Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SPHAR Gene

Aliases for SPHAR Gene

  • S-Phase Response (Cyclin Related) 2 3 5
  • S-Phase Response Protein 4

External Ids for SPHAR Gene

Previous GeneCards Identifiers for SPHAR Gene

  • GC01P227887
  • GC01M225134
  • GC01P225840
  • GC01P226401
  • GC01P225748
  • GC01P227506
  • GC01P229440
  • GC01P199930

Summaries for SPHAR Gene

GeneCards Summary for SPHAR Gene

SPHAR (S-Phase Response (Cyclin Related)) is a Protein Coding gene.

Additional gene information for SPHAR Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SPHAR Gene

Genomics for SPHAR Gene

Regulatory Elements for SPHAR Gene

Enhancers for SPHAR Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH01H229280 0.8 ENCODE 11.9 -23.9 -23874 0.2 HDAC1 PKNOX1 ATF1 TCF12 ELK1 GATA2 ZNF366 ATF7 CEBPB ZEB2 SPHAR ENSG00000237481 TMEM78 CCSAP ACTA1 RNU6-180P RAB4A GC01P229305 GC01P229306
GH01H229278 0.8 dbSUPER 11.9 -25.3 -25298 2 PKNOX1 ATF1 ARID4B CEBPG THRB RARA ZNF121 ZNF316 POLR2A ZNF366 CCSAP SPHAR ENSG00000237481 RNU6-180P TMEM78 ACTA1 ABCB10 RNU4-21P RAB4A GC01P229305
GH01H229228 1.9 FANTOM5 Ensembl ENCODE dbSUPER 1.3 -73.7 -73655 3.8 PKNOX1 FOXA2 FEZF1 ZNF2 YY1 FOS SP3 ZC3H11A JUNB REST NUP133 ENSG00000269890 HMGN2P19 HIST3H3 LOC105373158 ABCB10 URB2 CCSAP RHOU SPHAR
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around SPHAR on UCSC Golden Path with GeneCards custom track

Genomic Locations for SPHAR Gene

Genomic Locations for SPHAR Gene
1,123 bases
Plus strand

Genomic View for SPHAR Gene

Genes around SPHAR on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SPHAR Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SPHAR Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SPHAR Gene

Proteins for SPHAR Gene

  • Protein details for SPHAR Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein SPHAR
    Protein Accession:
    Secondary Accessions:
    • Q4EW09
    • Q6NSB9

    Protein attributes for SPHAR Gene

    63 amino acids
    Molecular mass:
    7515 Da
    Quaternary structure:
    No Data Available

neXtProt entry for SPHAR Gene

Post-translational modifications for SPHAR Gene

No Post-translational modifications

Other Protein References for SPHAR Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for SPHAR Gene

Domains & Families for SPHAR Gene

Gene Families for SPHAR Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for SPHAR Gene


Suggested Antigen Peptide Sequences for SPHAR Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with SPHAR: view

No data available for UniProtKB/Swiss-Prot for SPHAR Gene

Function for SPHAR Gene

genes like me logo Genes that share phenotypes with SPHAR: view

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SPHAR Gene

Localization for SPHAR Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SPHAR gene
Compartment Confidence
extracellular 3
mitochondrion 1
cytosol 1

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for SPHAR Gene

Pathways & Interactions for SPHAR Gene

SuperPathways for SPHAR Gene

No Data Available

Interacting Proteins for SPHAR Gene

Gene Ontology (GO) - Biological Process for SPHAR Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006260 DNA replication TAS 7799938
genes like me logo Genes that share ontologies with SPHAR: view

No data available for Pathways by source and SIGNOR curated interactions for SPHAR Gene

Drugs & Compounds for SPHAR Gene

No Compound Related Data Available

Transcripts for SPHAR Gene

mRNA/cDNA for SPHAR Gene

(1) REFSEQ mRNAs :
(226) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SPHAR Gene

No ASD Table

Relevant External Links for SPHAR Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SPHAR Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SPHAR Gene

NURSA nuclear receptor signaling pathways regulating expression of SPHAR Gene:

genes like me logo Genes that share expression patterns with SPHAR: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for SPHAR Gene

Orthologs for SPHAR Gene

This gene was present in the common ancestor of human and chimp.

Orthologs for SPHAR Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SPHAR 33
  • 98.94 (n)
Species where no ortholog for SPHAR was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • mouse (Mus musculus)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for SPHAR Gene

Gene Tree for SPHAR (if available)
Gene Tree for SPHAR (if available)

Paralogs for SPHAR Gene Pseudogenes for SPHAR Gene

genes like me logo Genes that share paralogs with SPHAR: view

No data available for Paralogs for SPHAR Gene

Variants for SPHAR Gene

Sequence variations from dbSNP and Humsavar for SPHAR Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type
rs1001694618 -- 229,305,523(+) TAATC(A/G)GGCTT intron-variant, nc-transcript-variant, utr-variant-3-prime
rs1002124131 -- 229,305,117(+) GAGAC(A/G)CATAA nc-transcript-variant, utr-variant-3-prime, utr-variant-5-prime
rs1004778599 -- 229,304,886(+) ATTGT(A/G)TTACA nc-transcript-variant, utr-variant-3-prime, utr-variant-5-prime
rs1005129342 -- 229,305,539(+) TTAGG(A/G)AGAAT intron-variant, nc-transcript-variant, utr-variant-3-prime
rs1005283872 -- 229,304,237(+) TGGTT(-/ATATTTATGACCTGATATTCAAAGACTCTGGC)ATTGA nc-transcript-variant, upstream-variant-2KB, utr-variant-3-prime

Structural Variations from Database of Genomic Variants (DGV) for SPHAR Gene

Variant ID Type Subtype PubMed ID
nsv549299 CNV gain 21841781
esv3589072 CNV gain 21293372

Variation tolerance for SPHAR Gene

Residual Variation Intolerance Score: 65.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.01; 0.33% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for SPHAR Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SPHAR Gene

Disorders for SPHAR Gene

Relevant External Links for SPHAR

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for SPHAR Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SPHAR Gene

Publications for SPHAR Gene

  1. Irreversible repression of DNA synthesis in Fanconi anemia cells is alleviated by the product of a novel cyclin-related gene. (PMID: 7799938) Digweed M … Sperling K (Molecular and cellular biology 1995) 2 3 4 60
  2. The DNA sequence and biological annotation of human chromosome 1. (PMID: 16710414) Gregory SG … Prigmore E (Nature 2006) 3 4 60
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 4 60
  4. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 3 60

Products for SPHAR Gene

Sources for SPHAR Gene

Loading form....