Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



STK31 Gene

protein-coding   GIFtS: 51
GCID: GC07P023749

Serine/Threonine Kinase 31

  Search for STK31
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Serine/Threonine Kinase 311 2     Serine/Threonine-Protein Kinase 312
Serine/Threonine-Protein Kinase NYD-SPK2 3     Tudor Domain Containing 82
Sugen Kinase 3962 3     EC 2.7.11.13
SGK3962 3     SgK3963
TDRD82     

External Ids:    HGNC: 114071   Entrez Gene: 561642   Ensembl: ENSG000001963357   OMIM: 6057905   UniProtKB: Q9BXU13   

Export aliases for STK31 gene to outside databases

Previous GC identifers: GC07P023392 GC07P023458 GC07P023492 GC07P023523 GC07P023716 GC07P023634


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for STK31 Gene:
This gene is similar to a mouse gene that encodes a putative protein kinase with a tudor domain, and shows
testis-specific expression. Alternative splicing results in multiple transcript variants encoding different
isoforms. (provided by RefSeq, Jul 2008)

GeneCards Summary for STK31 Gene:
STK31 (serine/threonine kinase 31) is a protein-coding gene. GO annotations related to this gene include hydrolase activity, acting on ester bonds and protein serine/threonine kinase activity.




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000007.14  NT_007819.18  NC_018918.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the STK31 gene promoter:
         FOXF2   Nkx2-2   Pax-6   Evi-1   ATF6   HNF-4alpha1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 4): STK31 promoter sequence
   Search Chromatin IP Primers for STK31

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat STK31


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 7p15.3   Ensembl cytogenetic band:  7p15.3   HGNC chromosome: 7

STK31 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
STK31 gene location

GeneLoc information about chromosome 7         GeneLoc Exon Structure

GeneLoc location for GC07P023749:  view genomic region     (about GC identifiers)

Start:
23,749,786 bp from pter      End:
23,872,132 bp from pter
Size:
122,347 bases      Orientation:
plus strand

1 alternative location:
Chr7+,CRA_TCAG 23,801,635-23,923,918     

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: STK31_HUMAN, Q9BXU1 (See protein sequence)
Recommended Name: Serine/threonine-protein kinase 31  
Size: 1019 amino acids; 115694 Da
Caution: Ser-854 is present instead of the conserved Asp which is expected to be an active site residue
Secondary accessions: B4DZ06 B7WPP5 C9J4F9 Q6PCD3 Q9BXH8
Alternative splicing: 3 isoforms:  Q9BXU1-1   Q9BXU1-2   Q9BXU1-3   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for STK31: NX_Q9BXU1

Explore proteomics data for STK31 at MOPED

Post-translational modifications: 

  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus

  • See STK31 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (4 alternative transcripts): 
    NP_001247433.1  NP_001247434.1  NP_113602.2  NP_116562.2  

    ENSEMBL proteins: 
     ENSP00000348132   ENSP00000414087   ENSP00000389340   ENSP00000411852   ENSP00000346660  
     ENSP00000435974   ENSP00000398413   ENSP00000406146  

    STK31 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for STK31
    OriGene Protein Over-expression Lysate for STK31
    OriGene MassSpec for STK31
    OriGene Custom Protein Services for STK31
    GenScript Custom Purified and Recombinant Proteins Services for STK31
    Novus Biologicals STK31 Proteins
    Novus Biologicals STK31 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for STK31

    STK31 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for STK31
    Novus Biologicals STK31 Antibodies
    Abcam antibodies for STK31
    Cloud-Clone Corp. Antibodies for STK31
    ThermoFisher Antibodies for STK31
    LSBio Antibodies in human, mouse, rat for STK31

    STK31 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for STK31
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for STK31
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for STK31
    Cloud-Clone Corp. CLIAs for STK31


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    TDRD: Tudor domain containing

    IUPHAR Guide to PHARMACOLOGY protein family classification: serine/threonine kinase 31
    Other-unique family

    4 InterPro protein domains:
     IPR011009 Kinase-like_dom
     IPR000719 Prot_kinase_dom
     IPR016071 Staphylococal_nuclease_OB-fold
     IPR002999 Tudor

    Graphical View of Domain Structure for InterPro Entry Q9BXU1

    ProtoNet protein and cluster: Q9BXU1

    2 Blocks protein domains:
    IPB002999 Tudor domain
    IPB008191 Maternal tudor protein


    UniProtKB/Swiss-Prot: STK31_HUMAN, Q9BXU1
    Similarity: Belongs to the protein kinase superfamily. Ser/Thr protein kinase family
    Similarity: Contains 1 protein kinase domain
    Similarity: Contains 1 Tudor domain


    STK31 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: STK31_HUMAN, Q9BXU1
    Catalytic activity: ATP + a protein = ADP + a phosphoprotein

         Enzyme Number (IUBMB): EC 2.7.11.11

         Gene Ontology (GO): Selected molecular function terms (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003676nucleic acid binding IEA--
    GO:0004672protein kinase activity ----
    GO:0004674protein serine/threonine kinase activity IEA--
    GO:0005524ATP binding IEA--
    GO:0016772transferase activity, transferring phosphorus-containing groups ----
         
    STK31 for ontologies           About GeneDecksing


    Phenotypes:
         1 GenomeRNAi human phenotype for STK31:
     Decreased focal adhesion (FA)  

         1 MGI mutant phenotype (inferred from 1 allele(MGI details for Stk31):
     normal 

    STK31 for phenotypes           About GeneDecksing

    Animal Models:
       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for STK31
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for STK31

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for STK31
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for STK31

    miRNA
    Products:
        
    Block miRNA regulation of human, mouse, rat STK31 using miScript Target Protectors
    Search for qRT-PCR Assays for microRNAs that regulate STK31
    SwitchGear 3'UTR luciferase reporter plasmidSTK31 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for STK31
    Predesigned siRNA for gene silencing in human, mouse, rat STK31

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for STK31

    Clone
    Products:
         
    OriGene clones in human, mouse for STK31 (see all 11)
    OriGene ORF clones in mouse, rat for STK31
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): STK31 (NM_031414)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for STK31
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat STK31

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for STK31
    Browse ESI BIO Cell Lines and PureStem Progenitors for STK31 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for STK31


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    cytosol2
    nucleus2
    golgi apparatus1

    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for STK31 About    
    See pathways by source

    SuperPathContained pathways About
    1Sweet Taste Signaling
    Sperm Motility0.37

    1 Downloadable PowerPoint Slide of GeneGlobe Pathway Central Maps for STK31
        Sperm Motility


        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for STK31
    Interactions:

        Search GeneGlobe Interaction Network for STK31

    STRING Interaction Network Preview (showing 1 interactants - click image to see more details)

    2 Interacting proteins for STK31 (Q9BXU13 ENSP000003481324) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    ESR2Q927313, ENSP000003439254I2D: score=1 STRING: ENSP00000343925
    PIWIL1Q96J943I2D: score=1 
    About this table

    Gene Ontology (GO): 1 biological process term:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006468protein phosphorylation ----

    STK31 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for STK31



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for STK31 gene (5 alternative transcripts): 
    NM_001260504.1  NM_001260505.1  NM_031414.4  NM_032944.3  NM_001122833.1  

    Unigene Cluster for STK31:

    Serine/threonine kinase 31
    Hs.309767  [show with all ESTs]
    Unigene Representative Sequence: BC036476
    14 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000355870(uc003sws.4 uc003swt.4 uc011jze.2 uc003swv.1)
    ENST00000422637 ENST00000456014 ENST00000476399 ENST00000433467 ENST00000461866
    ENST00000354639 ENST00000531170 ENST00000444333 ENST00000405627 ENST00000528479
    ENST00000529549 ENST00000478321 ENST00000428484(uc010kuq.3)
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat STK31 using miScript Target Protectors
    Search for qRT-PCR Assays for microRNAs that regulate STK31
    SwitchGear 3'UTR luciferase reporter plasmidSTK31 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for STK31
    Predesigned siRNA for gene silencing in human, mouse, rat STK31
    Clone
    Products:
         
    OriGene clones in human, mouse for STK31 (see all 11)
    OriGene ORF clones in mouse, rat for STK31
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): STK31 (NM_031414)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for STK31
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat STK31
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for STK31
    OriGene qSTAR qPCR primer pairs in human, mouse for STK31
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat STK31
      QuantiTect SYBR Green Assays in human, mouse, rat STK31
      QuantiFast Probe-based Assays in human, mouse, rat STK31

    Additional mRNA sequence: 

    AF285599.1 AF332194.1 AK057271.1 AK131214.1 AK292474.1 AK302689.1 BC033018.1 BC036476.1 
    BC059374.1 NR_048542.1 

    8 DOTS entries:

    DT.70101462  DT.97770476  DT.100675312  DT.97762871  DT.121042620  DT.100676695  DT.95330928  DT.99935559 

    Selected AceView cDNA sequences (see all 42):

    BI826581 BC059374 BG207010 CD300254 BC036476 BG214885 BG210662 BC047506 
    BG196157 NM_032944 AF285599 AI613437 BC033018 AK131214 BQ435707 NM_031414 
    AF332194 BI461148 AA315045 AK057271 AL048857 AI694552 BI559853 BG202661 

    GeneLoc Exon Structure

    5 Alternative Splicing Database (ASD) splice patterns (SP) for STK31    About this scheme

    ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18a · 18b ^ 19 ^ 20 ^ 21 ^ 22 ^ 23 ^
    SP1:              -                             -     -                                                                 -                                       
    SP2:                                                                                                                                                            
    SP3:                                                                                                                                                            
    SP4:                                                                                                                                                            
    SP5:                                                                                                                                                            

    ExUns: 24 ^ 25 ^ 26 ^ 27
    SP1:                        
    SP2:                        
    SP3:                        
    SP4:                        
    SP5:                        


    ECgene alternative splicing isoforms for STK31

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    STK31 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: ATGGTTGGTG
    STK31 Expression
    About this image


    STK31 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 3) fully expand
     
     Gonad
             XY Germ Cells Testis Cord
     
     Testis (Reproductive System)
             XY Germ Cells Testis Cord
     
     Ovary (Reproductive System)
             XX Germ Cells Ovigerous Cord
    STK31 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    STK31 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.309767

    UniProtKB/Swiss-Prot: STK31_HUMAN, Q9BXU1
    Tissue specificity: Testis specific

        Custom PCR Arrays for STK31
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for STK31
    OriGene qSTAR qPCR primer pairs in human, mouse for STK31
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat STK31
    QuantiTect SYBR Green Assays in human, mouse, rat STK31
    QuantiFast Probe-based Assays in human, mouse, rat STK31
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for STK31

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of chordates.

    Orthologs for STK31 gene from Selected species (see all 11)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Stk311 , 5 serine threonine kinase 311, 5 84.58(n)1
    78.44(a)1
      6 (23.87 cM)5
    774851  NM_029916.21  NP_084192.21 
     493956045 
    chicken
    (Gallus gallus)
    Aves STK311 serine/threonine kinase 31 63.73(n)
    56.08(a)
      420621  XM_418720.4  XP_418720.4 
    lizard
    (Anolis carolinensis)
    Reptilia STK316
    serine/threonine kinase 31
    50(a)
    1 ↔ 1
    6(30672266-30723424)
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia stk311 serine/threonine kinase 31 58.03(n)
    48.85(a)
      100380163  XM_002933400.2  XP_002933446.2 
    zebrafish
    (Danio rerio)
    Actinopterygii LOC1003307651 serine/threonine-protein kinase 31-like 50.5(n)
    36.89(a)
      100330765  XM_002664866.3  XP_002664912.3 


    ENSEMBL Gene Tree for STK31 (if available)
    TreeFam Gene Tree for STK31 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for STK31 (see all 2878)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 7 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0411584
    A lung neuroendocrine carcinoma sample4--see VAR_0411582 H Y mis40--------
    VAR_0411604
    A lung small cell carcinoma sample4--see VAR_0411602 V L mis40--------
    rs715522511,2
    C--23721804(+) GGCTC-/TG/   
      TGTGTG
    TGTGT
    3 -- us2k11NA 2
    rs604520891,2
    C--23734887(+) ATTTT-/CTACCATTGTATTACTGGTTTTGTTTGTTTCTTGTTTCT
    TTTTCTTTTTTTCCCTTCCTGTGCATTACTTGAAAAAATTTT
    AAGAG
    5 -- int11Minor allele frequency- CTACCATTGTATTACTGGTTTTGTTTGTTTCTTGTTTCTTTTTCTTTTTTTCCCTTCCTGTGCATTACTTGAAAAAATTTT:0.00NA 2
    rs1405731131,2
    --23747791(+) TACTGG/TGCTCA 3 -- us2k10--------
    rs1134924271,2
    F--23747906(+) TGTGTG/TTGTGT 3 -- us2k11Minor allele frequency- T:0.50CSA 2
    rs2014123001,2
    --23747906(+) GTGTG-/TTTGTGT 3 -- us2k10--------
    rs1915789771,2
    --23747942(+) GCTTCC/TACGAT 3 -- us2k10--------
    rs69628591,2
    C,F,A,H--23747944(+) TTCTAT/CGATCG 3 -- us2k120Minor allele frequency- C:0.42NS EA NA WA 1424
    rs1456949491,2
    --23747949(+) CGATCA/GCATGA 5 -- us2k10--------

    HapMap Linkage Disequilibrium report for STK31 (23749786 - 23872132 bp)

    Structural Variations
         Database of Genomic Variants (DGV) Selected variations for STK31 (see all 13):    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2734132CNV Deletion23290073
    esv1343786CNV Deletion17803354
    esv2372085CNV Deletion18987734
    esv2734131CNV Deletion23290073
    esv2602899CNV Deletion19546169
    esv2673027CNV Deletion23128226
    nsv365951CNV Loss16902084
    nsv366286CNV Loss16902084
    nsv830924CNV Loss17160897
    nsv510074CNV Loss20534489

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing STK31
    DNA2.0 Custom Variant and Variant Library Synthesis for STK31

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 605790    OMIM disorders: --


    STK31 for disorders           About GeneDecksing

    Genetic Association Database (GAD): STK31
    Human Genome Epidemiology (HuGE) Navigator: STK31 (2 documents)

    Export disorders for STK31 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for STK31 gene, integrated from 10 sources (see all 16):
    (articles sorted by number of sources associating them with STK31)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. An abundance of X-linked genes expressed in spermatogonia. (PubMed id 11279525)1, 2, 3 Wang P.J.... Page D.C. (Nat. Genet. 2001)
    2. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1, 4 Rose J.E....Uhl G.R. (Mol. Med. 2010)
    3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (Nat. Genet. 2004)
    4. The DNA sequence of human chromosome 7. (PubMed id 12853948)1, 2 Hillier L.W.... Wilson R.K. (Nature 2003)
    5. STK31 maintains the undifferentiated state of colon cancer cells. (PubMed id 22828137)1 Fok K.L....Chang Chan H. (Carcinogenesis 2012)
    6. Single-nucleotide polymorphisms, acute rejection, and severity of tubulitis in kidney transplantation, accounting for center-to-center variation. (PubMed id 21085059)4 Israni A....Oetting W.S. (Transplantation 2010)
    7. Comparison of substrate specificity of the ubiquitin ligases Nedd4 and Nedd4-2 using proteome arrays. (PubMed id 19953087)1 Persaud A....Rotin D. (Mol. Syst. Biol. 2009)
    8. Patterns of somatic mutation in human cancer genomes. (PubMed id 17344846)2 Greenman C.... Stratton M.R. (Nature 2007)
    9. Genome-wide association study of electrocardiographic and heart rate variability traits: the Framingham Heart Study. (PubMed id 17903306)4 Newton-Cheh C....Larson M.G. (BMC Med. Genet. 2007)
    10. A genome-wide association study for blood lipid phenotypes in the Framingham Heart Study. (PubMed id 17903299)4 Kathiresan S....Cupples L.A. (BMC Med. Genet. 2007)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 56164 HGNC: 11407 AceView: STK31 Ensembl:ENSG00000196335 euGenes: HUgn56164
    ECgene: STK31 H-InvDB: STK31

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for STK31 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for STK31 gene:
    Search GeneIP for patents involving STK31

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for STK31  
     OriGene qPCR primer pairs and template standards for STK31   OriGene Protein Over-expression Lysate for STK31  
     OriGene MassSpec something-or-other for STK31   OriGene clones in human, mouse for STK31  
     OriGene qSTAR qPCR primer pairs in human, mouse for STK31   OriGene Purified Protein for STK31  
     OriGene ORF clones in mouse, rat for STK31   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for STK31   OriGene Custom Protein Services for STK31  

     
     
     Block miRNA regulation of human, mouse, rat STK31 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing STK31
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat STK31 Predesigned siRNA for gene silencing in human, mouse, rat STK31
     QuantiFast Probe-based Assays in human, mouse, rat STK31 QuantiTect SYBR Green Assays in human, mouse, rat STK31
     Custom PCR Arrays for STK31 Search Chromatin IP Primers for STK31
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat STK31  Search GeneGlobe Interaction Network for STK31
     Regulatory tfbs in STK31 promoter
     GenScript Custom Purified and Recombinant Proteins Services for STK31 GenScript cDNA clones with any tag delivered in your preferred vector for STK31
     GenScript Custom Assay Services for STK31 GenScript Custom overexpressing Cell Line Services for STK31
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for STK31
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     STK31 antibodies
     STK31 proteins
     STK31 lysates
     Antibodies for STK31
     See all of Abcam's Antibodies, Kits and Proteins for STK31
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for STK31
     Antibodies for STK31
     ELISAs for STK31
     CLIAs for STK31



     Browse ESI BIO Cell Lines and PureStem Progenitors for STK31
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for STK31
     SwitchGear 3'UTR luciferase reporter plasmids for STK31
     SwitchGear Promoter luciferase reporter plasmids for STK31
     ThermoFisher Antibodies for STK31
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat STK31
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for STK31
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for STK31
     LSBio Antibodies in human, mouse, rat for STK31
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      STK31 gene at Home site.
    Version: 3.12.162 20 Aug 2014
    hostname: 356977-web1.xennexinc.com index build: 126 solr: 1.4