-mir-484 (MIRT041734), hsa-mir-342-5p (MIRT038218)

    Block miRNA regulation of human, mouse, rat TBC1D22A using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate TBC1D22A (see all 11):
    hsa-miR-579 hsa-miR-31 hsa-miR-1271 hsa-miR-516b* hsa-miR-421 hsa-miR-9 hsa-miR-182 hsa-miR-130b*
    SwitchGear 3'UTR luciferase reporter plasmidTBC1D22A 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for TBC1D22A
    Predesigned siRNA for gene silencing in human, mouse, rat TBC1D22A

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for TBC1D22A

    Clone
    Products:
         
    OriGene clones in human, mouse for TBC1D22A (see all 9)
    OriGene ORF clones in mouse, rat for TBC1D22A
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: TBC1D22A (NM_014346)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TBC1D22A
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TBC1D22A

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for TBC1D22A
    Browse ESI BIO Cell Lines and PureStem Progenitors for TBC1D22A 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TBC1D22A


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    cytosol1
    golgi apparatus1
    mitochondrion1
    nucleus1

    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus



        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for TBC1D22A
    Interactions:

        Search GeneGlobe Interaction Network for TBC1D22A

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for TBC1D22A (ENSP000003367244) via UniProtKB, MINT, STRING, and/or I2D (see all 92)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    COG6ENSP000003974414STRING: ENSP00000397441
    COG8ENSP000003054594STRING: ENSP00000305459
    SYS1ENSP000002439184STRING: ENSP00000243918
    ARFRP1ENSP000003268844STRING: ENSP00000326884
    ARL1ENSP000002616364STRING: ENSP00000261636
    About this table

    Gene Ontology (GO): 1 biological process term:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0032313regulation of Rab GTPase activity ----

    TBC1D22A for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for TBC1D22A (TB22A)



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for TBC1D22A gene (4 alternative transcripts): 
    NM_001284303.1  NM_001284304.1  NM_001284305.1  NM_014346.3  

    Unigene Cluster for TBC1D22A:

    TBC1 domain family, member 22A
    Hs.435044  [show with all ESTs]
    Unigene Representative Sequence: NM_014346
    11 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000337137(uc003bib.3 uc010haf.3 uc003bie.3 uc010hag.3 uc003bif.3)
    ENST00000441936 ENST00000486163 ENST00000407381 ENST00000355704 ENST00000394449
    ENST00000496139 ENST00000472791 ENST00000441162 ENST00000406733 ENST00000380995

    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat TBC1D22A using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate TBC1D22A (see all 11):
    hsa-miR-579 hsa-miR-31 hsa-miR-1271 hsa-miR-516b* hsa-miR-421 hsa-miR-9 hsa-miR-182 hsa-miR-130b*
    SwitchGear 3'UTR luciferase reporter plasmidTBC1D22A 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for TBC1D22A
    Predesigned siRNA for gene silencing in human, mouse, rat TBC1D22A
    Clone
    Products:
         
    OriGene clones in human, mouse for TBC1D22A (see all 9)
    OriGene ORF clones in mouse, rat for TBC1D22A
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: TBC1D22A (NM_014346)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TBC1D22A
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TBC1D22A
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for TBC1D22A
    OriGene qSTAR qPCR primer pairs in human, mouse for TBC1D22A
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TBC1D22A
      QuantiTect SYBR Green Assays in human, mouse, rat TBC1D22A
      QuantiFast Probe-based Assays in human, mouse, rat TBC1D22A

    Additional mRNA sequence: 

    AB449908.1 AK000851.1 AK055591.1 AK125705.1 AK127653.1 AK301445.1 AK308039.1 AK315779.1 
    AL096779.1 BC001292.1 BC002743.2 BC020976.1 BC022417.1 BC029897.1 CR456412.1 

    24 DOTS entries:

    DT.100682942  DT.92414941  DT.100757874  DT.100642727  DT.412945  DT.100820821  DT.120631928  DT.211074 
    DT.100820815  DT.100820817  DT.95246684  DT.91728665  DT.100732631  DT.100724646  DT.100765391  DT.95368951 
    DT.100820823  DT.100837348  DT.91728668  DT.95082528  DT.95246679  DT.95246687  DT.99974755  DT.95246685 

    Selected AceView cDNA sequences (see all 318):

    H55580 BE466638 AA806731 AI092397 BI093563 H55231 CR590637 BM773251 
    AA782652 BG761583 BM919932 BM562677 BX385175 CR621287 BM743647 CR456412 
    BC020976 BI763082 BG284030 BE549849 BM794724 BG760278 BM742443 BU789400 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for TBC1D22A (see all 11)    About this scheme

    ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10 ^ 11a · 11b ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19a · 19b · 19c ·
    SP1:                                      -     -                                                     -           -                 -                           
    SP2:                    -     -     -     -     -                 -                                   -           -                 -                           
    SP3:                                                                                                                                -                           
    SP4:                                      -     -                 -                                                                                             
    SP5:                                      -     -                       -                                                                                       

    ExUns: 19d
    SP1:      
    SP2:      
    SP3:      
    SP4:      
    SP5:      


    ECgene alternative splicing isoforms for TBC1D22A

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    TBC1D22A expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: AGCAAGCTGC
    TBC1D22A Expression
    About this image

    TBC1D22A Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    TBC1D22A Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.435044
        Custom PCR Arrays for TBC1D22A
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for TBC1D22A
    OriGene qSTAR qPCR primer pairs in human, mouse for TBC1D22A
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TBC1D22A
    QuantiTect SYBR Green Assays in human, mouse, rat TBC1D22A
    QuantiFast Probe-based Assays in human, mouse, rat TBC1D22A
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TBC1D22A

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals and fungi.

    Orthologs for TBC1D22A gene from Selected species (see all 15)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Tbc1d22a1 , 5 TBC1 domain family, member 22a1, 5 85.72(n)1
    90.12(a)1
      15 (40.56 cM)5
    2237541  NM_145476.21  NP_663451.21 
     862144595 
    chicken
    (Gallus gallus)
    Aves TBC1D22A1 TBC1 domain family, member 22A 72.66(n)
    80.08(a)
      428128  NM_001031490.1  NP_001026661.1 
    lizard
    (Anolis carolinensis)
    Reptilia TBC1D22A6
    TBC1 domain family, member 22A
    74(a)
    1 ↔ 1
    5(72349436-72536397)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.146732 Xenopus laevis transcribed sequence with moderate similarity more 76.79(n)    BJ083549.1 
    zebrafish
    (Danio rerio)
    Actinopterygii Dr.262702 Transcribed sequences 75.06(n)    CD603879.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG57456
    --
    41(a)
    1 → many
    3R(16927921-16930835)
    worm
    (Caenorhabditis elegans)
    Secernentea tbc-36
    Protein TBC-3, isoform a
    45(a)
    1 → many
    IV(9899012-9902500) WBGene00009322
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes GYP16
    Cis-golgi GTPase-activating protein (GAP) for the ...
    27(a)
    1 → many
    XV(455907-457820) YOR070C


    ENSEMBL Gene Tree for TBC1D22A (if available)
    TreeFam Gene Tree for TBC1D22A (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for TBC1D22A gene
    TBCK2  TBC1D22B2  
    10 SIMAP similar genes for TBC1D22A using alignment to 6 protein entries:     TB22A_HUMAN (see all proteins):
    TMEM145    DKFZp762J0110    COPS7B    TBC1D22B    MEF2BNB    RANBP3
    HDGFRP2    SLC4A8    NDUFA7    TBC1D13

    TBC1D22A for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for TBC1D22A (see all 10634)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 22 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs681481571,2
    C--30485088(+) TTCACGGGTGCAGCCCGTGAAGGTGCCT
    GCTGGCTGAGATCCTGGGACT
    /-
    GGGTG
    1 -- int11Minor allele frequency- -:0.50NA 2
    rs1318721,2
    C--31192621(+) CTCAG-/CCTCTGC
    GGGTTGTGG
    TTCCG
    1 -- int11Minor allele frequency- CCTCTGCGGGTTGTGG:0.00NA 2
    rs1486160921,2
    --47156547(+) AAGAGA/CGTTCT 1 -- us2k10--------
    rs1881087551,2
    --47156596(+) AAGACA/CGGTTT 1 -- us2k10--------
    rs57691361,2
    C,F,A,H--47156703(+) TTCCAT/CTCCAT 1 -- us2k122Minor allele frequency- C:0.37NS EA NA WA CSA 2483
    rs755668231,2
    F--47156769(+) CATCTG/ATATTA 1 -- us2k11Minor allele frequency- A:0.01WA 118
    rs81409831,2
    C,F,H--47156995(+) TTTTCC/TTCTGT 1 -- us2k1 trp313Minor allele frequency- T:0.09NS EA NA WA CSA 1309
    rs1420470131,2
    --47156996(+) TTTCCC/TCTGTC 1 -- us2k10--------
    rs1927900891,2
    --47157039(+) CATCAC/GGTTAA 1 -- us2k10--------
    rs1477462671,2
    --47157057(+) GTCACC/GTCGCT 1 -- us2k10--------

    HapMap Linkage Disequilibrium report for TBC1D22A (47158518 - 47408518 bp, first 250kb of TBC1D22A)

    Structural Variations
         Database of Genomic Variants (DGV) Selected variations for TBC1D22A (see all 89):    About this table    
    Variant IDTypeSubtypePubMed ID
    nsv820597CNV Deletion20802225
    esv2658255CNV Deletion23128226
    esv2279886CNV Deletion18987734
    esv2724477CNV Deletion23290073
    esv2724463CNV Deletion23290073
    esv2669936CNV Deletion23128226
    esv2724469CNV Deletion23290073
    esv2665891CNV Deletion23128226
    dgv789e201CNV Deletion23290073
    esv2665140CNV Deletion23128226

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing TBC1D22A
    DNA2.0 Custom Variant and Variant Library Synthesis for TBC1D22A

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    4 diseases for TBC1D22A:    
    About MalaCards
    aids dementia complex    attention deficit hyperactivity disorder    dementia    parkinson's disease


    TBC1D22A for disorders           About GeneDecksing

    Genetic Association Database (GAD): TBC1D22A
    Human Genome Epidemiology (HuGE) Navigator: TBC1D22A (1 document)

    Export disorders for TBC1D22A gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for TBC1D22A gene, integrated from 10 sources (see all 24):
    (articles sorted by number of sources associating them with TBC1D22A)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1, 4 Rose J.E....Uhl G.R. (Mol. Med. 2010)
    2. Joint influence of small-effect genetic variants on human longevity. (PubMed id 20834067)1, 4 Yashin A.I....Ukraintseva S.V. (Aging (Albany NY) 2010)
    3. First crystallographic models of human TBC domains in the context of a family-wide structural analysis. (PubMed id 18186464)1, 2 Tempel W.... Park H. (Proteins 2008)
    4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (Nat. Genet. 2004)
    6. A genome annotation-driven approach to cloning the human ORFeome. (PubMed id 15461802)1, 2 Collins J.E.... Dunham I. (Genome Biol. 2004)
    7. Reevaluating human gene annotation: a second-generation analysis of chromosome 22. (PubMed id 12529303)1, 2 Collins J.E.... Dunham I. (Genome Res. 2003)
    8. The DNA sequence of human chromosome 22. (PubMed id 10591208)1, 2 Dunham I.... Wright H. (Nature 1999)
    9. ACBD3 interaction with TBC1 domain 22 protein is differentially affected by enteroviral and kobuviral 3A protein binding. (PubMed id 23572552)1 Greninger A.L....DeRisi J.L. (MBio 2013)
    10. Protein interaction network of the mammalian Hippo pathway reveals mechanisms of kinase-phosphatase interactions. (PubMed id 24255178)1 Couzens A.L....Gingras A.C. (Sci Signal 2013)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 25771 HGNC: 1309 AceView: C22orf4 Ensembl:ENSG00000054611 euGenes: HUgn25771
    ECgene: TBC1D22A H-InvDB: TBC1D22A

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for TBC1D22A Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for TBC1D22A gene:
    Search GeneIP for patents involving TBC1D22A

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for TBC1D22A  
     OriGene qPCR primer pairs and template standards for TBC1D22A   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for TBC1D22A  
     OriGene qSTAR qPCR primer pairs in human, mouse for TBC1D22A   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for TBC1D22A   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for TBC1D22A   OriGene Custom Protein Services for TBC1D22A  

     
     
     Block miRNA regulation of human, mouse, rat TBC1D22A using miScript Target Protectors SeqTarget long-range PCR primers for resequencing TBC1D22A
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat TBC1D22A Predesigned siRNA for gene silencing in human, mouse, rat TBC1D22A
     QuantiFast Probe-based Assays in human, mouse, rat TBC1D22A QuantiTect SYBR Green Assays in human, mouse, rat TBC1D22A
     Custom PCR Arrays for TBC1D22A Search Chromatin IP Primers for TBC1D22A
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat TBC1D22A  Search GeneGlobe Interaction Network for TBC1D22A
     Regulatory tfbs in TBC1D22A promoter
     GenScript Custom Purified and Recombinant Proteins Services for TBC1D22A GenScript cDNA clones with any tag delivered in your preferred vector for TBC1D22A
     GenScript Custom Assay Services for TBC1D22A GenScript Custom overexpressing Cell Line Services for TBC1D22A
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for TBC1D22A (TB22A)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     TBC1D22A antibodies
     Search for Antibodies for TBC1D22A at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for TBC1D22A
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for TBC1D22A
     Antibodies for TBC1D22A
     ELISAs for TBC1D22A
     CLIAs for TBC1D22A



     Browse ESI BIO Cell Lines and PureStem Progenitors for TBC1D22A
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TBC1D22A
     SwitchGear 3'UTR luciferase reporter plasmids for TBC1D22A
     SwitchGear Promoter luciferase reporter plasmids for TBC1D22A
     ThermoFisher Antibodies for TBC1D22A
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TBC1D22A
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for TBC1D22A
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for TBC1D22A
     LSBio Antibodies in human, mouse, rat for TBC1D22A
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      TBC1D22A gene at Home site.
    Version: 3.12.166 28 Aug 2014
    hostname: 356977-web1.xennexinc.com index build: 126 solr: 1.4