Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



SPPL2B Gene

protein-coding   GIFtS: 50
GCID: GC19P002328

Signal Peptide Peptidase Like 2B

  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Signal Peptide Peptidase Like 2B1 2     PSL12 3
Intramembrane Protease 41 2 3     SPP-Like 2B2 3
IMP42 3 5     KIAA15323 5
Presenilin Homologous Protein 42 3     Signal Peptide Peptidase-Like 2B2
Presenilin-Like Protein 12 3     EC 3.4.23.-3
IMP-42 3     SPPL2b3
PSH42 3     SNPPL2B5

External Ids:    HGNC: 306271   Entrez Gene: 569282   Ensembl: ENSG000000052067   OMIM: 6082395   UniProtKB: Q8TCT73   

Export aliases for SPPL2B gene to outside databases

Previous GC identifers: GC19P002391 GC19P002268 GC19P002279 GC19P002099


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for SPPL2B Gene:
This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins
with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to
endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha
to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity
pathways. Multiple transcript variants encoding different isoforms have been found for this gene. (provided by
RefSeq, Jul 2008)

GeneCards Summary for SPPL2B Gene:
SPPL2B (signal peptide peptidase like 2B) is a protein-coding gene. Diseases associated with SPPL2B include malaria, and dementia. GO annotations related to this gene include protein homodimerization activity and aspartic endopeptidase activity, intramembrane cleaving.

UniProtKB/Swiss-Prot: SPP2B_HUMAN, Q8TCT7
Function: Intramembrane-cleaving aspartic protease (I-CLiP) that cleaves type II membrane signal peptides in the
hydrophobic plane of the membrane. Functions in ITM2B and TNF processing. Catalyzes the intramembrane cleavage of
the anchored fragment of shed TNF-alpha (TNF), which promotes the release of the intracellular domain (ICD) for
signaling to the nucleus. May play a role in the regulation of innate and adaptive immunity

Gene Wiki entry for SPPL2B Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
Regulatory elements:
   Regulatory transcription factor binding sites in the SPPL2B gene promoter:
         GR   Sp1   GR-alpha   STAT5A   E47   Evi-1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidSPPL2B promoter sequence
   Search Chromatin IP Primers for SPPL2B

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat SPPL2B


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19p13.3   Ensembl cytogenetic band:  19p13.3   HGNC cytogenetic band: 19p13.3

SPPL2B Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
SPPL2B gene location

GeneLoc information about chromosome 19         GeneLoc Exon Structure

GeneLoc location for GC19P002328:  view genomic region     (about GC identifiers)

Start:
2,328,614 bp from pter      End:
2,355,100 bp from pter
Size:
26,487 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: SPP2B_HUMAN, Q8TCT7 (See protein sequence)
Recommended Name: Signal peptide peptidase-like 2B precursor  
Size: 592 amino acids; 64644 Da
Subunit: Monomer. Homodimer. Interacts with ITM2B and TNF
Sequence caution: Sequence=AAC05601.1; Type=Erroneous gene model prediction; Sequence=AAG45441.1; Type=Erroneous
initiation; Note=Translation N-terminally shortened; Sequence=BAA96056.1; Type=Erroneous initiation;
Note=Translation N-terminally shortened;
Secondary accessions: D6W609 O60365 Q567S3 Q8IUH9 Q9BUY6 Q9H3M4 Q9NPN2 Q9P1Z6
Alternative splicing: 4 isoforms:  Q8TCT7-1   Q8TCT7-2   Q8TCT7-3   Q8TCT7-4   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for SPPL2B: NX_Q8TCT7

Explore proteomics data for SPPL2B at MOPED

Post-translational modifications: 

  • Glycosylated1
  • Glycosylation2 at Asn97, Asn129
  • Modification sites at PhosphoSitePlus

  • See SPPL2B Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (2 alternative transcripts): 
    NP_001070706.1  NP_694533.1  

    SPPL2B Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec
    OriGene Custom Protein Services for SPPL2B
    GenScript Custom Purified and Recombinant Proteins Services for SPPL2B
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for SPPL2B

    SPPL2B Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for SPPL2B
    Novus Biologicals SPPL2B Antibody
    Abcam antibodies for SPPL2B
    Cloud-Clone Corp. Antibodies for SPPL2B
    Search ThermoFisher Antibodies for SPPL2B
    LSBio Antibodies in human, mouse, rat for SPPL2B

    SPPL2B Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for SPPL2B
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for SPPL2B
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for SPPL2B
    Cloud-Clone Corp. CLIAs for SPPL2B


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    3 InterPro protein domains:
     IPR006639 Preselin/SPP
     IPR003137 Protease-assoc_domain
     IPR007369 Peptidase_A22B_SPP

    Graphical View of Domain Structure for InterPro Entry Q8TCT7

    ProtoNet protein and cluster: Q8TCT7

    UniProtKB/Swiss-Prot: SPP2B_HUMAN, Q8TCT7
    Domain: The PAL motif is required for normal active site conformation (By similarity). The catalytic domains
    embedded in the membrane are in the opposite orientation to that of the presenilin protein family; therefore, it
    is predicted to cleave type II-oriented substrate peptides like the prototypic protease SPP
    Similarity: Belongs to the peptidase A22B family
    Similarity: Contains 1 PA (protease associated) domain


    SPPL2B for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: SPP2B_HUMAN, Q8TCT7
    Function: Intramembrane-cleaving aspartic protease (I-CLiP) that cleaves type II membrane signal peptides in the
    hydrophobic plane of the membrane. Functions in ITM2B and TNF processing. Catalyzes the intramembrane cleavage of
    the anchored fragment of shed TNF-alpha (TNF), which promotes the release of the intracellular domain (ICD) for
    signaling to the nucleus. May play a role in the regulation of innate and adaptive immunity

         Enzyme Number (IUBMB): EC 3.4.23.-1

         Gene Ontology (GO): 3 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005515protein binding IPI17965014
    GO:0042500NOT aspartic endopeptidase activity, intramembrane cleaving IMP16873890
    GO:0042803protein homodimerization activity IDA15385547
         
    SPPL2B for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for SPPL2B:
     Decreased viability with pacli  Synthetic lethal with Ras 

    Animal Models:
       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for SPPL2B
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for SPPL2B

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for SPPL2B
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for SPPL2B

    miRNA
    Products:
        
    miRTarBase miRNAs that target SPPL2B:
    hsa-mir-320a (MIRT044455), hsa-mir-98-5p (MIRT027762)

    Block miRNA regulation of human, mouse, rat SPPL2B using miScript Target Protectors
    7 qRT-PCR Assays for microRNAs that regulate SPPL2B:
    hsa-miR-135b hsa-miR-2909 hsa-miR-29a hsa-miR-29c hsa-miR-767-5p hsa-miR-135a hsa-miR-29b
    SwitchGear 3'UTR luciferase reporter plasmidSPPL2B 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for SPPL2B
    Predesigned siRNA for gene silencing in human, mouse, rat SPPL2B

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for SPPL2B

    Clone
    Products:
         
    OriGene clones in human, mouse for SPPL2B (see all 13)
    OriGene ORF clones in mouse, rat for SPPL2B
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): SPPL2B (NM_152988)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for SPPL2B
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat SPPL2B

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for SPPL2B
    Browse ESI BIO Cell Lines and PureStem Progenitors for SPPL2B 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for SPPL2B


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    SPP2B_HUMAN, Q8TCT7: Golgi apparatus membrane; Multi-pass membrane protein. Note=targeted through the entire
    secretory pathway to endosomes/lysosomes
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    endoplasmic reticulum5
    endosome5
    golgi apparatus5
    lysosome5
    plasma membrane5
    vacuole5

    Gene Ontology (GO): Selected cellular component terms (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005765lysosomal membrane IDA15998642
    GO:0005886plasma membrane IDA16829952
    GO:0010008endosome membrane IDA15998642
    GO:0030660Golgi-associated vesicle membrane IDA17965014
    GO:0071458integral component of cytoplasmic side of endoplasmic reticulum membrane IDA15385547

    SPPL2B for ontologies           About GeneDecksing


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus



        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for SPPL2B
    Interactions:

        Search GeneGlobe Interaction Network for SPPL2B

    1 Interacting protein for SPPL2B (Q8TCT73) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    PACSIN1Q9BY113I2D: score=2 
    About this table

    Gene Ontology (GO): 3 biological process terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006509membrane protein ectodomain proteolysis IDA16829951
    GO:0031293membrane protein intracellular domain proteolysis IMP16829952
    GO:0050776regulation of immune response IMP16829952

    SPPL2B for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for SPPL2B (SPP2B)



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for SPPL2B gene (2 alternative transcripts): 
    NM_001077238.1  NM_152988.2  

    16 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000585725(processed_transcript) ENST00000592845(processed_transcript) ENST00000586332(processed_transcript) ENST00000590982(processed_transcript) ENST00000586377(processed_transcript)
    ENST00000593198(processed_transcript) ENST00000590295(processed_transcript) ENST00000592738(processed_transcript) ENST00000587851(processed_transcript) ENST00000593243(processed_transcript)
    ENST00000591959(processed_transcript) ENST00000590902(processed_transcript) ENST00000589515(processed_transcript) ENST00000610255(processed_transcript) ENST00000452401(processed_transcript)
    ENST00000382189(processed_transcript)
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat SPPL2B using miScript Target Protectors
    7 qRT-PCR Assays for microRNAs that regulate SPPL2B:
    hsa-miR-135b hsa-miR-2909 hsa-miR-29a hsa-miR-29c hsa-miR-767-5p hsa-miR-135a hsa-miR-29b
    SwitchGear 3'UTR luciferase reporter plasmidSPPL2B 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for SPPL2B
    Predesigned siRNA for gene silencing in human, mouse, rat SPPL2B
    Clone
    Products:
         
    OriGene clones in human, mouse for SPPL2B (see all 13)
    OriGene ORF clones in mouse, rat for SPPL2B
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): SPPL2B (NM_152988)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for SPPL2B
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat SPPL2B
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for SPPL2B
    OriGene qSTAR qPCR primer pairs in human, mouse for SPPL2B
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat SPPL2B
      QuantiTect SYBR Green Assays in human, mouse, rat SPPL2B
      QuantiFast Probe-based Assays in human, mouse, rat SPPL2B

    Selected AceView cDNA sequences (see all 252):

    AI880318 CR624124 CR613332 BU782805 BE253442 BQ681216 BE254254 BU782927 
    AB040965 BE048448 BU838197 AA453953 AL040279 F10738 BU178086 BQ677981 
    BE552158 AI680443 BF001571 BI029051 AJ420897 BM791099 CA419230 BQ267943 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for SPPL2B (see all 10)    About this scheme

    ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4a · 4b ^ 5 ^ 6a · 6b ^ 7a · 7b ^ 8 ^ 9a · 9b ^ 10 ^ 11a · 11b · 11c ^ 12a · 12b ^ 13 ^ 14 ^ 15 ^ 16 ^ 17a ·
    SP1:                    -     -                 -           -                                                     -     -                                       
    SP2:                    -     -                 -           -                                                     -     -                                       
    SP3:                    -     -                 -           -                                                                                                   
    SP4:                    -     -                 -           -     -                                                                                             
    SP5:                                                                                                                                                            

    ExUns: 17b · 17c ^ 18a · 18b
    SP1:        -               
    SP2:                        
    SP3:                        
    SP4:                        
    SP5:                        


    ECgene alternative splicing isoforms for SPPL2B

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    SPPL2B expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: CCTGCACACT
    SPPL2B Expression
    About this image


    SPPL2B expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 2) fully expand
     
     Thymus (Hematopoietic System)
             Double Negative 2 Thymocytes Thymus
     
     Blood (Cardiovascular System)
             Double Negative 2 Thymocytes Thymus
    SPPL2B Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    SPPL2B Protein Expression

    UniProtKB/Swiss-Prot: SPP2B_HUMAN, Q8TCT7
    Tissue specificity: Expressed predominantly in adrenal cortex and mammary gland

        Custom PCR Arrays for SPPL2B
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for SPPL2B
    OriGene qSTAR qPCR primer pairs in human, mouse for SPPL2B
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat SPPL2B
    QuantiTect SYBR Green Assays in human, mouse, rat SPPL2B
    QuantiFast Probe-based Assays in human, mouse, rat SPPL2B
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for SPPL2B

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for SPPL2B gene from Selected species (see all 13)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Sppl2b1 , 5 RIKEN cDNA 3110056O03 gene5
    signal peptide peptidase like 2B1
    80.22(n)1
    79.68(a)1
      10 (39.72 cM)5
    732181  NM_175195.31  NP_780404.21 
     808552755 
    chicken
    (Gallus gallus)
    Aves SPPL2B1 signal peptide peptidase like 2B 71.31(n)
    79.74(a)
      420056  NM_001030933.1  NP_001026104.1 
    African clawed frog
    (Xenopus laevis)
    Amphibia MGC691132 hypothetical protein MGC69113 75.31(n)    BC056100.1 
    zebrafish
    (Danio rerio)
    Actinopterygii BC044512.12   -- 76.26(n)    BC044512.1 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons SPPL31 SPPL3 45.87(n)
    37.61(a)
      818909  NM_180052.3  NP_850383.2 
    rice
    (Oryza sativa)
    Liliopsida Os01g09147001 Os01g0914700 49.46(n)
    37.59(a)
      4324348  NM_001051717.1  NP_001045182.1 


    ENSEMBL Gene Tree for SPPL2B (if available)
    TreeFam Gene Tree for SPPL2B (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for SPPL2B gene
    2 SIMAP similar genes for SPPL2B using alignment to 1 protein entry:     SPP2B_HUMAN:
    SPPL2A    SPPL2C

    SPPL2B for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for SPPL2B (see all 1045)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 19 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs800674831,2
    F--2330839(+) TTATCC/TGGAGG 2 -- int11Minor allele frequency- T:0.03WA 118
    rs739169251,2
    C,F--2330840(+) TATCCG/TGAGGG 2 -- int12Minor allele frequency- T:0.27WA 120
    rs1854509841,2
    --2330851(+) TGGGGA/CGTCAA 2 -- int10--------
    rs37950401,2
    C,F,H--2330933(+) TGAGAC/AGCCTG 2 -- int18Minor allele frequency- A:0.01EA NS 2356
    rs735205481,2
    C,F--2330962(+) GCTTCG/ACGGCA 2 -- int17Minor allele frequency- A:0.33WA NA CSA 248
    rs735205511,2
    C--2331057(+) TTGCTA/GCCATT 2 -- int13Minor allele frequency- G:0.34WA 122
    rs1895239051,2
    --2331104(+) AGACAC/GCTCCC 2 -- int10--------
    rs1808081421,2
    --2331130(+) GAGCCC/GGCTCC 2 -- int10--------
    rs118823301,2
    C,F,A,H--2331181(+) CGGCCC/TGGCTC 2 -- int115Minor allele frequency- T:0.09NS EA NA 1962
    rs1412722641,2
    C--2331184(+) CCCGG-/CTCCTGGAACTCCTCAGTC
    TTCCCAGAAGGGAGGCTCTCCC
    CGCCT
    2 -- int10--------

    HapMap Linkage Disequilibrium report for SPPL2B (2328614 - 2355100 bp)

    Structural Variations
         Database of Genomic Variants (DGV) Selected variations for SPPL2B (see all 27):    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2674747CNV Deletion23128226
    esv2385804CNV Deletion18987734
    esv987545CNV Deletion20482838
    esv1566250CNV Deletion17803354
    esv2717886CNV Deletion23290073
    esv2717887CNV Deletion23290073
    esv2717885CNV Deletion23290073
    esv2717888CNV Deletion23290073
    esv2534504CNV Deletion19546169
    esv1110117CNV Deletion17803354

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing SPPL2B
    DNA2.0 Custom Variant and Variant Library Synthesis for SPPL2B

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 608239    OMIM disorders: --

    3 diseases for SPPL2B:    
    About MalaCards
    malaria    dementia    alzheimer's disease


    SPPL2B for disorders           About GeneDecksing


    Export disorders for SPPL2B gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for SPPL2B gene, integrated from 10 sources (see all 19):
    (articles sorted by number of sources associating them with SPPL2B)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Prediction of the coding sequences of unidentified human genes. XVII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. (PubMed id 10819331)1, 2, 3 Nagase T.... Ohara O. (DNA Res. 2000)
    2. Intramembrane proteolytic cleavage by human signal peptide peptidase like 3 and malaria signal peptide peptidase. (PubMed id 16873890)1, 2, 9 Nyborg A.C.... Golde T.E. (FASEB J. 2006)
    3. Regulated intramembrane proteolysis of Bri2 (Itm2b) by ADAM10 and SPPL2a/SPPL2b. (PubMed id 17965014)1, 2, 9 Martin L.... Haass C. (J. Biol. Chem. 2008)
    4. The alpha-helical content of the transmembrane domain of the British dementia protein-2 (Bri2) determines its processing by signal peptide peptidase-like 2b (SPPL2b). (PubMed id 22194595)1, 2 Fluhrer R.... Haass C. (J. Biol. Chem. 2012)
    5. Substrate requirements for SPPL2b-dependent regulated intramembrane proteolysis. (PubMed id 19114711)1, 2 Martin L.... Haass C. (J. Biol. Chem. 2009)
    6. A gamma-secretase-like intramembrane cleavage of TNFalpha by the GxGD aspartyl protease SPPL2b. (PubMed id 16829951)1, 2 Fluhrer R....Haass C. (Nat. Cell Biol. 2006)
    7. SPPL2a and SPPL2b promote intramembrane proteolysis of TNFalpha in activated dendritic cells to trigger IL-12 production. (PubMed id 16829952)1, 2 Friedmann E.... Martoglio B. (Nat. Cell Biol. 2006)
    8. Differential localization and identification of a critical aspartate suggest non-redundant proteolytic functions of the presenilin homologues SPPL2b and SPPL3. (PubMed id 15998642)1, 2 Krawitz P.... Haass C. (J. Biol. Chem. 2005)
    9. Consensus analysis of signal peptide peptidase and homologous human aspartic proteases reveals opposite topology of catalytic domains compared with presenilins. (PubMed id 15385547)1, 2 Friedmann E.... Martoglio B. (J. Biol. Chem. 2004)
    10. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 56928 HGNC: 30627 AceView: SPPL2B Ensembl:ENSG00000005206 euGenes: HUgn56928
    ECgene: SPPL2B H-InvDB: SPPL2B

    (According to HUGE)
    About This Section

    TryGeneCards Plus
    HUGE: KIAA1532

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for SPPL2B Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for SPPL2B gene:
    Search GeneIP for patents involving SPPL2B

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for SPPL2B  
     OriGene qPCR primer pairs and template standards for SPPL2B   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for SPPL2B  
     OriGene qSTAR qPCR primer pairs in human, mouse for SPPL2B   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for SPPL2B   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for SPPL2B   OriGene Custom Protein Services for SPPL2B  

     
     
     Block miRNA regulation of human, mouse, rat SPPL2B using miScript Target Protectors SeqTarget long-range PCR primers for resequencing SPPL2B
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat SPPL2B Predesigned siRNA for gene silencing in human, mouse, rat SPPL2B
     QuantiFast Probe-based Assays in human, mouse, rat SPPL2B QuantiTect SYBR Green Assays in human, mouse, rat SPPL2B
     Custom PCR Arrays for SPPL2B Search Chromatin IP Primers for SPPL2B
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat SPPL2B  Search GeneGlobe Interaction Network for SPPL2B
     Regulatory tfbs in SPPL2B promoter
     GenScript Custom Purified and Recombinant Proteins Services for SPPL2B GenScript cDNA clones with any tag delivered in your preferred vector for SPPL2B
     GenScript Custom Assay Services for SPPL2B GenScript Custom overexpressing Cell Line Services for SPPL2B
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for SPPL2B (SPP2B)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     SPPL2B antibodies
     Antibodies for SPPL2B
     See all of Abcam's Antibodies, Kits and Proteins for SPPL2B
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for SPPL2B
     Antibodies for SPPL2B
     ELISAs for SPPL2B
     CLIAs for SPPL2B



     Browse ESI BIO Cell Lines and PureStem Progenitors for SPPL2B
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for SPPL2B
     SwitchGear 3'UTR luciferase reporter plasmids for SPPL2B
     SwitchGear Promoter luciferase reporter plasmids for SPPL2B
     Search ThermoFisher Antibodies for SPPL2B
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat SPPL2B
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for SPPL2B
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for SPPL2B
     LSBio Antibodies in human, mouse, rat for SPPL2B
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      SPPL2B gene at Home site.
    Version: 3.12.166 28 Aug 2014
    hostname: 356980-web2.xennexinc.com index build: 126 solr: 1.4