Free for academic non-profit institutions. Other users need a Commercial license

Aliases for STK4-AS1 Gene

Subcategory (RNA class) for STK4-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for STK4-AS1 Gene

  • STK4 Antisense RNA 1 (Head To Head) 2 3 5
  • STK4 Antisense RNA 1 (Non-Protein Coding) 2
  • STK4 Antisense RNA 1 2

External Ids for STK4-AS1 Gene

Previous GeneCards Identifiers for STK4-AS1 Gene

  • GC20M043594

Summaries for STK4-AS1 Gene

GeneCards Summary for STK4-AS1 Gene

STK4-AS1 (STK4 Antisense RNA 1 (Head To Head)) is an RNA Gene, and is affiliated with the non-coding RNA class.

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for STK4-AS1 Gene

Genomics for STK4-AS1 Gene

Regulatory Elements for STK4-AS1 Gene

Enhancers for STK4-AS1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH20G044989 1.3 Ensembl ENCODE dbSUPER 13 -25.5 -25466 4.6 PKNOX1 JUN ETV1 EBF1 ZFHX2 ZNF316 SCRT2 NFE2 FOS MAFK STK4 STK4-AS1 TOMM34 ENSG00000252021
GH20G044909 1.5 FANTOM5 ENCODE 10.6 +55.7 55714 2.9 HDGF CREB3L1 ARNT AGO1 ZFP64 SIN3A ARID4B DMAP1 YY1 SLC30A9 YWHAB SPATA25 PABPC1L TOMM34 STK4-AS1 STK4 DBNDD2 PIR52220
GH20G045014 1.2 Ensembl ENCODE dbSUPER 12 -49.0 -48983 2.7 SIN3A FEZF1 CEBPG PPARG ZNF664 JUND PRDM6 CEBPA PRDM10 PRDM1 STK4 STK4-AS1 TOMM34 PABPC1L KCNS1 ENSG00000252021 PIR48188
GH20G045010 1 ENCODE dbSUPER 11.9 -44.6 -44572 2.0 CTCF ZNF654 HLF SIN3A REST RAD21 RFX5 ZNF121 JUND GATA2 STK4 STK4-AS1 TOMM34 PABPC1L ENSG00000252021 PIR48188
GH20G045012 0.8 ENCODE dbSUPER 11.9 -46.4 -46433 1.6 ZNF362 JUND TEAD4 CEBPB STK4 STK4-AS1 TOMM34 PABPC1L ENSG00000252021 PIR48188
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around STK4-AS1 on UCSC Golden Path with GeneCards custom track

Genomic Location for STK4-AS1 Gene

Chromosome:
20
Start:
44,963,794 bp from pter
End:
44,966,458 bp from pter
Size:
2,665 bases
Orientation:
Minus strand

Genomic View for STK4-AS1 Gene

Genes around STK4-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
STK4-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for STK4-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for STK4-AS1 Gene

Proteins for STK4-AS1 Gene

Post-translational modifications for STK4-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for STK4-AS1 Gene

Domains & Families for STK4-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for STK4-AS1 Gene

Function for STK4-AS1 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for STK4-AS1 Gene

Localization for STK4-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for STK4-AS1 Gene

Pathways & Interactions for STK4-AS1 Gene

SuperPathways for STK4-AS1 Gene

No Data Available

Interacting Proteins for STK4-AS1 Gene

Gene Ontology (GO) - Biological Process for STK4-AS1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for STK4-AS1 Gene

Drugs & Compounds for STK4-AS1 Gene

No Compound Related Data Available

Transcripts for STK4-AS1 Gene

mRNA/cDNA for STK4-AS1 Gene

(2) Additional mRNA sequences :
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for STK4-AS1 Gene

STK4 antisense RNA 1 (head to head):
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for STK4-AS1 Gene

No ASD Table

Relevant External Links for STK4-AS1 Gene

GeneLoc Exon Structure for
STK4-AS1
ECgene alternative splicing isoforms for
STK4-AS1

Expression for STK4-AS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for STK4-AS1 Gene

mRNA differential expression in normal tissues according to GTEx for STK4-AS1 Gene

This gene is overexpressed in Testis (x19.1).

SOURCE GeneReport for Unigene cluster for STK4-AS1 Gene:

Hs.196065
genes like me logo Genes that share expression patterns with STK4-AS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for STK4-AS1 Gene

Orthologs for STK4-AS1 Gene

Evolution for STK4-AS1 Gene

ENSEMBL:
Gene Tree for STK4-AS1 (if available)
TreeFam:
Gene Tree for STK4-AS1 (if available)

No data available for Orthologs for STK4-AS1 Gene

Paralogs for STK4-AS1 Gene

No data available for Paralogs for STK4-AS1 Gene

Variants for STK4-AS1 Gene

Sequence variations from dbSNP and Humsavar for STK4-AS1 Gene

SNP ID Clin Chr 20 pos Sequence Context AA Info Type
rs1000555916 -- 44,965,437(+) TCTGT(A/G)GATGG nc-transcript-variant, upstream-variant-2KB
rs1001420212 -- 44,965,987(+) CAAAC(C/T)GACTT intron-variant, upstream-variant-2KB
rs1001462417 -- 44,965,229(+) TGTGT(-/AAACCGTGGGTCTCAGCTTTCTTATCTGTTAACGGTAGGTAC)TTCTT nc-transcript-variant, upstream-variant-2KB
rs1001718181 -- 44,965,910(+) CAGGG(A/G)ATTAA intron-variant, upstream-variant-2KB
rs1002982761 -- 44,967,203(+) TTTAT(A/T)ACTGA intron-variant, upstream-variant-2KB, reference, synonymous-codon

Structural Variations from Database of Genomic Variants (DGV) for STK4-AS1 Gene

Variant ID Type Subtype PubMed ID
nsv1056102 CNV loss 25217958

Relevant External Links for STK4-AS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
STK4-AS1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for STK4-AS1 Gene

Disorders for STK4-AS1 Gene

Relevant External Links for STK4-AS1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
STK4-AS1

No disorders were found for STK4-AS1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for STK4-AS1 Gene

Publications for STK4-AS1 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 64

Products for STK4-AS1 Gene

Sources for STK4-AS1 Gene

Content
Loading form....