Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SSTR3 Gene

Aliases for SSTR3 Gene

  • Somatostatin Receptor 3 2 3 5
  • SS-3-R 3 4
  • SSR-28 3 4
  • SS3-R 3 4
  • SS3R 3 4
  • Somatostatin Receptor Type 3 3

External Ids for SSTR3 Gene

Previous GeneCards Identifiers for SSTR3 Gene

  • GC22M034217
  • GC22M035845
  • GC22M035926
  • GC22M037600
  • GC22M020567

Summaries for SSTR3 Gene

Entrez Gene Summary for SSTR3 Gene

  • This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

GeneCards Summary for SSTR3 Gene

SSTR3 (Somatostatin Receptor 3) is a Protein Coding gene. Diseases associated with SSTR3 include Oncogenic Osteomalacia. Among its related pathways are Signaling by GPCR and Peptide ligand-binding receptors. GO annotations related to this gene include G-protein coupled receptor activity and somatostatin receptor activity. An important paralog of this gene is SSTR5.

UniProtKB/Swiss-Prot for SSTR3 Gene

  • Receptor for somatostatin-14 and -28. This receptor is coupled via pertussis toxin sensitive G proteins to inhibition of adenylyl cyclase.

Tocris Summary for SSTR3 Gene

  • Somatostatin (somatotropin release inhibiting factor, SRIF) is an endogenous cyclic polypeptide with two biologically active forms. It is an abundant neuropeptide and has a wide range of physiological effects on neurotransmission, secretion and cell proliferation.

Gene Wiki entry for SSTR3 Gene

No data available for PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SSTR3 Gene

Genomics for SSTR3 Gene

Regulatory Elements for SSTR3 Gene

Enhancers for SSTR3 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH22F037217 1.9 FANTOM5 Ensembl ENCODE 12.5 -11.2 -11212 28.8 HDGF PKNOX1 ARNT MLX CREB3L1 WRNIP1 ARID4B SIN3A DMAP1 ZNF143 CSF2RB RAC2 LL22NC01-81G9.3 ENSG00000229971 SSTR3 GGA1 CYTH4 TEX33 ENSG00000226233 C1QTNF6
GH22F037191 1.4 Ensembl ENCODE 6.7 +24.0 23970 9.5 HDGF PKNOX1 CREB3L1 MLX ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 C1QTNF6 IL2RB ENSG00000235237 TMPRSS6 ENSG00000231467 CYTH4 SSTR3 GC22M037168
GH22F037175 1.1 Ensembl ENCODE 6.1 +42.0 42044 6.0 ELF3 CREB3L1 RAD21 RARA YY1 ZNF121 EGR2 SMARCA5 CEBPB NR2F2 C1QTNF6 TMPRSS6 ENSG00000231467 CYTH4 SSTR3 ENSG00000226233 IL2RB GC22M037168
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around SSTR3 on UCSC Golden Path with GeneCards custom track

Genomic Location for SSTR3 Gene

Chromosome:
22
Start:
37,204,237 bp from pter
End:
37,220,447 bp from pter
Size:
16,211 bases
Orientation:
Minus strand

Genomic View for SSTR3 Gene

Genes around SSTR3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SSTR3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SSTR3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SSTR3 Gene

Proteins for SSTR3 Gene

  • Protein details for SSTR3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P32745-SSR3_HUMAN
    Recommended name:
    Somatostatin receptor type 3
    Protein Accession:
    P32745
    Secondary Accessions:
    • A8K550
    • Q53ZR7

    Protein attributes for SSTR3 Gene

    Size:
    418 amino acids
    Molecular mass:
    45847 Da
    Quaternary structure:
    • Homodimer and heterodimer with SSTR2. Heterodimerization with SSTR2 inactivates SSTR3 receptor function (By similarity).

neXtProt entry for SSTR3 Gene

Post-translational modifications for SSTR3 Gene

  • Phosphorylated. Phosphorylation increases upon somatostatin binding (By similarity).
  • Glycosylation at Asn 17 and Asn 30
  • Modification sites at PhosphoSitePlus

Other Protein References for SSTR3 Gene

Antibody Products

  • R&D Systems Antibodies for SSTR3 (Somatostatin R3/SSTR3)

No data available for DME Specific Peptides for SSTR3 Gene

Domains & Families for SSTR3 Gene

Gene Families for SSTR3 Gene

Suggested Antigen Peptide Sequences for SSTR3 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P32745

UniProtKB/Swiss-Prot:

SSR3_HUMAN :
  • Belongs to the G-protein coupled receptor 1 family.
Family:
  • Belongs to the G-protein coupled receptor 1 family.
genes like me logo Genes that share domains with SSTR3: view

Function for SSTR3 Gene

Molecular function for SSTR3 Gene

GENATLAS Biochemistry:
somatostatin receptor gene 3,G protein coupled receptor superfamily
UniProtKB/Swiss-Prot Function:
Receptor for somatostatin-14 and -28. This receptor is coupled via pertussis toxin sensitive G proteins to inhibition of adenylyl cyclase.

Gene Ontology (GO) - Molecular Function for SSTR3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004930 G-protein coupled receptor activity IEA --
GO:0004994 somatostatin receptor activity IEA,TAS --
GO:0005102 receptor binding IEA --
GO:0005515 protein binding IPI 19071123
GO:0042923 neuropeptide binding IBA --
genes like me logo Genes that share ontologies with SSTR3: view
genes like me logo Genes that share phenotypes with SSTR3: view

Animal Models for SSTR3 Gene

MGI Knock Outs for SSTR3:

Animal Model Products

  • Taconic Biosciences Mouse Models for SSTR3

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for SSTR3
  • R&D Systems cDNA Clones for SSTR3 (Somatostatin R3/SSTR3)

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for SSTR3 Gene

Localization for SSTR3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SSTR3 Gene

Cell membrane; Multi-pass membrane protein. Note=Internalized into endoplasmic vesicles upon somatostatin-stimulation. {ECO:0000250}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SSTR3 gene
Compartment Confidence
plasma membrane 5
cytoskeleton 1
nucleus 1

Gene Ontology (GO) - Cellular Components for SSTR3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005886 plasma membrane TAS --
GO:0005887 integral component of plasma membrane TAS 1337145
GO:0005929 cilium IEA --
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with SSTR3: view

Pathways & Interactions for SSTR3 Gene

genes like me logo Genes that share pathways with SSTR3: view

Gene Ontology (GO) - Biological Process for SSTR3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007165 signal transduction IEA --
GO:0007186 G-protein coupled receptor signaling pathway IEA --
GO:0007187 G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger TAS 8405411
GO:0007267 cell-cell signaling TAS 1337145
GO:0007268 chemical synaptic transmission IBA --
genes like me logo Genes that share ontologies with SSTR3: view

No data available for SIGNOR curated interactions for SSTR3 Gene

Drugs & Compounds for SSTR3 Gene

(59) Drugs for SSTR3 Gene - From: DrugBank, ApexBio, DGIdb, IUPHAR, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Octreotide Approved, Investigational Pharma Full agonist, Agonist, binder sst2, sst3 and sst5 agonist 213
Pasireotide Approved Pharma inhibitor, agonist, Target 0
lanreotide Approved Pharma Full agonist, Agonist 82
Vapreotide Approved, Investigational Pharma Full agonist, Agonist 2
Somatostatin Approved Pharma Influences growth hormone release 229

(3) Additional Compounds for SSTR3 Gene - From: IUPHAR

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
CST-14
Full agonist, Agonist
MK-678
Full agonist, Agonist
SOM-230
Full agonist, Agonist

(5) Tocris Compounds for SSTR3 Gene

Compound Action Cas Number
Cyclosomatostatin Non-selective sst receptor antagonist 84211-54-1
CYN 154806 Selective sst2 antagonist 183658-72-2
L-803,087 trifluoroacetate Potent and selective sst4 agonist 217480-26-7
Octreotide sst2, sst3 and sst5 agonist 83150-76-9
Somatostatin Influences growth hormone release 51110-01-1

(12) ApexBio Compounds for SSTR3 Gene

Compound Action Cas Number
(1R,1'S,3'R/1R,1'R,3'S)-L-054,264 208706-12-1
BIM 23056 Somatostatin receptor ligand 150155-61-6
CH 275 174688-78-9
Cortistatin 14 193829-96-8
Cyclosomatostatin somatostatin receptor antagonist 84211-54-1
CYN 154806 183658-72-2
L-803,087 trifluoroacetate 217480-26-7
L-817,818 217480-27-8
Octreotide acetate octapeptide congener of native somatostatin 83150-76-9
Pasireotide 396091-73-9
Seglitide 81377-02-8
Somatostatin 1-28 74315-46-1
genes like me logo Genes that share compounds with SSTR3: view

Transcripts for SSTR3 Gene

mRNA/cDNA for SSTR3 Gene

Unigene Clusters for SSTR3 Gene

Somatostatin receptor 3:
Representative Sequences:

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for SSTR3
  • R&D Systems cDNA Clones for SSTR3 (Somatostatin R3/SSTR3)

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for SSTR3 Gene

No ASD Table

Relevant External Links for SSTR3 Gene

GeneLoc Exon Structure for
SSTR3
ECgene alternative splicing isoforms for
SSTR3

Expression for SSTR3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for SSTR3 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for SSTR3 Gene

This gene is overexpressed in Brain - Cortex (x6.2), Testis (x6.1), and Brain - Frontal Cortex (BA9) (x5.7).

Protein differential expression in normal tissues from HIPED for SSTR3 Gene

This gene is overexpressed in Platelet (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for SSTR3 Gene



Protein tissue co-expression partners for SSTR3 Gene

NURSA nuclear receptor signaling pathways regulating expression of SSTR3 Gene:

SSTR3

SOURCE GeneReport for Unigene cluster for SSTR3 Gene:

Hs.225995

mRNA Expression by UniProt/SwissProt for SSTR3 Gene:

P32745-SSR3_HUMAN
Tissue specificity: Brain, pituitary and pancreas.
genes like me logo Genes that share expression patterns with SSTR3: view

Primer Products

Orthologs for SSTR3 Gene

This gene was present in the common ancestor of animals.

Orthologs for SSTR3 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SSTR3 34
  • 99.2 (n)
dog
(Canis familiaris)
Mammalia SSTR3 34
  • 89.93 (n)
cow
(Bos Taurus)
Mammalia SSTR3 34
  • 87.2 (n)
mouse
(Mus musculus)
Mammalia Sstr3 34 16
  • 83.46 (n)
rat
(Rattus norvegicus)
Mammalia Sstr3 34
  • 82.72 (n)
chicken
(Gallus gallus)
Aves SSTR3 34
  • 72.15 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia sstr3 34
  • 58.73 (n)
zebrafish
(Danio rerio)
Actinopterygii LOC100334518 34
  • 62.16 (n)
fruit fly
(Drosophila melanogaster)
Insecta Drostar1 36
  • 40 (a)
AlCR2 36
  • 38 (a)
Species where no ortholog for SSTR3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for SSTR3 Gene

ENSEMBL:
Gene Tree for SSTR3 (if available)
TreeFam:
Gene Tree for SSTR3 (if available)

Paralogs for SSTR3 Gene

genes like me logo Genes that share paralogs with SSTR3: view

Variants for SSTR3 Gene

Sequence variations from dbSNP and Humsavar for SSTR3 Gene

SNP ID Clin Chr 22 pos Sequence Context AA Info Type
rs10626254 -- 37,220,902(+) CTCCC(-/A/ACCTGGATTATGGGATTCAATTACCTCCCACTGGGTTCCTCCC)TTGGG upstream-variant-2KB
rs111304805 -- 37,210,154(+) TCACA(A/G)GCCAG intron-variant
rs111558923 -- 37,221,076(+) GTTTC(A/G)TGCCA upstream-variant-2KB
rs111572321 -- 37,212,771(+) GGGCT(A/G)GCCAG intron-variant, upstream-variant-2KB
rs111790277 -- 37,209,537(+) GACAG(G/T)GGGCT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for SSTR3 Gene

Variant ID Type Subtype PubMed ID
nsv834188 CNV loss 17160897
nsv829203 CNV loss 20364138

Variation tolerance for SSTR3 Gene

Residual Variation Intolerance Score: 64.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.38; 63.49% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for SSTR3 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
SSTR3

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SSTR3 Gene

Disorders for SSTR3 Gene

MalaCards: The human disease database

(1) MalaCards diseases for SSTR3 Gene - From: GeneCards

Disorder Aliases PubMed IDs
oncogenic osteomalacia
  • oo
- elite association - COSMIC cancer census association via MalaCards
Search SSTR3 in MalaCards View complete list of genes associated with diseases

Relevant External Links for SSTR3

Genetic Association Database (GAD)
SSTR3
Human Genome Epidemiology (HuGE) Navigator
SSTR3
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
SSTR3
genes like me logo Genes that share disorders with SSTR3: view

No data available for UniProtKB/Swiss-Prot and Genatlas for SSTR3 Gene

Publications for SSTR3 Gene

  1. Human somatostatin receptor genes: localization to human chromosomes 14, 17, and 22 and identification of simple tandem repeat polymorphisms. (PMID: 8449518) Yamada Y. … Bell G.I. (Genomics 1993) 2 3 22 64
  2. A human somatostatin receptor (SSTR3), located on chromosome 22, displays preferential affinity for somatostatin-14 like peptides. (PMID: 8097479) Corness J.D. … Niznik H.B. (FEBS Lett. 1993) 3 4 22 64
  3. Somatostatin receptors, an expanding gene family: cloning and functional characterization of human SSTR3, a protein coupled to adenylyl cyclase. (PMID: 1337145) Yamada Y. … Seino S. (Mol. Endocrinol. 1992) 3 4 22 64
  4. Genetic susceptibility to distinct bladder cancer subphenotypes. (PMID: 19692168) Guey L.T. … Malats N. (Eur. Urol. 2010) 3 46 64
  5. L-type voltage-dependent calcium channel alpha subunit 1C is a novel candidate gene associated with secondary hyperparathyroidism: an application of haplotype-based analysis for multiple linked single nucleotide polymorphisms. (PMID: 20424473) Yokoyama K. … Hosoya T. (Nephron Clin Pract 2010) 3 46 64

Products for SSTR3 Gene

Sources for SSTR3 Gene

Content
Loading form....