Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SURF2 Gene

Aliases for SURF2 Gene

  • Surfeit 2 2 3 5
  • Surfeit Locus Protein 2 2 3
  • SURF-2 3 4

External Ids for SURF2 Gene

Previous GeneCards Identifiers for SURF2 Gene

  • GC09P127313
  • GC09P127780
  • GC09P129577
  • GC09P131499
  • GC09P133252
  • GC09P135213
  • GC09P136223
  • GC09P105723
  • GC09P133358
  • GC09P133364
  • GC09P133372
  • GC09P133385

Summaries for SURF2 Gene

Entrez Gene Summary for SURF2 Gene

  • This gene shares a bidirectional promoter with surfeit 1 (SURF1; GeneID: 6834), which is located on the opposite strand. It encodes a conserved protein that is expressed in a variety of tissues. [provided by RefSeq, Jul 2013]

GeneCards Summary for SURF2 Gene

SURF2 (Surfeit 2) is a Protein Coding gene.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SURF2 Gene

Genomics for SURF2 Gene

Regulatory Elements for SURF2 Gene

Enhancers for SURF2 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH09F133378 0.5 Ensembl 11.7 +22.3 22256 0.8 HDAC1 CREB3L1 ARID4B SIN3A DMAP1 ZBTB40 YY1 GLIS2 ZNF766 ZNF143 ADAMTS13 SURF1 SURF2 SNORD24 SNORD36A SNORD36B SNORD36C MED22 RPL7A ENSG00000230064
GH09F133267 0.2 ENCODE 11.2 -87.1 -87143 2.8 HDGF HDAC1 ATF1 PKNOX1 TBL1XR1 CREB3L1 NFRKB KLF17 RAD21 GLIS2 ABO ENSG00000201451 ENSG00000230064 SURF6 MED22 RPL7A SNORD24 SNORD36A SNORD36B SNORD36C
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around SURF2 on UCSC Golden Path with GeneCards custom track

Genomic Location for SURF2 Gene

133,356,545 bp from pter
133,361,169 bp from pter
4,625 bases
Plus strand

Genomic View for SURF2 Gene

Genes around SURF2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SURF2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SURF2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SURF2 Gene

Proteins for SURF2 Gene

  • Protein details for SURF2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Surfeit locus protein 2
    Protein Accession:
    Secondary Accessions:
    • Q6IBP9
    • Q96CD1

    Protein attributes for SURF2 Gene

    256 amino acids
    Molecular mass:
    29648 Da
    Quaternary structure:
    No Data Available

neXtProt entry for SURF2 Gene

Post-translational modifications for SURF2 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for SURF2 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for SURF2 Gene

Domains & Families for SURF2 Gene

Protein Domains for SURF2 Gene


Suggested Antigen Peptide Sequences for SURF2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the SURF2 family.
  • Belongs to the SURF2 family.
genes like me logo Genes that share domains with SURF2: view

No data available for Gene Families for SURF2 Gene

Function for SURF2 Gene

Molecular function for SURF2 Gene

GENATLAS Biochemistry:
surfeit 2 (see SURF@)

Gene Ontology (GO) - Molecular Function for SURF2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with SURF2: view

Phenotypes for SURF2 Gene

GenomeRNAi human phenotypes for SURF2:
genes like me logo Genes that share phenotypes with SURF2: view

Animal Model Products

miRNA for SURF2 Gene

miRTarBase miRNAs that target SURF2

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SURF2 Gene

Localization for SURF2 Gene

Subcellular locations from

Jensen Localization Image for SURF2 Gene COMPARTMENTS Subcellular localization image for SURF2 gene
Compartment Confidence
nucleus 5
plasma membrane 5
extracellular 2
cytosol 1

Gene Ontology (GO) - Cellular Components for SURF2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005575 cellular_component ND --
GO:0005634 nucleus IDA --
GO:0005730 nucleolus IDA --
GO:0005886 plasma membrane IDA --
genes like me logo Genes that share ontologies with SURF2: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for SURF2 Gene

Pathways & Interactions for SURF2 Gene

SuperPathways for SURF2 Gene

No Data Available

Gene Ontology (GO) - Biological Process for SURF2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008150 biological_process ND --
genes like me logo Genes that share ontologies with SURF2: view

No data available for Pathways by source and SIGNOR curated interactions for SURF2 Gene

Transcripts for SURF2 Gene

mRNA/cDNA for SURF2 Gene

Unigene Clusters for SURF2 Gene

Surfeit 2:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for SURF2 Gene

ExUns: 1a · 1b · 1c · 1d · 1e · 1f ^ 2a · 2b · 2c ^ 3a · 3b · 3c ^ 4 ^ 5 ^ 6a · 6b ^ 7
SP1: - - - -
SP2: - - -
SP3: - - - - - -
SP4: - - - - - - - -
SP5: - -
SP6: -

Relevant External Links for SURF2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SURF2 Gene

mRNA expression in normal human tissues for SURF2 Gene

mRNA differential expression in normal tissues according to GTEx for SURF2 Gene

This gene is overexpressed in Testis (x4.8).

Protein differential expression in normal tissues from HIPED for SURF2 Gene

This gene is overexpressed in Lung (62.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for SURF2 Gene

Protein tissue co-expression partners for SURF2 Gene

NURSA nuclear receptor signaling pathways regulating expression of SURF2 Gene:


SOURCE GeneReport for Unigene cluster for SURF2 Gene:

genes like me logo Genes that share expression patterns with SURF2: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA Expression by UniProt/SwissProt for SURF2 Gene

Orthologs for SURF2 Gene

This gene was present in the common ancestor of chordates.

Orthologs for SURF2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SURF2 34 35
  • 92.43 (n)
(Bos Taurus)
Mammalia SURF2 34 35
  • 80.08 (n)
(Canis familiaris)
Mammalia SURF2 34 35
  • 79.58 (n)
(Mus musculus)
Mammalia Surf2 34 16 35
  • 73.59 (n)
(Monodelphis domestica)
Mammalia SURF2 35
  • 60 (a)
(Gallus gallus)
Aves SURF2 34 35
  • 65.98 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia surf2 34
  • 60.29 (n)
Str.10001 34
African clawed frog
(Xenopus laevis)
Amphibia surf2-prov 34
(Danio rerio)
Actinopterygii zgc:101084 34
  • 55.36 (n)
SURF2 35
  • 42 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.9263 34
sea squirt
(Ciona savignyi)
Ascidiacea CSA.2405 35
  • 33 (a)
Species where no ortholog for SURF2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for SURF2 Gene

Gene Tree for SURF2 (if available)
Gene Tree for SURF2 (if available)

Paralogs for SURF2 Gene

No data available for Paralogs for SURF2 Gene

Variants for SURF2 Gene

Sequence variations from dbSNP and Humsavar for SURF2 Gene

SNP ID Clin Chr 09 pos Sequence Context AA Info Type
rs782726390 Pathogenic 133,354,959(+) ACCCC(C/T)GGAGA upstream-variant-2KB, splice-acceptor-variant
rs863224228 Pathogenic 133,354,661(-) GTCCC(AT/TCTGCCAGCC)GAGTG upstream-variant-2KB, reference, frameshift-variant, utr-variant-5-prime
rs863224229 Pathogenic 133,356,441(-) CGCGG(-/GGCCGGGTGCGATGGCGGCGGTGG)CTGCG upstream-variant-2KB, utr-variant-5-prime
rs863224926 Likely pathogenic 133,356,268(-) CCCAG(C/G)TGAGG intron-variant, upstream-variant-2KB, splice-donor-variant, utr-variant-5-prime
rs587727919 Likely benign 133,356,437(+) GCAAC(A/G)CAGCC upstream-variant-2KB, reference, missense, utr-variant-5-prime

Structural Variations from Database of Genomic Variants (DGV) for SURF2 Gene

Variant ID Type Subtype PubMed ID
esv2739138 CNV deletion 23290073
nsv1125319 OTHER inversion 24896259

Variation tolerance for SURF2 Gene

Residual Variation Intolerance Score: 82.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.48; 43.52% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for SURF2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SURF2 Gene

Disorders for SURF2 Gene

Relevant External Links for SURF2

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for SURF2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SURF2 Gene

Publications for SURF2 Gene

  1. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey S.D. … Anand S. (Diabetes Care 2010) 3 46 64
  2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
  3. The Surf-1 and Surf-2 genes and their essential bidirectional promoter elements are conserved between mouse and human. (PMID: 7702754) Lennard A. … Fried M. (DNA Cell Biol. 1994) 3 4 64
  4. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin E.L. … Gygi S.P. (Cell 2015) 3 64
  5. Panorama of ancient metazoan macromolecular complexes. (PMID: 26344197) Wan C. … Emili A. (Nature 2015) 3 64

Products for SURF2 Gene

Sources for SURF2 Gene

Loading form....