Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SURF2 Gene

Aliases for SURF2 Gene

  • Surfeit 2 2 3 5
  • Surfeit Locus Protein 2 2 3
  • SURF-2 3 4

External Ids for SURF2 Gene

Previous GeneCards Identifiers for SURF2 Gene

  • GC09P127313
  • GC09P127780
  • GC09P129577
  • GC09P131499
  • GC09P133252
  • GC09P135213
  • GC09P136223
  • GC09P105723
  • GC09P133358
  • GC09P133364
  • GC09P133372
  • GC09P133385
  • GC09P133394
  • GC09P133403

Summaries for SURF2 Gene

Entrez Gene Summary for SURF2 Gene

  • This gene shares a bidirectional promoter with surfeit 1 (SURF1; GeneID: 6834), which is located on the opposite strand. It encodes a conserved protein that is expressed in a variety of tissues. [provided by RefSeq, Jul 2013]

GeneCards Summary for SURF2 Gene

SURF2 (Surfeit 2) is a Protein Coding gene.

Additional gene information for SURF2 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SURF2 Gene

Genomics for SURF2 Gene

Regulatory Elements for SURF2 Gene

Enhancers for SURF2 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH09H133416 1.5 FANTOM5 ENCODE 11.7 +61.4 61433 3 ZFP64 FEZF1 DMAP1 YY1 SLC30A9 ZNF143 SP3 NFYC ZC3H11A MEF2D SURF1 MED22 SURF6 RPL7A ENSG00000273473 BRD3 BRD3OS ADAMTS13 CACFD1 SURF2
GH09H133420 1.2 Ensembl ENCODE 11.7 +64.7 64690 2 HDGF PKNOX1 FOXA2 SIN3A ARID4B BATF RAD21 RFX5 ZNF207 ATF7 SURF1 CACFD1 SURF2 MED22 SNORD24 SNORD36A SNORD36B SNORD36C RPL7A ADAMTS13
GH09H133459 1.1 ENCODE 10.3 +103.9 103888 2 HDGF FOXA2 MLX ARID4B SIN3A DMAP1 ZNF2 ZBTB7B YY1 ZNF143 CACFD1 SURF1 SURF2 SNORD36A SNORD36C MED22 RPL7A SNORD24 SNORD36B ADAMTS13
GH09H133267 0.9 ENCODE 11.2 -87.1 -87143 2 HDAC1 HDGF PKNOX1 ATF1 TBL1XR1 NFRKB ZBTB40 TCF12 ZNF766 EGR1 ABO SURF6 ENSG00000201451 ENSG00000230064 MED22 RPL7A SNORD24 SNORD36A SNORD36B SNORD36C
GH09H133463 0.6 ENCODE 10.3 +106.8 106809 0 CTCF MAZ ESRRA ZNF687 MNT ZEB2 CTBP1 MTA1 ZBTB33 SURF1 SURF2 SNORD24 SNORD36B SNORD36C SNORD36A RPL7A MED22 CACFD1 SLC2A6
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around SURF2 on UCSC Golden Path with GeneCards custom track

Genomic Location for SURF2 Gene

Chromosome:
9
Start:
133,356,545 bp from pter
End:
133,361,169 bp from pter
Size:
4,625 bases
Orientation:
Plus strand

Genomic View for SURF2 Gene

Genes around SURF2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SURF2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SURF2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SURF2 Gene

Proteins for SURF2 Gene

  • Protein details for SURF2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q15527-SURF2_HUMAN
    Recommended name:
    Surfeit locus protein 2
    Protein Accession:
    Q15527
    Secondary Accessions:
    • Q6IBP9
    • Q96CD1

    Protein attributes for SURF2 Gene

    Size:
    256 amino acids
    Molecular mass:
    29648 Da
    Quaternary structure:
    No Data Available

neXtProt entry for SURF2 Gene

Post-translational modifications for SURF2 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for SURF2 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for SURF2 Gene

Domains & Families for SURF2 Gene

Gene Families for SURF2 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for SURF2 Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for SURF2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q15527

UniProtKB/Swiss-Prot:

SURF2_HUMAN :
  • Belongs to the SURF2 family.
Family:
  • Belongs to the SURF2 family.
genes like me logo Genes that share domains with SURF2: view

Function for SURF2 Gene

Molecular function for SURF2 Gene

GENATLAS Biochemistry:
surfeit 2 (see SURF@)

Phenotypes From GWAS Catalog for SURF2 Gene

Gene Ontology (GO) - Molecular Function for SURF2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with SURF2: view

Phenotypes for SURF2 Gene

GenomeRNAi human phenotypes for SURF2:
genes like me logo Genes that share phenotypes with SURF2: view

Animal Model Products

CRISPR Products

miRNA for SURF2 Gene

miRTarBase miRNAs that target SURF2

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for SURF2
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SURF2 Gene

Localization for SURF2 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SURF2 gene
Compartment Confidence
plasma membrane 5
nucleus 5
extracellular 2
cytosol 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoli (4)
  • Nucleus (4)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for SURF2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005575 cellular_component ND --
GO:0005634 nucleus IDA --
GO:0005730 nucleolus IDA --
GO:0005886 plasma membrane IDA --
GO:0016607 nuclear speck IDA --
genes like me logo Genes that share ontologies with SURF2: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for SURF2 Gene

Pathways & Interactions for SURF2 Gene

SuperPathways for SURF2 Gene

No Data Available

Gene Ontology (GO) - Biological Process for SURF2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008150 biological_process ND --
genes like me logo Genes that share ontologies with SURF2: view

No data available for Pathways by source and SIGNOR curated interactions for SURF2 Gene

Drugs & Compounds for SURF2 Gene

No Compound Related Data Available

Transcripts for SURF2 Gene

mRNA/cDNA for SURF2 Gene

Unigene Clusters for SURF2 Gene

Surfeit 2:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for SURF2
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

Alternative Splicing Database (ASD) splice patterns (SP) for SURF2 Gene

ExUns: 1a · 1b · 1c · 1d · 1e · 1f ^ 2a · 2b · 2c ^ 3a · 3b · 3c ^ 4 ^ 5 ^ 6a · 6b ^ 7
SP1: - - - -
SP2: - - -
SP3: - - - - - -
SP4: - - - - - - - -
SP5: - -
SP6: -
SP7:
SP8:

Relevant External Links for SURF2 Gene

GeneLoc Exon Structure for
SURF2
ECgene alternative splicing isoforms for
SURF2

Expression for SURF2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SURF2 Gene

mRNA differential expression in normal tissues according to GTEx for SURF2 Gene

This gene is overexpressed in Testis (x4.8).

Protein differential expression in normal tissues from HIPED for SURF2 Gene

This gene is overexpressed in Lung (62.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for SURF2 Gene



Protein tissue co-expression partners for SURF2 Gene

NURSA nuclear receptor signaling pathways regulating expression of SURF2 Gene:

SURF2

SOURCE GeneReport for Unigene cluster for SURF2 Gene:

Hs.159448

Evidence on tissue expression from TISSUES for SURF2 Gene

  • Liver(4.3)
  • Lung(4.3)
genes like me logo Genes that share expression patterns with SURF2: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for SURF2 Gene

Orthologs for SURF2 Gene

This gene was present in the common ancestor of chordates.

Orthologs for SURF2 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SURF2 33 34
  • 92.43 (n)
cow
(Bos Taurus)
Mammalia SURF2 33 34
  • 80.08 (n)
dog
(Canis familiaris)
Mammalia SURF2 33 34
  • 79.58 (n)
mouse
(Mus musculus)
Mammalia Surf2 33 16 34
  • 73.59 (n)
oppossum
(Monodelphis domestica)
Mammalia SURF2 34
  • 60 (a)
OneToOne
chicken
(Gallus gallus)
Aves SURF2 33 34
  • 65.98 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia surf2 33
  • 60.29 (n)
Str.10001 33
African clawed frog
(Xenopus laevis)
Amphibia surf2-prov 33
zebrafish
(Danio rerio)
Actinopterygii zgc:101084 33
  • 55.36 (n)
SURF2 34
  • 42 (a)
OneToOne
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.9263 33
sea squirt
(Ciona savignyi)
Ascidiacea CSA.2405 34
  • 33 (a)
OneToOne
Species where no ortholog for SURF2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for SURF2 Gene

ENSEMBL:
Gene Tree for SURF2 (if available)
TreeFam:
Gene Tree for SURF2 (if available)

Paralogs for SURF2 Gene

No data available for Paralogs for SURF2 Gene

Variants for SURF2 Gene

Sequence variations from dbSNP and Humsavar for SURF2 Gene

SNP ID Clin Chr 09 pos Sequence Context AA Info Type
rs782726390 Pathogenic 133,354,959(+) ACCCC(C/T)GGAGA upstream-variant-2KB, splice-acceptor-variant
rs863224228 Pathogenic 133,354,661(-) GTCCC(AT/TCTGCCAGCC)GAGTG upstream-variant-2KB, reference, frameshift-variant, utr-variant-5-prime
rs863224229 Pathogenic 133,356,441(-) CGCGG(-/GGCCGGGTGCGATGGCGGCGGTGG)CTGCG upstream-variant-2KB, utr-variant-5-prime
rs863224926 Likely pathogenic 133,356,268(-) CCCAG(C/G)TGAGG intron-variant, upstream-variant-2KB, splice-donor-variant, utr-variant-5-prime
rs28615629 Likely benign 133,354,702(+) CTCCA(A/G)CTCTG upstream-variant-2KB, reference, synonymous-codon, utr-variant-5-prime

Structural Variations from Database of Genomic Variants (DGV) for SURF2 Gene

Variant ID Type Subtype PubMed ID
esv2739138 CNV deletion 23290073
nsv1125319 OTHER inversion 24896259

Variation tolerance for SURF2 Gene

Residual Variation Intolerance Score: 82.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.48; 43.52% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for SURF2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
SURF2

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SURF2 Gene

Disorders for SURF2 Gene

Relevant External Links for SURF2

Genetic Association Database (GAD)
SURF2
Human Genome Epidemiology (HuGE) Navigator
SURF2
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
SURF2

No disorders were found for SURF2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SURF2 Gene

Publications for SURF2 Gene

  1. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 45 60
  2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 60
  3. The Surf-1 and Surf-2 genes and their essential bidirectional promoter elements are conserved between mouse and human. (PMID: 7702754) Lennard A … Fried M (DNA and cell biology 1994) 3 4 60
  4. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 60
  5. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin EL … Gygi SP (Cell 2015) 3 60

Products for SURF2 Gene

Sources for SURF2 Gene

Content
Loading form....