Set Analyses:
Advanced Search

Advanced Search

Search By
Section (entire)

or upload a file of gene symbols

Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

STX1B Gene

protein-coding   GIFtS: 54
GCID: GC16M031000

Syntaxin 1B

(Previous names: syntaxin 1B1, syntaxin 1B2)
(Previous symbols: STX1B1, STX1B2)
Alzheimer's & Parkinson's Diseases Congress
  See related diseases

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Syntaxin 1B1 2     syntaxin-1B2
STX1B11 2 3     syntaxin-1B12
STX1B21 2 3     syntaxin-1B22
Syntaxin 1B11 2     Syntaxin-1B13
Syntaxin 1B21 2     Syntaxin-1B23

External Ids:    HGNC: 185391   Entrez Gene: 1127552   Ensembl: ENSG000000993657   OMIM: 6014855   UniProtKB: P612663   

Export aliases for STX1B gene to outside databases

Previous GC identifers: GC16M030912 GC16M028563

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for STX1B Gene:
Syntaxins are cellular receptors for transport vesicles (see MIM 603765). One of these proteins, designated
syntaxin 1B (STX1B), is directly implicated in the process of calcium-dependent synaptic transmission in rat
brain (Smirnova et al., 1993 (PubMed 8105537)). The expression of this protein is transiently induced by
long-term potentiation of synaptic responses in the rat hippocampus. The protein may play an important role in
the excitatory pathway of synaptic transmission, which is known to be implicated in several neurologic
diseases.(supplied by OMIM, Nov 2010)

GeneCards Summary for STX1B Gene: 
STX1B (syntaxin 1B) is a protein-coding gene. Diseases associated with STX1B include neurologic diseases, and hemolytic-uremic syndrome, and among its related super-pathways are Synaptic Vesicle Pathway and Nicotine Pathway (Dopaminergic Neuron), Pharmacodynamics. GO annotations related to this gene include SNAP receptor activity and protein domain specific binding. An important paralog of this gene is STX2.

UniProtKB/Swiss-Prot: STX1B_HUMAN, P61266
Function: Potentially involved in docking of synaptic vesicles at presynaptic active zones. May mediate
Ca(2+)-regulation of exocytosis acrosomal reaction in sperm (By similarity)

Gene Wiki entry for STX1B Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000016.9  NC_018927.2  NT_010393.16  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the STX1B gene promoter:
         STAT1   Sp1   RREB-1   Egr-1   NF-E2 p45   HNF-3beta   MEF-2A   ARP-1   aMEF-2   NF-E2   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidSTX1B promoter sequence
   Search SABiosciences Chromatin IP Primers for STX1B

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat STX1B

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 16p11.2   Ensembl cytogenetic band:  16p11.2   HGNC cytogenetic band: 16p12-p11

STX1B Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
STX1B gene location

GeneLoc information about chromosome 16         GeneLoc Exon Structure

GeneLoc location for GC16M031000:  view genomic region     (about GC identifiers)

31,000,577 bp from pter      End:
31,021,949 bp from pter
21,373 bases      Orientation:
minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: STX1B_HUMAN, P61266 (See protein sequence)
Recommended Name: Syntaxin-1B  
Size: 288 amino acids; 33245 Da
Subunit: Interacts with OTOF. Interacts with SYT6 and SYT8; the interaction is Ca(2+)-dependent (By similarity)
Subcellular location: Membrane; Single-pass type IV membrane protein (Potential)
Secondary accessions: Q15531

Explore the universe of human proteins at neXtProt for STX1B: NX_P61266

Explore proteomics data for STX1B at MOPED 

Post-translational modifications:

  • UniProtKB: Phosphorylated by CK2 (By similarity)
  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_P61266

  • STX1B Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    STX1B Protein Expression
    REFSEQ proteins: NP_443106.1  
    ENSEMBL proteins: 
     ENSP00000215095   ENSP00000457067   ENSP00000455899  
    Reactome Protein details: P61266
    Human Recombinant Protein Products for STX1B: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for STX1B
    OriGene Protein Over-expression Lysate for STX1B
    OriGene MassSpec for STX1B 
    OriGene Custom Protein Services for STX1B
    GenScript Custom Purified and Recombinant Proteins Services for STX1B
    Novus Biologicals STX1B Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for STX1B 

    Gene Ontology (GO): 5/6 cellular component terms (GO ID links to tree view) (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IEA--
    GO:0005737cytoplasm IEA--
    GO:0005815microtubule organizing center IEA--
    GO:0005819spindle IEA--
    GO:0005887integral to plasma membrane TAS8105537

    STX1B for ontologies           About GeneDecksing

    STX1B Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    R&D Systems Antibodies for STX1B (Syntaxin 1B)
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for STX1B
    GenScript Custom Superior Antibodies Services for STX1B
    Abcam antibodies for STX1B
    Cloud-Clone Corp. Antibodies for STX1B 
    Search ThermoFisher Antibodies for STX1B
    LSBio Antibodies in human, mouse, rat for STX1B 

    Assay Products for STX1B: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for STX1B
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for STX1B
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for STX1B 
    Cloud-Clone Corp. CLIAs for STX1B

    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    5 InterPro protein domains:
     IPR000727 T_SNARE_dom
     IPR010989 t-SNARE
     IPR006011 Syntaxin_N
     IPR015709 Syntaxin-1
     IPR006012 Syntaxin/epimorphin_CS

    Graphical View of Domain Structure for InterPro Entry P61266

    ProtoNet protein and cluster: P61266

    1 Blocks protein domain: IPB006011 Syntaxin

    UniProtKB/Swiss-Prot: STX1B_HUMAN, P61266
    Similarity: Belongs to the syntaxin family
    Similarity: Contains 1 t-SNARE coiled-coil homology domain

    STX1B for domains           About GeneDecksing

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: STX1B_HUMAN, P61266
    Function: Potentially involved in docking of synaptic vesicles at presynaptic active zones. May mediate
    Ca(2+)-regulation of exocytosis acrosomal reaction in sperm (By similarity)

         Genatlas biochemistry entry for STX1B:
    syntaxin 1B,brain,forming a synaptic core complex with synaptosome associated proteins,and synaptobrevin,binding
    to N-type Ca2+ channels,involved in vesicular transport and in Ca2 dependent synaptic transmission,soluble N
    ethylmaleimide-sensitive factor-attachment protein receptor,SNARE protein

         Gene Ontology (GO): 5 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005230extracellular ligand-gated ion channel activity TAS8105537
    GO:0005234extracellular-glutamate-gated ion channel activity TAS8105537
    GO:0005484SNAP receptor activity IEA--
    GO:0005515protein binding ----
    GO:0019904protein domain specific binding IEA--
    STX1B for ontologies           About GeneDecksing

         5 MGI mutant phenotypes (inferred from 2 alleles(MGI details for Stx1b):
     behavior/neurological  endocrine/exocrine gland  mortality/aging  nervous system  no phenotypic analysis 

    STX1B for phenotypes           About GeneDecksing

    Animal Models:
       inGenious Targeting Laboratory - Custom generated mouse model solutions for STX1B 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for STX1B

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for STX1B 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for STX1B 

    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat STX1B
    8/72 QIAGEN miScript miRNA Assays for microRNAs that regulate STX1B (see all 72):
    hsa-miR-4254 hsa-miR-574-3p hsa-miR-138-2* hsa-miR-3921 hsa-miR-629* hsa-miR-149 hsa-miR-637 hsa-miR-3116
    SwitchGear 3'UTR luciferase reporter plasmidSTX1B 3' UTR sequence
    Inhib. RNA
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for STX1B
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat STX1B

    Gene Editing
    DNA2.0 Custom Protein Engineering Service for STX1B
    Sirion Biotech Customized adenovirus for overexpression of STX1B

    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for STX1B (see all 7)
    OriGene ORF clones in mouse, rat for STX1B
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: STX1B (NM_052874)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for STX1B
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat STX1B
    Sirion Biotech Customized lentivirus for stable overexpression of STX1B 
                         Customized lentivirus expression plasmids for stable overexpression of STX1B 

    Cell Line
    GenScript Custom overexpressing Cell Line Services for STX1B
    Search LifeMap BioReagents cell lines for STX1B
    In Situ Assay

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for STX1B

    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for STX1B About                                                                                                See pathways by source

    SuperPathContained pathways About
    1Synaptic vesicle cycle
    Synaptic vesicle cycle0.50
    Synaptic Vesicle Pathway0.50
    2Nicotine Pathway (Dopaminergic Neuron), Pharmacodynamics
    Nicotine Pathway (Dopaminergic Neuron), Pharmacodynamics0.44
    SNARE interactions in vesicular transport0.40
    3Botulinum neurotoxicity
    Botulinum neurotoxicity0.89
    Proteolytic cleavage of SNARE complex proteins0.89
    4Transmission across Chemical Synapses
    Neuronal System0.67

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    1 BioSystems Pathway for STX1B
        Synaptic Vesicle Pathway

    4        Reactome Pathways for STX1B
        Proteolytic cleavage of SNARE complex proteins
    Botulinum neurotoxicity
    Neuronal System

    1 PharmGKB Pathway for STX1B
        Nicotine Pathway (Dopaminergic Neuron), Pharmacodynamics

    2         Kegg Pathways  (Kegg details for STX1B):
        SNARE interactions in vesicular transport
    Synaptic vesicle cycle

    STX1B for pathways           About GeneDecksing


        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for STX1B

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/37 Interacting proteins for STX1B (P612663 ENSP000002150954) via UniProtKB, MINT, STRING, and/or I2D (see all 37)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    STXBP1P617643, ENSP000003623994I2D: score=4 STRING: ENSP00000362399
    VAMP7P518093, ENSP000002864484I2D: score=2 STRING: ENSP00000286448
    VAMP2P630273, ENSP000003142144I2D: score=5 STRING: ENSP00000314214
    SNAP23O001613, ENSP000002496474I2D: score=1 STRING: ENSP00000249647
    UNC13BO147953, ENSP000003677564I2D: score=1 STRING: ENSP00000367756
    About this table

    Gene Ontology (GO): 5/7 biological process terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006810transport TAS8105537
    GO:0006836neurotransmitter transport IEA--
    GO:0006886intracellular protein transport IEA--
    GO:0007268synaptic transmission TAS8105537
    GO:0015031protein transport ----

    STX1B for ontologies           About GeneDecksing

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for STX1B

    Search CenterWatch for drugs/clinical trials and news about STX1B

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for STX1B gene: 

    Unigene Cluster for STX1B:

    Syntaxin 1B
    Hs.542230  [show with all ESTs]
    Unigene Representative Sequence: NM_052874
    5 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000215095(uc010cad.2 uc010vfd.2) ENST00000569638 ENST00000565419
    ENST00000566211 ENST00000561836

    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat STX1B
    8/72 QIAGEN miScript miRNA Assays for microRNAs that regulate STX1B (see all 72):
    hsa-miR-4254 hsa-miR-574-3p hsa-miR-138-2* hsa-miR-3921 hsa-miR-629* hsa-miR-149 hsa-miR-637 hsa-miR-3116
    SwitchGear 3'UTR luciferase reporter plasmidSTX1B 3' UTR sequence
    Inhib. RNA
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for STX1B
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat STX1B
    OriGene clones in human, mouse for STX1B (see all 7)
    OriGene ORF clones in mouse, rat for STX1B
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: STX1B (NM_052874)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for STX1B
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat STX1B
    Sirion Biotech Customized lentivirus for stable overexpression of STX1B 
                         Customized lentivirus expression plasmids for stable overexpression of STX1B 
    OriGene qPCR primer pairs and template standards for STX1B
    OriGene qSTAR qPCR primer pairs in human, mouse for STX1B
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat STX1B
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat STX1B
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat STX1B

    Additional mRNA sequence: 

    AK123137.1 AL713744.1 AL833259.1 AY028792.1 AY203924.1 AY995211.1 BC038359.1 BC062298.1 

    6 DOTS entries:

    DT.92417128  DT.86846036  DT.100020849  DT.100836888  DT.445784  DT.102823499 

    24/63 AceView cDNA sequences (see all 63):

    T33774 Z45823 R89620 AY028792 AK123137 NM_052874 H18698 AY203924 
    BF967282 BC062298 BC038359 BX422853 BQ940305 BG818056 H19537 R15454 
    BQ640507 T33782 H18797 Z45063 AL713744 AW956912 AL833259 BF513511 

    GeneLoc Exon Structure

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    STX1B expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    STX1B Expression
    About this image

    See STX1B Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for STX1B

    SOURCE GeneReport for Unigene cluster: Hs.542230
        SABiosciences Custom PCR Arrays for STX1B
    OriGene qPCR primer pairs and template standards for STX1B
    OriGene qSTAR qPCR primer pairs in human, mouse for STX1B
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat STX1B
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat STX1B
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat STX1B
    In Situ
    Assay Products:

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for STX1B

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for STX1B gene from 8/15 species (see all 15)    About this table
    Organism Taxonomic
    Gene Description Human
    (Mus musculus)
    Mammalia Stx1b1 , 5 syntaxin 1B1, 5 92.13(n)1
      7 (69.75 cM)5
    562161  NM_024414.21  NP_077725.11 
    (Anolis carolinensis)
    Reptilia STX1B6
    Uncharacterized protein
    1 ↔ 1
    possible ortholog
    (Danio rerio)
    Actinopterygii syntaxin1b2 syntaxin1b 82.34(n)   58038  AF229154.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta Syx1A6
    Syntaxin 4
    1 ↔ many
    possible ortholog
    (Caenorhabditis elegans)
    Secernentea unc-646
    Syntaxin-1A homolog
    1 → many
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes SSO16
    Plasma membrane t-SNARE involved in fusion of secr...
    Plasma membrane t-SNARE involved in fusion of secr...
    many ↔ many
    many ↔ many
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons SYP1231 syntaxin-123 42.48(n)
      827970  NM_116571.2  NP_192242.1 
    (Oryza sativa)
    Liliopsida Os02g02099001 hypothetical protein 47.09(n)
      9272269  NM_001185923.1  NP_001172852.1 

    ENSEMBL Gene Tree for STX1B (if available)
    TreeFam Gene Tree for STX1B (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to Build 68)
    About This Section
    Paralogs for STX1B gene
    STX22  STX1A2  STX112  STX32  STX192  STX42  
    11 SIMAP similar genes for STX1B using alignment to 3 protein entries:     STX1B_HUMAN (see all proteins):
    STX1A    stx1c    STX2    DKFZp686L1857    STX3    STX3A
    STX4A    STX4    STX11    STX19    STX16

    STX1B for paralogs           About GeneDecksing

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/411 SNPs in STX1B are shown (see all 411)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    Chr 16 posSequence#AA
    C--31000753(+) AACAG-/AAATGGGACTC
    1 -- cds11Minor allele frequency- AAATGGGACTCTGAGGGCTAACAG:0.00NA 2
    C,F,A,H--31001095(+) GCGTGC/TGTCGA 1 -- ut3120Minor allele frequency- T:0.03NA NS EA WA CSA 1313
    --31001166(+) GGGGAA/GGAGGA 1 -- ut310--------
    C,F--31001268(+) CACATT/CTGTCC 1 -- ut311Minor allele frequency- C:0.04NA 120
    C,F--31001488(+) TCAACC/TCTTCT 1 -- ut313Minor allele frequency- T:0.04NS WA 186
    --31001756(+) CACAGA/GACAAG 1 -- ut310--------
    C--31001977(+) GCATGA/GCACAT 1 -- ut310--------
    C,F--31002064(+) CACCAC/TCTACC 1 -- ut311Minor allele frequency- T:0.04NA 120
    --31002237(+) GACCCA/GGCCCA 1 -- ut310--------
    --31002447(+) TTGCCG/TCATCA 1 -- ut310--------

    HapMap Linkage Disequilibrium report for STX1B (31000577 - 31021949 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 9 variations for STX1B:    About this table     
    Variant IDTypeSubtypePubMed ID
    esv270787CNV Insertion20981092
    dgv35n68CNV Loss17160897
    nsv457483CNV Loss19166990
    dgv2671n71CNV Loss21882294
    nsv905729CNV Loss21882294
    nsv905733CNV Loss21882294
    nsv905739CNV Loss21882294
    dgv2670n71CNV Loss21882294
    nsv833193CNV Gain+Loss17160897

    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing STX1B
    DNA2.0 Custom Variant and Variant Library Synthesis for STX1B

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 601485    OMIM disorders: --

    6 diseases for STX1B:    About MalaCards
    neurologic diseases    hemolytic-uremic syndrome    diarrhea    burkitt's lymphoma
    pancreatitis    neuronitis

    1 disease from the University of Copenhagen DISEASES database for STX1B:
    hemolytic-uremic syndrome

    STX1B for disorders           About GeneDecksing

    Congresses - knowledge worth sharing:  
    Alzheimer's & Parkinson's Diseases Congress (ADPD) 18 - 22 March 2015

    Export disorders for STX1B gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for STX1B gene, integrated from 9 sources (see all 14):
    (articles sorted by number of sources associating them with STX1B)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    2. Proteomic analysis identifies dysfunction in cellular transport, energy, and protein metabolism in different brain regions of atypical frontotemporal lobar degeneration. (PubMed id 22360420)1 Martins-de-Souza D....Bahn S. (2012)
    3. System-wide temporal characterization of the proteome and phosphoproteome of human embryonic stem cell differentiation. (PubMed id 21406692)2 Rigbolt K.T....Blagoev B. (2011)
    4. Mass spectrometric analysis of lysine ubiquitylation r eveals promiscuity at site level. (PubMed id 21139048)1 Danielsen J.M....Nielsen M.L. (2011)
    5. Nuclear localization of a novel human syntaxin 1B isoform. (PubMed id 18691641)1 Pereira S....Szepetowski P. (2008)
    6. Huntingtin interacting proteins are genetic modifiers of neurodegeneration. (PubMed id 17500595)1 Kaltenbach L.S....Hughes R.E. (2007)
    7. Syntaxin isoform specificity in the regulation of renal H+-ATPase exocytosis. (PubMed id 12651853)1 Li G....Schwartz J.H. (2003)
    8. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (2002)
    9. Munc 18a binding to syntaxin 1A and 1B isoforms defines its localization at the plasma membrane and blocks SNARE assembly in a three-hybrid system assay. (PubMed id 12093152)1 Perez-Branguli F....Blasi J. (2002)
    10. Localization of cellubrevin-related peptide, endobrevin, in the early endosome in pancreatic beta cells and its physiological function in exo-endocytosis of secretory granules. (PubMed id 11112705)1 Nagamatsu S....Ishida H. (2001)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
    Free Text  

      Query String
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 112755 HGNC: 18539 AceView: STX1B2 Ensembl:ENSG00000099365 euGenes: HUgn112755
    ECgene: STX1B Kegg: 112755 H-InvDB: STX1B

    (According to HUGE)
    About This Section

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    PharmGKB entry for STX1B Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for STX1B gene:
    Search GeneIP for patents involving STX1B

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

     Antibodies for STX1B (Syntaxin 1B)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for STX1B  
     OriGene qPCR primer pairs and template standards for STX1B   OriGene Protein Over-expression Lysate for STX1B  
     OriGene MassSpec something-or-other for STX1B   OriGene clones in human, mouse for STX1B  
     OriGene qSTAR qPCR primer pairs in human, mouse for STX1B   OriGene Purified Protein for STX1B  
     OriGene ORF clones in mouse, rat for STX1B   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for STX1B   OriGene Custom Protein Services for STX1B  

     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat STX1B
     QIAGEN SeqTarget long-range PCR primers for resequencing STX1B
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat STX1B
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat STX1B
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat STX1B
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat STX1B
     GenScript Custom Purified and Recombinant Proteins Services for STX1B GenScript cDNA clones with any tag delivered in your preferred vector for STX1B
     GenScript Custom Assay Services for STX1B GenScript Custom Superior Antibodies Services for STX1B
     GenScript Custom overexpressing Cell Line Services for STX1B CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in STX1B promoter
     Search Chromatin IP Primers for STX1B
     RT2 qPCR Primer Assay in human, mouse, rat STX1B
     Search GNC Networks for STX1B
     SABiosciences Custom PCR Arrays for STX1B
     Search Tocris compounds for STX1B
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     STX1B lysates
     Antibodies for STX1B
     See all of Abcam's Antibodies, Kits and Proteins for STX1B
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins

     Proteins for STX1B
     Antibodies for STX1B
     ELISAs for STX1B
     CLIAs for STX1B
     Search LifeMap BioReagents cell lines for STX1B
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for STX1B
     SwitchGear 3'UTR luciferase reporter plasmids for STX1B
     SwitchGear Promoter luciferase reporter plasmids for STX1B
     Search ThermoFisher Antibodies for STX1B
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat STX1B
     inGenious Targeting Laboratory - Custom generated mouse model solutions for STX1B
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for STX1B
     lentivirus for stable overexpression of STX1B
     lentivirus expression plasmids for stable overexpression of STX1B
     adenovirus for overexpression of STX1B
     LSBio Antibodies in human, mouse, rat for STX1B
    Customized transgenic rodents for:
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      STX1B gene at Home site.
    hostname: index build: 106 solr: 1.4