Free for academic non-profit institutions. Other users need a Commercial license

Aliases for STK4-AS1 Gene

Subcategory (RNA class) for STK4-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for STK4-AS1 Gene

  • STK4 Antisense RNA 1 (Head To Head) 2 3 5
  • STK4 Antisense RNA 1 (Non-Protein Coding) 2
  • STK4 Antisense RNA 1 2

External Ids for STK4-AS1 Gene

Previous GeneCards Identifiers for STK4-AS1 Gene

  • GC20M043594

Summaries for STK4-AS1 Gene

GeneCards Summary for STK4-AS1 Gene

STK4-AS1 (STK4 Antisense RNA 1 (Head To Head)) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for STK4-AS1 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for STK4-AS1 Gene

Genomics for STK4-AS1 Gene

GeneHancer (GH) Regulatory Elements for STK4-AS1 Gene

Promoters and enhancers for STK4-AS1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH20I044909 Promoter/Enhancer 2.3 EPDnew FANTOM5 Ensembl ENCODE 10.6 +55.7 55713 2.9 HDGF CLOCK FOXA2 ARNT ZFP64 ARID4B SIN3A DMAP1 YY1 SLC30A9 PABPC1L YWHAB ENSG00000271984 ZSWIM1 SPATA25 TOMM34 STK4 STK4-AS1 DBNDD2 PIR52220
GH20I044989 Enhancer 1.1 Ensembl ENCODE dbSUPER 13 -25.5 -25466 4.6 MEIS2 PKNOX1 JUN ETV1 EBF1 ZFHX2 ZNF316 SCRT2 NFE2 MAFK STK4 STK4-AS1 TOMM34 ENSG00000252021
GH20I045014 Enhancer 1 Ensembl ENCODE dbSUPER 12 -49.0 -48983 2.7 CEBPG FEZF1 PPARG ZNF664 JUND PRDM6 POLR2A CEBPA PRDM10 PRDM1 STK4 STK4-AS1 TOMM34 PABPC1L KCNS1 ENSG00000252021 PIR48188
GH20I045010 Enhancer 0.9 ENCODE dbSUPER 11.9 -44.6 -44571 2 CTCF ZNF654 HLF DACH1 MZF1 REST RAD21 RFX5 ZNF121 JUND STK4 STK4-AS1 TOMM34 PABPC1L ENSG00000252021 PIR48188
GH20I045012 Enhancer 0.6 ENCODE dbSUPER 11.9 -46.4 -46433 1.6 JUND ZNF362 CEBPB STK4 STK4-AS1 TOMM34 PABPC1L ENSG00000252021 PIR48188
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around STK4-AS1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for STK4-AS1 Gene

Genomic Locations for STK4-AS1 Gene
chr20:44,963,794-44,966,458
(GRCh38/hg38)
Size:
2,665 bases
Orientation:
Minus strand
chr20:43,592,435-43,595,099
(GRCh37/hg19)

Genomic View for STK4-AS1 Gene

Genes around STK4-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
STK4-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for STK4-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for STK4-AS1 Gene

Proteins for STK4-AS1 Gene

Post-translational modifications for STK4-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for STK4-AS1 Gene

Domains & Families for STK4-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for STK4-AS1 Gene

Function for STK4-AS1 Gene

Phenotypes From GWAS Catalog for STK4-AS1 Gene

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for STK4-AS1 Gene

Localization for STK4-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for STK4-AS1 Gene

Pathways & Interactions for STK4-AS1 Gene

SuperPathways for STK4-AS1 Gene

No Data Available

Interacting Proteins for STK4-AS1 Gene

Gene Ontology (GO) - Biological Process for STK4-AS1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for STK4-AS1 Gene

Drugs & Compounds for STK4-AS1 Gene

No Compound Related Data Available

Transcripts for STK4-AS1 Gene

mRNA/cDNA for STK4-AS1 Gene

(2) Additional mRNA sequences :
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for STK4-AS1 Gene

STK4 antisense RNA 1 (head to head):
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for STK4-AS1 Gene

No ASD Table

Relevant External Links for STK4-AS1 Gene

GeneLoc Exon Structure for
STK4-AS1
ECgene alternative splicing isoforms for
STK4-AS1

Expression for STK4-AS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for STK4-AS1 Gene

mRNA differential expression in normal tissues according to GTEx for STK4-AS1 Gene

This gene is overexpressed in Testis (x19.1).

SOURCE GeneReport for Unigene cluster for STK4-AS1 Gene:

Hs.196065
genes like me logo Genes that share expression patterns with STK4-AS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for STK4-AS1 Gene

Orthologs for STK4-AS1 Gene

Evolution for STK4-AS1 Gene

ENSEMBL:
Gene Tree for STK4-AS1 (if available)
TreeFam:
Gene Tree for STK4-AS1 (if available)

No data available for Orthologs for STK4-AS1 Gene

Paralogs for STK4-AS1 Gene

No data available for Paralogs for STK4-AS1 Gene

Variants for STK4-AS1 Gene

Sequence variations from dbSNP and Humsavar for STK4-AS1 Gene

SNP ID Clin Chr 20 pos Variation AA Info Type
rs1000555916 -- 44,965,437(-) A/G non_coding_transcript_variant
rs1001420212 -- 44,965,987(-) T/C intron_variant
rs1001462417 -- 44,965,229(-) AAACCGTGGGTCTCAGCTTTCTTATCTGTTAACGGTAGGTAC/ non_coding_transcript_variant
rs1001718181 -- 44,965,910(-) G/A intron_variant
rs1002982761 -- 44,967,203(-) T/A upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for STK4-AS1 Gene

Variant ID Type Subtype PubMed ID
nsv1056102 CNV loss 25217958

Additional Variant Information for STK4-AS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
STK4-AS1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for STK4-AS1 Gene

Disorders for STK4-AS1 Gene

Additional Disease Information for STK4-AS1

No disorders were found for STK4-AS1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for STK4-AS1 Gene

Publications for STK4-AS1 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 58

Products for STK4-AS1 Gene

Sources for STK4-AS1 Gene

Content
Loading form....