Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

TBC1D22A Gene

protein-coding   GIFtS: 48
GCID: GC22P047158

TBC1 Domain Family, Member 22A

(Previous name: chromosome 22 open reading frame 4)
(Previous symbol: C22orf4)
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
TBC1 Domain Family, Member 22A1 2
C22orf41 2 3
Chromosome 22 Open Reading Frame 41
HSC79E0212
Putative GTPase Activator2
TBC1 Domain Family Member 22A2

External Ids:    HGNC: 13091   Entrez Gene: 257712   Ensembl: ENSG000000546117   UniProtKB: Q8WUA73   

Export aliases for TBC1D22A gene to outside databases

Previous GC identifers: GC22P045480 GC22P030103


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

GeneCards Summary for TBC1D22A Gene: 
TBC1D22A (TBC1 domain family, member 22A) is a protein-coding gene. Diseases associated with TBC1D22A include aids dementia complex, and dementia. GO annotations related to this gene include Rab GTPase activator activity and protein homodimerization activity. An important paralog of this gene is TBC1D22B.

UniProtKB/Swiss-Prot: TB22A_HUMAN, Q8WUA7
Function: May act as a GTPase-activating protein for Rab family protein(s) (By similarity)




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000022.10  NT_011520.12  NC_018933.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the TBC1D22A gene promoter:
         c-Fos   SREBP-1a   AP-1   SREBP-1c   ATF-2   c-Jun   SREBP-1b   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): TBC1D22A promoter sequence
   Search SABiosciences Chromatin IP Primers for TBC1D22A

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TBC1D22A


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 22q13.3   Ensembl cytogenetic band:  22q13.31   HGNC cytogenetic band: 22q13

TBC1D22A Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
TBC1D22A gene location

GeneLoc information about chromosome 22         GeneLoc Exon Structure

GeneLoc location for GC22P047158:  view genomic region     (about GC identifiers)

Start:
47,158,518 bp from pter      End:
47,571,342 bp from pter
Size:
412,825 bases      Orientation:
plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: TB22A_HUMAN, Q8WUA7 (See protein sequence)
Recommended Name: TBC1 domain family member 22A  
Size: 517 amino acids; 59121 Da
Subunit: Homodimer
Sequence caution: Sequence=CAB46628.1; Type=Erroneous initiation;
1 PDB 3D structure from and Proteopedia for TBC1D22A:
2QFZ (3D)    
Secondary accessions: B0QYI2 Q5TE47 Q6ZUH2 Q92680 Q9BVD6 Q9UGG0 Q9UGT2 Q9UGU6 Q9UH25 Q9Y4W5
Alternative splicing: 3 isoforms:  Q8WUA7-1   Q8WUA7-2   Q8WUA7-3   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for TBC1D22A: NX_Q8WUA7

Explore proteomics data for TBC1D22A at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q8WUA7

  • TBC1D22A Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    TBC1D22A Protein Expression
    REFSEQ proteins (4 alternative transcripts): 
    NP_001271232.1  NP_001271233.1  NP_001271234.1  NP_055161.1  

    ENSEMBL proteins: 
     ENSP00000336724   ENSP00000398828   ENSP00000384036   ENSP00000347932   ENSP00000377964  
     ENSP00000406214   ENSP00000385634   ENSP00000370383  

    Human Recombinant Protein Products for TBC1D22A: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec 
    OriGene Custom Protein Services for TBC1D22A
    GenScript Custom Purified and Recombinant Proteins Services for TBC1D22A
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for TBC1D22A 

    Gene Ontology (GO): 1 cellular component term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005622intracellular ----

    TBC1D22A for ontologies           About GeneDecksing



    TBC1D22A Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for TBC1D22A
    GenScript Custom Superior Antibodies Services for TBC1D22A
    Novus Biologicals TBC1D22A Antibodies
    Search for Antibodies for TBC1D22A at Abcam
    Cloud-Clone Corp. Antibodies for TBC1D22A 
    ThermoFisher Antibodies for TBC1D22A
    LSBio Antibodies in human, mouse, rat for TBC1D22A 

    Assay Products for TBC1D22A: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for TBC1D22A
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for TBC1D22A
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for TBC1D22A 
    Cloud-Clone Corp. CLIAs for TBC1D22A


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    1 InterPro protein domain:
     IPR000195 Rab-GTPase-TBC_dom

    Graphical View of Domain Structure for InterPro Entry Q8WUA7

    ProtoNet protein and cluster: Q8WUA7

    1 Blocks protein domain: IPB000195 RabGAP/TBC domain

    UniProtKB/Swiss-Prot: TB22A_HUMAN, Q8WUA7
    Similarity: Contains 1 Rab-GAP TBC domain


    TBC1D22A for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: TB22A_HUMAN, Q8WUA7
    Function: May act as a GTPase-activating protein for Rab family protein(s) (By similarity)

         Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005097Rab GTPase activator activity IEA--
    GO:0042803protein homodimerization activity IDA18186464
         
    TBC1D22A for ontologies           About GeneDecksing


    Phenotypes:
         3 GenomeRNAi human phenotypes for TBC1D22A:
     Decreased Salmonella enterica   Decreased Wnt reporter activit  Increased S DNA content 

    Animal Models:
       inGenious Targeting Laboratory - Custom generated mouse model solutions for TBC1D22A 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for TBC1D22A

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for TBC1D22A 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for TBC1D22A 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TBC1D22A
    8/11 QIAGEN miScript miRNA Assays for microRNAs that regulate TBC1D22A (see all 11):
    hsa-miR-579 hsa-miR-31 hsa-miR-1271 hsa-miR-516b* hsa-miR-421 hsa-miR-9 hsa-miR-182 hsa-miR-130b*
    SwitchGear 3'UTR luciferase reporter plasmidTBC1D22A 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for TBC1D22A
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TBC1D22A

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for TBC1D22A
    Sirion Biotech Customized adenovirus for overexpression of TBC1D22A

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for TBC1D22A (see all 7)
    OriGene ORF clones in mouse, rat for TBC1D22A
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: TBC1D22A (NM_014346)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TBC1D22A
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TBC1D22A
    Sirion Biotech Customized lentivirus for stable overexpression of TBC1D22A 
                         Customized lentivirus expression plasmids for stable overexpression of TBC1D22A 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for TBC1D22A
    Search LifeMap BioReagents cell lines for TBC1D22A
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TBC1D22A


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for TBC1D22A

    STRING Interaction Network Preview (showing 4 interactants - click image to see more details)

    4 Interacting proteins for TBC1D22A (ENSP000003367244) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    RER1ENSP000003020884STRING: ENSP00000302088
    CYP51A1ENSP000000031004STRING: ENSP00000003100
    TRAPPC1ENSP000003027834STRING: ENSP00000302783
    FA2HENSP000002193684STRING: ENSP00000219368
    About this table

    Gene Ontology (GO): 1 biological process term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0032313regulation of Rab GTPase activity ----

    TBC1D22A for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for TBC1D22A (TB22A)

    Search CenterWatch for drugs/clinical trials and news about TBC1D22A / TB22A

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for TBC1D22A gene (4 alternative transcripts): 
    NM_001284303.1  NM_001284304.1  NM_001284305.1  NM_014346.3  

    Unigene Cluster for TBC1D22A:

    TBC1 domain family, member 22A
    Hs.435044  [show with all ESTs]
    Unigene Representative Sequence: NM_014346
    11 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000337137(uc003bib.3 uc010haf.3 uc003bie.3 uc010hag.3 uc003bif.3)
    ENST00000441936 ENST00000486163 ENST00000407381 ENST00000355704 ENST00000394449
    ENST00000496139 ENST00000472791 ENST00000441162 ENST00000406733 ENST00000380995

    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat TBC1D22A
    8/11 QIAGEN miScript miRNA Assays for microRNAs that regulate TBC1D22A (see all 11):
    hsa-miR-579 hsa-miR-31 hsa-miR-1271 hsa-miR-516b* hsa-miR-421 hsa-miR-9 hsa-miR-182 hsa-miR-130b*
    SwitchGear 3'UTR luciferase reporter plasmidTBC1D22A 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for TBC1D22A
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TBC1D22A
    Clone
    Products:
         
    OriGene clones in human, mouse for TBC1D22A (see all 7)
    OriGene ORF clones in mouse, rat for TBC1D22A
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: TBC1D22A (NM_014346)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for TBC1D22A
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TBC1D22A
    Sirion Biotech Customized lentivirus for stable overexpression of TBC1D22A 
                         Customized lentivirus expression plasmids for stable overexpression of TBC1D22A 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for TBC1D22A
    OriGene qSTAR qPCR primer pairs in human, mouse for TBC1D22A
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TBC1D22A
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TBC1D22A
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TBC1D22A

    Additional mRNA sequence: 

    AB449908.1 AK000851.1 AK055591.1 AK125705.1 AK127653.1 AK301445.1 AK308039.1 AK315779.1 
    AL096779.1 BC001292.1 BC002743.2 BC020976.1 BC022417.1 BC029897.1 CR456412.1 

    24 DOTS entries:

    DT.100682942  DT.92414941  DT.100757874  DT.100642727  DT.412945  DT.100820821  DT.120631928  DT.211074 
    DT.100820815  DT.100820817  DT.95246684  DT.91728665  DT.100732631  DT.100724646  DT.100765391  DT.95368951 
    DT.100820823  DT.100837348  DT.91728668  DT.95082528  DT.95246679  DT.95246687  DT.99974755  DT.95246685 

    24/318 AceView cDNA sequences (see all 318):

    BM700002 AW027704 BE732749 BU625685 CR593690 BX424603 BE794606 BX407409 
    CR590373 NM_014346 BG760263 BF223895 AA146658 BE395548 AA765901 CA392889 
    CR607393 BI821853 CR597368 BM975735 BM764970 BG686734 H55282 BQ355023 

    GeneLoc Exon Structure

    5/11 Alternative Splicing Database (ASD) splice patterns (SP) for TBC1D22A (see all 11)    About this scheme

    ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10 ^ 11a · 11b ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19a · 19b · 19c ·
    SP1:                                      -     -                                                     -           -                 -                           
    SP2:                    -     -     -     -     -                 -                                   -           -                 -                           
    SP3:                                                                                                                                -                           
    SP4:                                      -     -                 -                                                                                             
    SP5:                                      -     -                       -                                                                                       

    ExUns: 19d
    SP1:      
    SP2:      
    SP3:      
    SP4:      
    SP5:      


    ECgene alternative splicing isoforms for TBC1D22A

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TBC1D22A expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: AGCAAGCTGC
    TBC1D22A Expression
    About this image


    See TBC1D22A Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for TBC1D22A

    SOURCE GeneReport for Unigene cluster: Hs.435044
        SABiosciences Custom PCR Arrays for TBC1D22A
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for TBC1D22A
    OriGene qSTAR qPCR primer pairs in human, mouse for TBC1D22A
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat TBC1D22A
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TBC1D22A
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TBC1D22A
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TBC1D22A

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals and fungi.

    Orthologs for TBC1D22A gene from 8/16 species (see all 16)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Tbc1d22a1 , 5 TBC1 domain family, member 22a1, 5 85.72(n)1
    90.12(a)1
      15 (40.56 cM)5
    2237541  NM_145476.21  NP_663451.21 
     862144595 
    chicken
    (Gallus gallus)
    Aves TBC1D22A1 TBC1 domain family, member 22A 72.66(n)
    80.08(a)
      428128  NM_001031490.1  NP_001026661.1 
    lizard
    (Anolis carolinensis)
    Reptilia TBC1D22A6
    TBC1 domain family, member 22A
    74(a)
    1 ↔ 1
    5(72349436-72536397)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.146732 Xenopus laevis transcribed sequence with moderate similarity more 76.79(n)    BJ083549.1 
    zebrafish
    (Danio rerio)
    Actinopterygii Dr.262702 Transcribed sequences 75.06(n)    CD603879.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG57456
    --
    41(a)
    1 → many
    3R(16927921-16930835)
    worm
    (Caenorhabditis elegans)
    Secernentea tbc-36
    Protein TBC-3, isoform a
    46(a)
    1 → many
    IV(9899012-9902500)
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes GYP11 Gyp1p 48.39(n)
    44.62(a)
      854236   NP_014713.1 


    ENSEMBL Gene Tree for TBC1D22A (if available)
    TreeFam Gene Tree for TBC1D22A (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for TBC1D22A gene
    TBC1D22B2  TBC1D132  TBC1D52  
    9 SIMAP similar genes for TBC1D22A using alignment to 6 protein entries:     TB22A_HUMAN (see all proteins):
    TMEM145    DKFZp762J0110    COPS7B    TBC1D22B    RANBP3    HDGFRP2
    SLC4A8    NDUFA7    TBC1D13

    TBC1D22A for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/10634 SNPs in TBC1D22A are shown (see all 10634)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 22 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs681481571,2
    C--30485088(+) TTCACGGGTGCAGCCCGTGAAGGTGCCT
    GCTGGCTGAGATCCTGGGACT
    /-
    GGGTG
    1 -- int11Minor allele frequency- -:0.50NA 2
    rs1318721,2
    C--31192621(+) CTCAG-/CCTCTGC
    GGGTTGTGG
    TTCCG
    1 -- int11Minor allele frequency- CCTCTGCGGGTTGTGG:0.00NA 2
    rs1486160921,2
    --47156547(+) AAGAGA/CGTTCT 1 -- us2k10--------
    rs1881087551,2
    --47156596(+) AAGACA/CGGTTT 1 -- us2k10--------
    rs57691361,2
    C,F,A,H--47156703(+) TTCCAT/CTCCAT 1 -- us2k122Minor allele frequency- C:0.37NS EA NA WA CSA 2483
    rs755668231,2
    F--47156769(+) CATCTG/ATATTA 1 -- us2k11Minor allele frequency- A:0.01WA 118
    rs81409831,2
    C,F,H--47156995(+) TTTTCC/TTCTGT 1 -- us2k1 trp313Minor allele frequency- T:0.09NS EA NA WA CSA 1309
    rs1420470131,2
    --47156996(+) TTTCCC/TCTGTC 1 -- us2k10--------
    rs1927900891,2
    --47157039(+) CATCAC/GGTTAA 1 -- us2k10--------
    rs1477462671,2
    --47157057(+) GTCACC/GTCGCT 1 -- us2k10--------

    HapMap Linkage Disequilibrium report for TBC1D22A (47158518 - 47408518 bp, first 250kb of TBC1D22A)

    Structural Variations
         Database of Genomic Variants (DGV) 10/89 variations for TBC1D22A (see all 89):    About this table     
    Variant IDTypeSubtypePubMed ID
    nsv820597CNV Deletion20802225
    esv2658255CNV Deletion23128226
    esv2279886CNV Deletion18987734
    esv2724477CNV Deletion23290073
    esv2724463CNV Deletion23290073
    esv2669936CNV Deletion23128226
    esv2724469CNV Deletion23290073
    esv2665891CNV Deletion23128226
    dgv789e201CNV Deletion23290073
    esv2665140CNV Deletion23128226

    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing TBC1D22A
    DNA2.0 Custom Variant and Variant Library Synthesis for TBC1D22A

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    2 diseases for TBC1D22A:    About MalaCards
    aids dementia complex    dementia


    TBC1D22A for disorders           About GeneDecksing

    Genetic Association Database (GAD): TBC1D22A
    Human Genome Epidemiology (HuGE) Navigator: TBC1D22A (1 document)

    Export disorders for TBC1D22A gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for TBC1D22A gene, integrated from 9 sources (see all 23):
    (articles sorted by number of sources associating them with TBC1D22A)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1, 4 Rose J.E....Uhl G.R. (2010)
    2. Joint influence of small-effect genetic variants on h uman longevity. (PubMed id 20834067)1, 4 Yashin A.I....Ukraintseva S.V. (2010)
    3. First crystallographic models of human TBC domains in the context of a family-wide structural analysis. (PubMed id 18186464)1, 2 Tempel W.... Park H. (2008)
    4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    6. A genome annotation-driven approach to cloning the human ORFeome. (PubMed id 15461802)1, 2 Collins J.E.... Dunham I. (2004)
    7. Reevaluating human gene annotation: a second-generation analysis of chromosome 22. (PubMed id 12529303)1, 2 Collins J.E.... Dunham I. (2003)
    8. The DNA sequence of human chromosome 22. (PubMed id 10591208)1, 2 Dunham I....O'Brien K.P. (1999)
    9. ACBD3 interaction with TBC1 domain 22 protein is diffe rentially affected by enteroviral and kobuviral 3A protein binding. (PubMed id 23572552)1 Greninger A.L....DeRisi J.L. (2013)
    10. System-wide temporal characterization of the proteome and phosphoproteome of human embryonic stem cell differentiation. (PubMed id 21406692)2 Rigbolt K.T....Blagoev B. (2011)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 25771 HGNC: 1309 AceView: C22orf4 Ensembl:ENSG00000054611 euGenes: HUgn25771
    ECgene: TBC1D22A H-InvDB: TBC1D22A

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for TBC1D22A Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for TBC1D22A gene:
    Search GeneIP for patents involving TBC1D22A

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for TBC1D22A  
     OriGene qPCR primer pairs and template standards for TBC1D22A   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for TBC1D22A  
     OriGene qSTAR qPCR primer pairs in human, mouse for TBC1D22A   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for TBC1D22A   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for TBC1D22A   OriGene Custom Protein Services for TBC1D22A  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat TBC1D22A
     QIAGEN SeqTarget long-range PCR primers for resequencing TBC1D22A
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat TBC1D22A
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat TBC1D22A
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat TBC1D22A
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat TBC1D22A
     GenScript Custom Purified and Recombinant Proteins Services for TBC1D22A GenScript cDNA clones with any tag delivered in your preferred vector for TBC1D22A
     GenScript Custom Assay Services for TBC1D22A GenScript Custom Superior Antibodies Services for TBC1D22A
     GenScript Custom overexpressing Cell Line Services for TBC1D22A CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in TBC1D22A promoter
     Search Chromatin IP Primers for TBC1D22A
     RT2 qPCR Primer Assay in human, mouse, rat TBC1D22A
     Search GNC Networks for TBC1D22A
     SABiosciences Custom PCR Arrays for TBC1D22A
     Search Tocris compounds for TBC1D22A (TB22A)
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     TBC1D22A antibodies
     Search for Antibodies for TBC1D22A at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for TBC1D22A
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Proteins for TBC1D22A
     Antibodies for TBC1D22A
     ELISAs for TBC1D22A
     CLIAs for TBC1D22A
     Search LifeMap BioReagents cell lines for TBC1D22A
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for TBC1D22A
     SwitchGear 3'UTR luciferase reporter plasmids for TBC1D22A
     SwitchGear Promoter luciferase reporter plasmids for TBC1D22A
     ThermoFisher Antibodies for TBC1D22A
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat TBC1D22A
     inGenious Targeting Laboratory - Custom generated mouse model solutions for TBC1D22A
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for TBC1D22A
    Customized:
     lentivirus for stable overexpression of TBC1D22A
     lentivirus expression plasmids for stable overexpression of TBC1D22A
     adenovirus for overexpression of TBC1D22A
     LSBio Antibodies in human, mouse, rat for TBC1D22A
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      TBC1D22A gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4