Set Analyses:
Advanced Search

Advanced Search

Search By
Section (entire)


STX1B Gene

protein-coding   GIFtS: 54
GCID: GC16M031000

Syntaxin 1B

(Previous names: syntaxin 1B1, syntaxin 1B2)
(Previous symbols: STX1B1, STX1B2)
  Search for STX1B

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Syntaxin 1B1 2     syntaxin-1B2
STX1B11 2 3     syntaxin-1B12
STX1B21 2 3     syntaxin-1B22
Syntaxin 1B11 2     Syntaxin-1B13
Syntaxin 1B21 2     Syntaxin-1B23

External Ids:    HGNC: 185391   Entrez Gene: 1127552   Ensembl: ENSG000000993657   OMIM: 6014855   UniProtKB: P612663   

Export aliases for STX1B gene to outside databases

Previous GC identifers: GC16M030912 GC16M028563

(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for STX1B Gene:
Syntaxins are cellular receptors for transport vesicles (see MIM 603765). One of these proteins, designated
syntaxin 1B (STX1B), is directly implicated in the process of calcium-dependent synaptic transmission in rat
brain (Smirnova et al., 1993 (PubMed 8105537)). The expression of this protein is transiently induced by
long-term potentiation of synaptic responses in the rat hippocampus. The protein may play an important role in
the excitatory pathway of synaptic transmission, which is known to be implicated in several neurologic
diseases.(supplied by OMIM, Nov 2010)

GeneCards Summary for STX1B Gene:
STX1B (syntaxin 1B) is a protein-coding gene. GO annotations related to this gene include SNAP receptor activity and protein domain specific binding. An important paralog of this gene is STX2.

UniProtKB/Swiss-Prot: STX1B_HUMAN, P61266
Function: Potentially involved in docking of synaptic vesicles at presynaptic active zones. May mediate
Ca(2+)-regulation of exocytosis acrosomal reaction in sperm (By similarity)

Gene Wiki entry for STX1B Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000016.9  NC_018927.2  NT_187260.1  
Regulatory elements:
   Regulatory transcription factor binding sites in the STX1B gene promoter:
         STAT1   Sp1   RREB-1   Egr-1   NF-E2 p45   HNF-3beta   MEF-2A   ARP-1   aMEF-2   NF-E2   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidSTX1B promoter sequence
   Search Chromatin IP Primers for STX1B

DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat STX1B

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 16p11.2   Ensembl cytogenetic band:  16p11.2   HGNC cytogenetic band: 16p12-p11

STX1B Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
STX1B gene location

GeneLoc information about chromosome 16         GeneLoc Exon Structure

GeneLoc location for GC16M031000:  view genomic region     (about GC identifiers)

31,000,577 bp from pter      End:
31,021,949 bp from pter
21,373 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., and/or eBioscience,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., and/or eBioscience, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: STX1B_HUMAN, P61266 (See protein sequence)
Recommended Name: Syntaxin-1B  
Size: 288 amino acids; 33245 Da
Subunit: Interacts with OTOF. Interacts with SYT6 and SYT8; the interaction is Ca(2+)-dependent (By similarity)
Secondary accessions: Q15531 Q2VPS2
Alternative splicing: 2 isoforms:  P61266-1   P61266-2   (The glycine-rich C-terminus serves as an unconventional nuclear localization signal)

Explore the universe of human proteins at neXtProt for STX1B: NX_P61266

Explore proteomics data for STX1B at MOPED

Post-translational modifications: 

  • Phosphorylated by CK2 (By similarity)1
  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus

  • See STX1B Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins: NP_443106.1  
    ENSEMBL proteins: 
     ENSP00000215095   ENSP00000457067   ENSP00000455899  
    Reactome Protein details: P61266

    STX1B Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for STX1B
    OriGene Protein Over-expression Lysate for STX1B
    OriGene MassSpec for STX1B
    OriGene Custom Protein Services for STX1B
    GenScript Custom Purified and Recombinant Proteins Services for STX1B
    Novus Biologicals STX1B Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for STX1B

    Search eBioscience for Proteins for STX1B 

    STX1B Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    R&D Systems Antibodies for STX1B (Syntaxin 1B)
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for STX1B
    Abcam antibodies for STX1B (Q16623, Q13277, P61266, P32856)
    Cloud-Clone Corp. Antibodies for STX1B
    Search ThermoFisher Antibodies for STX1B
    LSBio Antibodies in human, mouse, rat for STX1B

    STX1B Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for STX1B
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for STX1B
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for STX1B
    Cloud-Clone Corp. CLIAs for STX1B
    Search eBioscience for ELISAs for STX1B 

    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    5 InterPro protein domains:
     IPR000727 T_SNARE_dom
     IPR028669 STX1A/1B
     IPR010989 t-SNARE
     IPR006011 Syntaxin_N
     IPR006012 Syntaxin/epimorphin_CS

    Graphical View of Domain Structure for InterPro Entry P61266

    ProtoNet protein and cluster: P61266

    1 Blocks protein domain: IPB006011 Syntaxin

    UniProtKB/Swiss-Prot: STX1B_HUMAN, P61266
    Similarity: Belongs to the syntaxin family
    Similarity: Contains 1 t-SNARE coiled-coil homology domain

    Find genes that share domains with STX1B           About GenesLikeMe

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: STX1B_HUMAN, P61266
    Function: Potentially involved in docking of synaptic vesicles at presynaptic active zones. May mediate
    Ca(2+)-regulation of exocytosis acrosomal reaction in sperm (By similarity)

         Genatlas biochemistry entry for STX1B:
    syntaxin 1B,brain,forming a synaptic core complex with synaptosome associated proteins,and synaptobrevin,binding
    to N-type Ca2+ channels,involved in vesicular transport and in Ca2 dependent synaptic transmission,soluble N
    ethylmaleimide-sensitive factor-attachment protein receptor,SNARE protein

         Gene Ontology (GO): 5 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005230extracellular ligand-gated ion channel activity TAS8105537
    GO:0005234extracellular-glutamate-gated ion channel activity TAS8105537
    GO:0005484SNAP receptor activity IEA--
    GO:0005515protein binding ----
    GO:0019904protein domain specific binding IEA--
    Find genes that share ontologies with STX1B           About GenesLikeMe

         5 MGI mutant phenotypes (inferred from 2 alleles(MGI details for Stx1b):
     behavior/neurological  endocrine/exocrine gland  mortality/aging  nervous system  no phenotypic analysis 

    Find genes that share phenotypes with STX1B           About GenesLikeMe

    Animal Models:
       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for STX1B
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for STX1B

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for STX1B
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for STX1B

    miRTarBase miRNAs that target STX1B:
    hsa-mir-330-5p (MIRT038244)

    Block miRNA regulation of human, mouse, rat STX1B using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate STX1B (see all 72):
    hsa-miR-4254 hsa-miR-574-3p hsa-miR-138-2* hsa-miR-3921 hsa-miR-629* hsa-miR-149 hsa-miR-637 hsa-miR-3116
    SwitchGear 3'UTR luciferase reporter plasmidSTX1B 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for STX1B
    Predesigned siRNA for gene silencing in human, mouse, rat STX1B

    Gene Editing
    DNA2.0 Custom Protein Engineering Service for STX1B

    OriGene clones in human, mouse for STX1B (see all 6)
    OriGene ORF clones in mouse, rat for STX1B
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: STX1B (NM_052874)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for STX1B
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat STX1B

    Cell Line
    GenScript Custom overexpressing Cell Line Services for STX1B
    Browse ESI BIO Cell Lines and PureStem Progenitors for STX1B 
    In Situ Assay

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for STX1B

    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    STX1B_HUMAN, P61266: Isoform 1: Membrane; Single-pass type IV membrane protein (Potential)
    STX1B_HUMAN, P61266: Isoform 2: Nucleus. Cytoplasm, cytoskeleton, microtubule organizing center, centrosome.
    Cytoplasm, cytoskeleton, spindle. Note=Colocalizes with Lamin A/C and NuMA in interphasic nuclei, and with NuMA
    and gamma-tubulin in the pericentrosomal region of the mitotic spindle in dividing cells
    Subcellular locations from COMPARTMENTS: 

    plasma membrane4

    Gene Ontology (GO): Selected cellular component terms (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IEA--
    GO:0005737cytoplasm IEA--
    GO:0005815microtubule organizing center IEA--
    GO:0005819spindle IEA--
    GO:0005887integral component of plasma membrane TAS8105537

    Find genes that share ontologies with STX1B           About GenesLikeMe

    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for STX1B About    
    See pathways by source

    SuperPathContained pathways About
    1Synaptic vesicle cycle
    Synaptic Vesicle Pathway0.50
    Synaptic vesicle cycle0.50
    2Nicotine Pathway (Dopaminergic Neuron), Pharmacodynamics
    Nicotine Pathway (Dopaminergic Neuron), Pharmacodynamics0.44
    SNARE interactions in vesicular transport0.40
    3Transmission across Chemical Synapses
    Neuronal System0.68

    Find genes that share SuperPaths with STX1B           About GenesLikeMe

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    1 Downloadable PowerPoint Slide of GeneGlobe Pathway Central Maps for STX1B
        Epithelial Tight Junctions

    1 BioSystems Pathway for STX1B
        Synaptic Vesicle Pathway

    1 Reactome Pathway for STX1B
        Toxicity of botulinum toxin type C (BoNT/C)

    1 PharmGKB Pathway for STX1B
        Nicotine Pathway (Dopaminergic Neuron), Pharmacodynamics

    2 Kegg Pathways  (Kegg details for STX1B):
        SNARE interactions in vesicular transport
    Synaptic vesicle cycle

        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for STX1B

        Search GeneGlobe Interaction Network for STX1B

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for STX1B (P612663 ENSP000002150954) via UniProtKB, MINT, STRING, and/or I2D (see all 88)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    STXBP1P617643, ENSP000003623994I2D: score=4 STRING: ENSP00000362399
    SNAP25P608803, ENSP000002549764I2D: score=2 STRING: ENSP00000254976
    SNAP23O001613, ENSP000002496474I2D: score=1 STRING: ENSP00000249647
    UNC13BO147953, ENSP000003677564I2D: score=1 STRING: ENSP00000367756
    VAMP2P630273, ENSP000003142144I2D: score=5 STRING: ENSP00000314214
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 8):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006810transport TAS8105537
    GO:0006836neurotransmitter transport IEA--
    GO:0006886intracellular protein transport IEA--
    GO:0007268synaptic transmission TAS8105537
    GO:0015031protein transport ----

    Find genes that share ontologies with STX1B           About GenesLikeMe

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for STX1B

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for STX1B gene: 

    Unigene Cluster for STX1B:

    Syntaxin 1B
    Hs.542230  [show with all ESTs]
    Unigene Representative Sequence: NM_052874
    5 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000215095(uc010cad.2 uc010vfd.2) ENST00000569638 ENST00000565419
    ENST00000566211 ENST00000561836
    Block miRNA regulation of human, mouse, rat STX1B using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate STX1B (see all 72):
    hsa-miR-4254 hsa-miR-574-3p hsa-miR-138-2* hsa-miR-3921 hsa-miR-629* hsa-miR-149 hsa-miR-637 hsa-miR-3116
    SwitchGear 3'UTR luciferase reporter plasmidSTX1B 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for STX1B
    Predesigned siRNA for gene silencing in human, mouse, rat STX1B
    OriGene clones in human, mouse for STX1B (see all 6)
    OriGene ORF clones in mouse, rat for STX1B
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: STX1B (NM_052874)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for STX1B
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat STX1B
    OriGene qPCR primer pairs and template standards for STX1B
    OriGene qSTAR qPCR primer pairs in human, mouse for STX1B
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat STX1B
      QuantiTect SYBR Green Assays in human, mouse, rat STX1B
      QuantiFast Probe-based Assays in human, mouse, rat STX1B

    Additional mRNA sequence: 

    AK123137.1 AL713744.1 AL833259.1 AY028792.1 AY203924.1 AY995211.1 BC038359.1 BC062298.1 

    6 DOTS entries:

    DT.92417128  DT.86846036  DT.100020849  DT.100836888  DT.445784  DT.102823499 

    Selected AceView cDNA sequences (see all 63):

    T33774 Z45823 H18698 R15454 T33782 NM_052874 BX422853 AL833259 
    AY203924 R89620 BF967282 F04686 BG818056 AL713744 BQ640507 H18797 
    H19537 BF513511 BC062298 BQ940305 AY028792 AW956912 AK123137 Z45063 

    GeneLoc Exon Structure

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    STX1B expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    STX1B Expression
    About this image

    STX1B Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    STX1B Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.542230
        Custom PCR Arrays for STX1B
    OriGene qPCR primer pairs and template standards for STX1B
    OriGene qSTAR qPCR primer pairs in human, mouse for STX1B
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat STX1B
    QuantiTect SYBR Green Assays in human, mouse, rat STX1B
    QuantiFast Probe-based Assays in human, mouse, rat STX1B
    In Situ
    Assay Products:

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for STX1B

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals.

    Orthologs for STX1B gene from Selected species (see all 14)    About this table
    Organism Taxonomic
    Gene Description Human
    (Mus musculus)
    Mammalia Stx1b1 , 5 syntaxin 1B1, 5 92.13(n)1
      7 (69.75 cM)5
    562161  NM_024414.21  NP_077725.11 
    (Anolis carolinensis)
    Reptilia STX1B6
    syntaxin 1B
    1 ↔ 1
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia stx1b1 syntaxin 1B 84.03(n)
      100124935  NM_001102876.1  NP_001096346.1 
    (Danio rerio)
    Actinopterygii syntaxin1b2 syntaxin1b 82.34(n)   58038  AF229154.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta Syx1A6
    Syntaxin 1A
    1 → many
    (Caenorhabditis elegans)
    Secernentea unc-646
    Protein UNC-64, isoform a (unc-64) mRNA, complete ...
    1 → many
    III(13277261-13284364) WBGene00006798

    ENSEMBL Gene Tree for STX1B (if available)
    TreeFam Gene Tree for STX1B (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for STX1B gene
    STX22  STX1A2  STX112  STX32  STX192  STX42  
    11 SIMAP similar genes for STX1B using alignment to 2 protein entries:     STX1B_HUMAN (see all proteins):
    STX1A    stx1c    STX2    STX3    DKFZp686L1857    STX3A
    STX4A    STX4    STX11    STX19    STX16

    Find genes that share paralogs with STX1B           About GenesLikeMe

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for STX1B (see all 411)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    Chr 16 posSequence#AA
    C--31000753(+) AACAG-/AAATGGGACTC
    1 -- cds11Minor allele frequency- AAATGGGACTCTGAGGGCTAACAG:0.00NA 2
    C,F,A,H--31001095(+) GCGTGC/TGTCGA 1 -- ut3120Minor allele frequency- T:0.03NA NS EA WA CSA 1313
    --31001166(+) GGGGAA/GGAGGA 1 -- ut310--------
    C,F--31001268(+) CACATT/CTGTCC 1 -- ut311Minor allele frequency- C:0.04NA 120
    C,F--31001488(+) TCAACC/TCTTCT 1 -- ut313Minor allele frequency- T:0.04NS WA 186
    --31001756(+) CACAGA/GACAAG 1 -- ut310--------
    C--31001977(+) GCATGA/GCACAT 1 -- ut310--------
    C,F--31002064(+) CACCAC/TCTACC 1 -- ut311Minor allele frequency- T:0.04NA 120
    --31002237(+) GACCCA/GGCCCA 1 -- ut310--------
    --31002447(+) TTGCCG/TCATCA 1 -- ut310--------

    HapMap Linkage Disequilibrium report for STX1B (31000577 - 31021949 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 9 variations for STX1B:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv270787CNV Insertion20981092
    dgv35n68CNV Loss17160897
    nsv457483CNV Loss19166990
    dgv2671n71CNV Loss21882294
    nsv905729CNV Loss21882294
    nsv905733CNV Loss21882294
    nsv905739CNV Loss21882294
    dgv2670n71CNV Loss21882294
    nsv833193CNV Gain+Loss17160897

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing STX1B
    DNA2.0 Custom Variant and Variant Library Synthesis for STX1B

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 601485    OMIM disorders: --

    1 disease from the University of Copenhagen DISEASES database for STX1B:
    hemolytic-uremic syndrome

    Find genes that share disorders with STX1B           About GenesLikeMe

    Export disorders for STX1B gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for STX1B gene, integrated from 10 sources (see all 14):
    (articles sorted by number of sources associating them with STX1B)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Nuclear localization of a novel human syntaxin 1B isoform. (PubMed id 18691641)1, 2 Pereira S....Szepetowski P. (Gene 2008)
    2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    3. Proteomic analysis identifies dysfunction in cellular transport, energy, and protein metabolism in different brain regions of atypical frontotemporal lobar degeneration. (PubMed id 22360420)1 Martins-de-Souza D....Bahn S. (J. Proteome Res. 2012)
    4. System-wide temporal characterization of the proteome and phosphoproteome of human embryonic stem cell differentiation. (PubMed id 21406692)2 Rigbolt K.T....Blagoev B. (Sci. Signal. 2011)
    5. Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. (PubMed id 21139048)1 Danielsen J.M....Nielsen M.L. (amp 2011)
    6. Huntingtin interacting proteins are genetic modifiers of neurodegeneration. (PubMed id 17500595)1 Kaltenbach L.S....Hughes R.E. (PLoS Genet. 2007)
    7. The sequence and analysis of duplication-rich human chromosome 16. (PubMed id 15616553)2 Martin J.... Pennacchio L.A. (Nature 2004)
    8. Syntaxin isoform specificity in the regulation of renal H+-ATPase exocytosis. (PubMed id 12651853)1 Li G....Schwartz J.H. (J. Biol. Chem. 2003)
    9. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002)
    10. Munc 18a binding to syntaxin 1A and 1B isoforms defines its localization at the plasma membrane and blocks SNARE assembly in a three-hybrid system assay. (PubMed id 12093152)1 PAcrez-BrangulA- F....Blasi J. (Mol. Cell. Neurosci. 2002)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
    Free Text  

      Query String
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 112755 HGNC: 18539 AceView: STX1B2 Ensembl:ENSG00000099365 euGenes: HUgn112755
    ECgene: STX1B Kegg: 112755 H-InvDB: STX1B

    (According to HUGE)
    About This Section

    TryGeneCards Plus

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    PharmGKB entry for STX1B Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for STX1B gene:
    Search GeneIP for patents involving STX1B

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, eBioscience, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     EMD Millipore genomic analysis products

     Antibodies for STX1B (Syntaxin 1B)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for STX1B  
     OriGene qPCR primer pairs and template standards for STX1B   OriGene Protein Over-expression Lysate for STX1B  
     OriGene MassSpec something-or-other for STX1B   OriGene clones in human, mouse for STX1B  
     OriGene qSTAR qPCR primer pairs in human, mouse for STX1B   OriGene Purified Protein for STX1B  
     OriGene ORF clones in mouse, rat for STX1B   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for STX1B   OriGene Custom Protein Services for STX1B  

     Block miRNA regulation of human, mouse, rat STX1B using miScript Target Protectors SeqTarget long-range PCR primers for resequencing STX1B
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat STX1B Predesigned siRNA for gene silencing in human, mouse, rat STX1B
     QuantiFast Probe-based Assays in human, mouse, rat STX1B QuantiTect SYBR Green Assays in human, mouse, rat STX1B
     Custom PCR Arrays for STX1B Search Chromatin IP Primers for STX1B
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat STX1B  Search GeneGlobe Interaction Network for STX1B
     Regulatory tfbs in STX1B promoter
     GenScript Custom Purified and Recombinant Proteins Services for STX1B GenScript cDNA clones with any tag delivered in your preferred vector for STX1B
     GenScript Custom Assay Services for STX1B GenScript Custom overexpressing Cell Line Services for STX1B
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for STX1B
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     STX1B lysates
     Antibodies for STX1B
     See all of Abcam's Antibodies, Kits and Proteins for STX1B
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for STX1B
     Antibodies for STX1B
     ELISAs for STX1B
     CLIAs for STX1B

     Browse ESI BIO Cell Lines and PureStem Progenitors for STX1B
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for STX1B
     SwitchGear 3'UTR luciferase reporter plasmids for STX1B
     SwitchGear Promoter luciferase reporter plasmids for STX1B
     Search ThermoFisher Antibodies for STX1B
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat STX1B
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for STX1B
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for STX1B
     LSBio Antibodies in human, mouse, rat for STX1B
    Customized transgenic rodents for:
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
     Search Addgene for plasmids for STX1B
      Search eBioscience for proteins for STX1B
      Search eBioscience for elisas for STX1B
      eBioscience FlowRNA Probe Sets
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014

    View Random Gene

    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      STX1B gene at Home site.
    Version: 3.12.212 17 Sep 2014
    hostname: index build: 128 solr: 1.4