Aliases for SPDL1 Gene
Aliases for SPDL1 Gene
External Ids for SPDL1 Gene
- HGNC: 26010
- Entrez Gene: 54908
- Ensembl: ENSG00000040275
- OMIM: 616401
- UniProtKB: Q96EA4
Previous HGNC Symbols for SPDL1 Gene
- CCDC99
Previous GeneCards Identifiers for SPDL1 Gene
- GC05P169011
Summaries for SPDL1 Gene
-
This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]
GeneCards Summary for SPDL1 Gene
SPDL1 (Spindle Apparatus Coiled-Coil Protein 1) is a Protein Coding gene. Among its related pathways are Mitotic Metaphase and Anaphase and Cell Cycle, Mitotic. GO annotations related to this gene include enzyme binding and kinetochore binding.
UniProtKB/Swiss-Prot for SPDL1 Gene
-
Required for the localization of dynein and dynactin to the mitotic kintochore. Dynein is believed to control the initial lateral interaction between the kinetochore and spindle microtubules and to facilitate the subsequent formation of end-on kinetochore-microtubule attachments mediated by the NDC80 complex. Also required for correct spindle orientation. Does not appear to be required for the removal of spindle assembly checkpoint (SAC) proteins from the kinetochore upon bipolar spindle attachment.
No data available for Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SPDL1 Gene
Genomics for SPDL1 Gene
Regulatory Elements for SPDL1 Gene
Enhancers for SPDL1 Gene
| GeneHancer Identifier | Enhancer Score | Enhancer Sources | Gene-Enhancer Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites within enhancer | Gene Targets for Enhancer |
|---|---|---|---|---|---|---|---|---|
| GH05F169582 | 1 | ENCODE | 46.2 | +0.6 | 559 | 2.5 | PKNOX1 CREB3L1 WRNIP1 ARID4B SIN3A GLI4 ZNF48 BRCA1 YY1 ZNF263 | SPDL1 GC05M169584 |
| GH05F169628 | 1 | FANTOM5 ENCODE | 29.1 | +45.7 | 45714 | 2.3 | STAT1 ZNF133 JUN CEBPB SIN3A EP300 ZNF644 JUND POLR2A FOS | SPDL1 SLIT3 DOCK2 GC05M169584 |
| GH05F169636 | 0.9 | ENCODE | 21.7 | +54.0 | 54027 | 2.1 | HDGF PKNOX1 WRNIP1 SIN3A ZBTB40 EGR1 ELK1 ZNF143 ETV6 CREM | SPDL1 DOCK2 GC05M169639 |
| GH05F169626 | 0.6 | ENCODE | 32.2 | +43.4 | 43396 | 1.3 | JUND JUN BHLHE40 FOS MAFK NFE2L2 | SPDL1 DOCK2 GC05M169584 |
| GH05F169591 | 0.4 | ENCODE | 43 | +8.2 | 8184 | 0.7 | NR2F2 | SPDL1 GC05M169584 DOCK2 |
- Elite enhancer and/or Elite enhancer-gene association
Download GeneHancer data dump
Enhancers around SPDL1 on UCSC Golden Path with GeneCards custom track
Regulatory Element Products
Genomic Location for SPDL1 Gene
- Chromosome:
- 5
- Start:
- 169,583,634 bp from pter
- End:
- 169,604,778 bp from pter
- Size:
- 21,145 bases
- Orientation:
- Plus strand
Genomic View for SPDL1 Gene
Genes around SPDL1 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 5q35.1 by Ensembl
- 5q35.1 by Entrez Gene
- 5q35.1 by HGNC
SPDL1 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for SPDL1 Gene
Proteins for SPDL1 Gene
-
Protein details for SPDL1 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q96EA4-SPDLY_HUMAN
- Recommended name:
- Protein Spindly
- Protein Accession:
- Q96EA4
- B4E393
- C9JS47
- Q8TEC8
- Q9HD44
- Q9NX97
Protein attributes for SPDL1 Gene
- Size:
- 605 amino acids
- Molecular mass:
- 70172 Da
- Quaternary structure:
-
- Interacts with KNTC1 and ZW10. These interactions appear weak and may be transient or indirect.
- SequenceCaution:
-
- Sequence=AAG01408.1; Type=Frameshift; Positions=604; Evidence={ECO:0000305}; Sequence=BAA91119.1; Type=Frameshift; Positions=412; Evidence={ECO:0000305}; Sequence=BAB85022.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};
Protein Expression for SPDL1 Gene
Post-translational modifications for SPDL1 Gene
Other Protein References for SPDL1 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- EMD Millipore Complete listing of Mono and Polychlonal Antibodies for SPDL1
- Novus Biologicals Antibodies for SPDL1
- Invitrogen Antibodies for SPDL1
- antibodies-online Antibodies for SPDL1: See all 54
- GeneTex SPDL1 antibody for SPDL1
-
St John's Laboratory Antibodies for SPDL1
Protein Products
-
OriGene Purified Proteins for SPDL1
- Search Origene for MassSpec and Protein Over-expression Lysates for SPDL1
- Origene Custom Protein Services for SPDL1
- antibodies-online Proteins for SPDL1: See all 6
- Search antibodies-online for peptides
- Search GeneTex for Proteins for SPDL1
Assay Products
No data available for DME Specific Peptides for SPDL1 Gene
Domains & Families for SPDL1 Gene
Protein Domains for SPDL1 Gene
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for SPDL1 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q96EA4- Family:
-
- Belongs to the Spindly family.
No data available for Gene Families for SPDL1 Gene
Function for SPDL1 Gene
Molecular function for SPDL1 Gene
- UniProtKB/Swiss-Prot Function:
- Required for the localization of dynein and dynactin to the mitotic kintochore. Dynein is believed to control the initial lateral interaction between the kinetochore and spindle microtubules and to facilitate the subsequent formation of end-on kinetochore-microtubule attachments mediated by the NDC80 complex. Also required for correct spindle orientation. Does not appear to be required for the removal of spindle assembly checkpoint (SAC) proteins from the kinetochore upon bipolar spindle attachment.
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005515 | protein binding | IPI | 19468067 |
| GO:0019899 | enzyme binding | IPI | 23382074 |
| GO:0043515 | kinetochore binding | IEA,IDA | 19468067 |
Phenotypes for SPDL1 Gene
- GenomeRNAi human phenotypes for SPDL1:
-
- Increased vaccinia virus (VACV) infection
- Increased gamma-H2AX phosphorylation
- Negative genetic interaction between MUS81-/- and MUS81+/+
- Mildly decreased CFP-tsO45G cell surface transport
- Dynamic nuclei (hole, folded or small irregular)
- Decreased NF-kappaB reporter expression
- Decreased IL-8 secretion
- Decreased Hepatitis C virus replication
- Reduced shRNA abundance in FBW7 KO line
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for SPDL1
-
-
ViGene Biosciences lentiviral particle packaged cDNA for SPDL1 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for SPDL1 gene
- Search ViGene Biosciences for SPDL1
CRISPR Products
-
OriGene CRISPR knockouts for SPDL1
- GenScript: Design CRISPR guide RNA sequences for SPDL1
miRNA for SPDL1 Gene
- miRTarBase miRNAs that target SPDL1
miRNA Products
- Search ViGene Biosciences for SPDL1
Clone Products
- Sino Biological Human cDNA Clone for SPDL1
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for SPDL1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for SPDL1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Cell Line Products
-
ViGene Biosciences adenoviral particle packaged cDNA for SPDL1 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for SPDL1 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for SPDL1 gene
Flow Cytometry Products
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SPDL1 Gene
Localization for SPDL1 Gene
Subcellular locations from UniProtKB/Swiss-Prot for SPDL1 Gene
- Cytoplasm, cytoskeleton, microtubule organizing center, centrosome. Chromosome, centromere, kinetochore. Nucleus. Cytoplasm, cytoskeleton, spindle pole. Note=Localizes to the nucleus in interphase and to the kinetochore in early prometaphase. Relocalizes to the mitotic spindle pole before metaphase and is subsequently lost from the spindle poles after chromosome congression is completed. Removal of this protein from the kinetochore requires the dynein/dynactin complex.
| Compartment | Confidence |
|---|---|
| cytoskeleton | 5 |
| nucleus | 5 |
| cytosol | 5 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000775 | chromosome, centromeric region | IEA | -- |
| GO:0000776 | kinetochore | IEA | -- |
| GO:0000777 | condensed chromosome kinetochore | IEA | -- |
| GO:0000922 | spindle pole | IEA,IDA | 19468067 |
| GO:0000940 | condensed chromosome outer kinetochore | IEA,IDA | 19468067 |
Pathways & Interactions for SPDL1 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Cell Cycle, Mitotic |
.83
|
.60
|
| 2 | Mitotic Metaphase and Anaphase |
.94
|
|
| 3 | Mitotic Prometaphase | ||
| 4 | Signaling by Rho GTPases | ||
| 5 | Signaling by GPCR | ||
Pathways by source for SPDL1 Gene
12 Reactome pathways for SPDL1 Gene
Interacting Proteins for SPDL1 Gene
Selected Interacting proteins:
ENSP00000265295
Q96EA4-SPDLY_HUMAN
for SPDL1 Gene via
STRING
UniProtKB
IID
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000132 | establishment of mitotic spindle orientation | IMP | 19468067 |
| GO:0007049 | cell cycle | IEA | -- |
| GO:0007062 | sister chromatid cohesion | TAS | -- |
| GO:0007067 | mitotic nuclear division | IEA | -- |
| GO:0007080 | mitotic metaphase plate congression | IMP | 19468067 |
No data available for SIGNOR curated interactions for SPDL1 Gene
Transcripts for SPDL1 Gene
mRNA/cDNA for SPDL1 Gene
- (14) REFSEQ mRNAs :
- (8) Additional mRNA sequences :
- (109) Selected AceView cDNA sequences:
- (16) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for SPDL1 Gene
CRISPR Products
-
OriGene CRISPR knockouts for SPDL1
- GenScript: Design CRISPR guide RNA sequences for SPDL1
miRNA Products
- Search ViGene Biosciences for SPDL1
Clone Products
- Sino Biological Human cDNA Clone for SPDL1
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for SPDL1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for SPDL1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Flow Cytometry Products
| ExUns: | 1 | ^ | 2 | ^ | 3 | ^ | 4 | ^ | 5 | ^ | 6 | ^ | 7a | · | 7b | · | 7c | · | 7d | ^ | 8 | ^ | 9 | ^ | 10a | · | 10b | ^ | 11 | ^ | 12 | ^ | 13 | ^ | 14 | ^ | 15 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | ||||||||||||||||||||||||||||||||||||
| SP2: | - | - | - | - | |||||||||||||||||||||||||||||||||
| SP3: | |||||||||||||||||||||||||||||||||||||
| SP4: | |||||||||||||||||||||||||||||||||||||
| SP5: | - | - | |||||||||||||||||||||||||||||||||||
| SP6: |
Expression for SPDL1 Gene
This gene is overexpressed in Urinary Bladder (33.7), Testis (12.4), Bone (9.5), and Ovary (8.9).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for SPDL1 Gene
NURSA nuclear receptor signaling pathways regulating expression of SPDL1 Gene:
SPDL1SOURCE GeneReport for Unigene cluster for SPDL1 Gene:
Hs.368710Primer Products
-
OriGene qPCR primer pairs and template standards for SPDL1
-
OriGene qPCR primer pairs for SPDL1
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for SPDL1 Gene
Orthologs for SPDL1 Gene
This gene was present in the common ancestor of chordates.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | SPDL1 34 35 |
|
||
| dog (Canis familiaris) |
Mammalia | SPDL1 34 35 |
|
||
| cow (Bos Taurus) |
Mammalia | SPDL1 34 35 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Spdl1 34 |
|
||
| mouse (Mus musculus) |
Mammalia | Spdl1 34 16 35 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | SPDL1 35 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | CCDC99 34 |
|
||
| SPDL1 35 |
|
OneToOne | |||
| lizard (Anolis carolinensis) |
Reptilia | SPDL1 35 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | spdl1 34 |
|
||
| African clawed frog (Xenopus laevis) |
Amphibia | Xl.9016 34 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | zgc:171223 34 |
|
||
| SPDL1 35 |
|
OneToOne | |||
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 35 |
|
OneToOne |
- Species where no ortholog for SPDL1 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- platypus (Ornithorhynchus anatinus)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Paralogs for SPDL1 Gene
No data available for Paralogs for SPDL1 Gene
Variants for SPDL1 Gene
| SNP ID | Clin | Chr 05 pos | Sequence Context | AA Info | Type |
|---|---|---|---|---|---|
| rs730882228 | Likely pathogenic | 169,604,113(+) | AACTT(-/CAAGCAAATTGGAAAAAGAAACTT)GTAAG | cds-indel | |
| rs879255411 | Uncertain significance | 169,594,464(+) | TCCCA(A/G)TAGTA | reference, missense | |
| rs10040988 | -- | 169,605,235(+) | ttttt(A/C/T)gactt | downstream-variant-500B | |
| rs10073896 | -- | 169,583,666(+) | GGGCG(C/G)TCCAT | upstream-variant-2KB, utr-variant-5-prime | |
| rs10073958 | -- | 169,583,742(+) | TCTCG(C/T)GGGAA | upstream-variant-2KB, utr-variant-5-prime |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| nsv5123 | CNV | insertion | 18451855 |
| nsv1031257 | CNV | gain | 25217958 |
Residual Variation Intolerance Score:
93.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
3.24;
52.61% of all genes are more intolerant (likely to be disease-causing)
Relevant External Links for SPDL1 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SPDL1 Gene
Disorders for SPDL1 Gene
Relevant External Links for SPDL1
- Atlas of Genetics and Cytogenetics in Oncology and Haematology:
- SPDL1
No disorders were found for SPDL1 Gene.
No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SPDL1 Gene
Publications for SPDL1 Gene
- Spindly/CCDC99 is required for efficient chromosome congression and mitotic checkpoint regulation. (PMID: 20427577) Barisic M. … Geley S. (Mol. Biol. Cell 2010) 2 3 64
- Mitotic control of kinetochore-associated dynein and spindle orientation by human Spindly. (PMID: 19468067) Chan Y.W. … Santamaria A. (J. Cell Biol. 2009) 3 4 64
- Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 64
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
- Preventing farnesylation of the dynein adaptor Spindly contributes to the mitotic defects caused by farnesyltransferase inhibitors. (PMID: 25808490) Holland A.J. … Gassmann R. (Mol. Biol. Cell 2015) 3 64
Products for SPDL1 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for SPDL1
- Search Origene for MassSpec and Protein Over-expression Lysates for SPDL1
- Origene Custom Protein Services for SPDL1
- Origene rat_shrna, siRNA, shRNA, mouse_rna, and RNAi products in human, mouse, rat for SPDL1
- Browse OriGene Inhibitory RNA Products For SPDL1
- OriGene qPCR primer pairs and template standards for SPDL1
- OriGene qPCR primer pairs for SPDL1
- OriGene CRISPR knockouts for SPDL1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For SPDL1
- GenScript: Next-day shipping cDNA clones in your preferred vector
- GenScript Custom Purified and Recombinant Proteins Services for SPDL1
- GenScript Custom Assay Services for SPDL1
- GenScript Custom overexpressing Cell Line Services for SPDL1
- GenScript: Design CRISPR guide RNA sequences for SPDL1
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for SPDL1
- Sino Biological Human cDNA Clone for SPDL1
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Proteins
- Sino Biological Antibodies
- Sino Biological ELISA Kits and Pair Sets
- Sino Biological Cell Lysates
- Sino Biological qPCR Primers
- Sino Biological CRO Services for Proteins, Antibodies and Genes
- Sino Biological Transfection Reagents
- Novus Biologicals Antibodies for SPDL1
- Novus Biologicals proteins and lysates for SPDL1
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- antibodies-online Antibodies for SPDL1: See all 54
- Search antibodies-online for kits
- antibodies-online Proteins for SPDL1: See all 6
- Search antibodies-online for peptides
- GeneTex SPDL1 antibody for SPDL1
- Search GeneTex for Proteins for SPDL1
- ViGene Biosciences adenoviral particle packaged cDNA for SPDL1 gene
- ViGene Biosciences lentiviral particle packaged cDNA for SPDL1 gene
- ViGene Biosciences ready-to-package AAV shRNAs for SPDL1 gene
- Search ViGene Biosciences for SPDL1
- Cyagen custom Knockout/knockin (KOKI) mouse models for SPDL1
- VectorBuilder custom plasmid, inducible vectors for SPDL1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for SPDL1
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Sources for SPDL1 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) RNAdb
- (29) ASD
- (30) ECgene
- (31) GeneAnnot
- (32) SAGE
- (33) SOURCE
- (34) HomoloGene
- (35) PanEnsembl
- (36) euGenes
- (37) SGD
- (38) FlyBase
- (39) WormBase
- (40) Pseudogene
- (41) DGV
- (42) dbSNP
- (43) GenAtlas
- (44) GeneTests
- (45) HGMD
- (46) GAD
- (47) LSDB
- (48) BGMUT
- (49) HuGE
- (50) eBioscience
- (51) Atlas
- (52) Cell Signaling Technology
- (53) GenBank
- (54) H-invDB
- (55) HORDE
- (56) HUGE
- (57) IMGT
- (58) Leiden
- (59) MILLIPORE
- (60) miRBase
- (61) DME
- (62) NCBI
- (63) OriGene
- (64) PubMed
- (65) R&D Systems
- (66) TGDB
- (67) Tocris
- (68) Abcam
- (69) Novus
- (70) ProSpec
- (71) Sino Biological
- (72) GenScript
- (73) Qiagen
- (74) Cloud-Clone Corp.
- (75) Enzo Life Sciences
- (76) OCA
- (77) Proteopedia
- (78) MOPED
- (79) SPIRE
- (80) neXtProt
- (81) Reactome
- (82) GeneGo (Thomson Reuters)
- (83) fRNAdb
- (84) DISEASES
- (85) SIMAP
- (86) GenomeRNAi
- (87) LifeMap
- (88) miRTarBase
- (89) MalaCards
- (90) Invitrogen
- (91) BitterDB
- (92) Vector BioLabs
- (93) ESI-BIO
- (94) RefSeq
- (95) BioSystems
- (96) MaxQB
- (97) IUPHAR
- (98) BioGPS
- (99) Illumina
- (100) COMPARTMENTS
- (101) HOMER
- (102) PaxDb
- (103) ApexBio
- (104) Addgene
- (105) antibodies-online
- (106) CYP
- (107) NONCODE
- (108) SwitchGear Genomics
- (109) TreeFam
- (110) PathCards
- (111) GeneReviews
- (112) GeneTex
- (113) Taconic Biosciences
- (114) GTEx
- (115) ProteomicsDB
- (116) SCBT
- (117) DGIdb
- (118) ClinicalTrials
- (119) FDA Approved Drugs
- (120) RVIS
- (121) SIGNOR
- (122) diseasecard
- (123) NIH Rare Diseases
- (124) Orphanet
- (125) UMLS
- (126) GTR
- (127) Disease Ontology
- (128) Genetics Home Reference
- (129) MeSH
- (130) MedlinePlus
- (131) CDC
- (132) NINDS
- (133) NCBI Bookshelf
- (134) ClinVar
- (135) Gene Damage Index
- (136) ViGene Biosciences
- (137) HPO
- (138) UDN
- (139) VISTA
- (140) FANTOM5
- (141) ENCODE
- (142) ProSci
- (143) Horizon
- (144) NURSA
- (145) IID
- (146) Cyagen
- (147) VectorBuilder
- (148) SNPedia
- (149) BRCA Exchange
- (150) St John's Lab