Aliases for SPDL1 Gene
Aliases for SPDL1 Gene
External Ids for SPDL1 Gene
- HGNC: 26010
- Entrez Gene: 54908
- Ensembl: ENSG00000040275
- OMIM: 616401
- UniProtKB: Q96EA4
Previous HGNC Symbols for SPDL1 Gene
- CCDC99
Previous GeneCards Identifiers for SPDL1 Gene
- GC05P169011
Summaries for SPDL1 Gene
-
This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]
GeneCards Summary for SPDL1 Gene
SPDL1 (Spindle Apparatus Coiled-Coil Protein 1) is a Protein Coding gene. Among its related pathways are Signaling by Rho GTPases and Cell Cycle, Mitotic. Gene Ontology (GO) annotations related to this gene include enzyme binding and kinetochore binding.
UniProtKB/Swiss-Prot for SPDL1 Gene
-
Required for the localization of dynein and dynactin to the mitotic kintochore. Dynein is believed to control the initial lateral interaction between the kinetochore and spindle microtubules and to facilitate the subsequent formation of end-on kinetochore-microtubule attachments mediated by the NDC80 complex. Also required for correct spindle orientation. Does not appear to be required for the removal of spindle assembly checkpoint (SAC) proteins from the kinetochore upon bipolar spindle attachment (PubMed:17576797, PubMed:19468067). Acts as an adapter protein linking the dynein motor complex to various cargos and converts dynein from a non-processive to a highly processive motor in the presence of dynactin. Facilitates the interaction between dynein and dynactin and activates dynein processivity (the ability to move along a microtubule for a long distance without falling off the track) (PubMed:25035494).
No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SPDL1 Gene
Genomics for SPDL1 Gene
GeneHancer (GH) Regulatory Elements for SPDL1 Gene
GeneHancer (GH) Identifier | GH Type | GH Score |
GH Sources | Gene Association Score | Total Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites |
Gene Targets |
---|---|---|---|---|---|---|---|---|---|---|
GH05I169582 | Promoter/Enhancer | 2 | EPDnew Ensembl ENCODE | 596.2 | +0.6 | 559 | 2.5 | PKNOX1 ATF1 FOXA2 ARID4B SIN3A GLI4 BRCA1 ZNF48 YY1 POLR2B | SPDL1 GC05M169584 LOC105377714 ENSG00000254192 | |
GH05I169581 | Enhancer | 0.8 | Ensembl ENCODE | 568.4 | -1.9 | -1901 | 0.3 | CTCF ZNF654 TRIM22 RAD21 GATA3 GATAD1 MYNN SMC3 ZNF143 HNF4A | SPDL1 LOC105377714 RNU6-477P | |
GH05I169636 | Promoter/Enhancer | 2 | EPDnew Ensembl ENCODE dbSUPER | 21.7 | +54.0 | 54026 | 2.1 | HDGF RB1 ZBTB40 KLF5 ZNF143 ATF7 ETV6 BCLAF1 IKZF2 RUNX3 | DOCK2 SPDL1 GC05M169639 | |
GH05I169628 | Enhancer | 0.8 | FANTOM5 ENCODE | 29.1 | +45.7 | 45714 | 2.3 | STAT1 JUN CEBPB ZNF398 EP300 ZNF644 SP1 JUND FOS FOSL2 | SPDL1 SLIT3 DOCK2 GC05M169584 | |
GH05I169626 | Enhancer | 0.5 | ENCODE | 32.2 | +43.4 | 43395 | 1.3 | JUND POLR2A JUN FOSL2 FOS | SPDL1 DOCK2 GC05M169584 |
Regulatory Element Products
Genomic Locations for SPDL1 Gene
- chr5:169,583,634-169,604,778
- (GRCh38/hg38)
- Size:
- 21,145 bases
- Orientation:
- Plus strand
- chr5:169,010,638-169,031,782
- (GRCh37/hg19)
Genomic View for SPDL1 Gene
- Cytogenetic band:
-
- 5q35.1 by Ensembl
- 5q35.1 by Entrez Gene
- 5q35.1 by HGNC


RefSeq DNA sequence for SPDL1 Gene
Proteins for SPDL1 Gene
-
Protein details for SPDL1 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q96EA4-SPDLY_HUMAN
- Recommended name:
- Protein Spindly
- Protein Accession:
- Q96EA4
- B4E393
- C9JS47
- Q8TEC8
- Q9HD44
- Q9NX97
Protein attributes for SPDL1 Gene
- Size:
- 605 amino acids
- Molecular mass:
- 70172 Da
- Quaternary structure:
-
- Interacts with KNTC1 and ZW10. These interactions appear weak and may be transient or indirect (PubMed:19468067). Interacts with dynein intermediate chain and dynactin (DCTN1) (PubMed:25035494).
- SequenceCaution:
-
- Sequence=AAG01408.1; Type=Frameshift; Positions=604; Evidence={ECO:0000305}; Sequence=BAA91119.1; Type=Frameshift; Positions=412; Evidence={ECO:0000305}; Sequence=BAB85022.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};
Protein Expression for SPDL1 Gene
Post-translational modifications for SPDL1 Gene
Other Protein References for SPDL1 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- Novus Biologicals Antibodies for SPDL1
-
Abcam antibodies for SPDL1
- Invitrogen Antibodies for SPDL1
- GeneTex SPDL1 antibody for SPDL1
Protein Products
-
OriGene Purified Proteins for SPDL1
- Search Origene for MassSpec and Protein Over-expression Lysates for SPDL1
- Origene Custom Protein Services for SPDL1
- Search GeneTex for Proteins for SPDL1
-
Abcam proteins for SPDL1
Assay Products
No data available for DME Specific Peptides for SPDL1 Gene
Domains & Families for SPDL1 Gene
Gene Families for SPDL1 Gene
- Human Protein Atlas (HPA):
-
- Predicted intracellular proteins
Protein Domains for SPDL1 Gene
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for SPDL1 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q96EA4- Family:
-
- Belongs to the Spindly family.
Function for SPDL1 Gene
Molecular function for SPDL1 Gene
- UniProtKB/Swiss-Prot Function:
- Required for the localization of dynein and dynactin to the mitotic kintochore. Dynein is believed to control the initial lateral interaction between the kinetochore and spindle microtubules and to facilitate the subsequent formation of end-on kinetochore-microtubule attachments mediated by the NDC80 complex. Also required for correct spindle orientation. Does not appear to be required for the removal of spindle assembly checkpoint (SAC) proteins from the kinetochore upon bipolar spindle attachment (PubMed:17576797, PubMed:19468067). Acts as an adapter protein linking the dynein motor complex to various cargos and converts dynein from a non-processive to a highly processive motor in the presence of dynactin. Facilitates the interaction between dynein and dynactin and activates dynein processivity (the ability to move along a microtubule for a long distance without falling off the track) (PubMed:25035494).
Phenotypes From GWAS Catalog for SPDL1 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005515 | protein binding | IPI | 19468067 |
GO:0019899 | enzyme binding | IPI | 23382074 |
GO:0043515 | kinetochore binding | IDA | 19468067 |
Phenotypes for SPDL1 Gene
- GenomeRNAi human phenotypes for SPDL1:
-
- Increased vaccinia virus (VACV) infection
- Increased gamma-H2AX phosphorylation
- Negative genetic interaction between MUS81-/- and MUS81+/+
- Mildly decreased CFP-tsO45G cell surface transport
- Dynamic nuclei (hole, folded or small irregular)
- Decreased NF-kappaB reporter expression
- Decreased IL-8 secretion
- Decreased Hepatitis C virus replication
- Reduced shRNA abundance in FBW7 KO line
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for SPDL1
-
-
ViGene Biosciences lentiviral particle packaged cDNA for SPDL1 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for SPDL1 gene
- Search ViGene Biosciences for SPDL1
CRISPR Products
-
OriGene CRISPR knockouts for SPDL1
- genomics-online: gRNA clones - Search results for available CCDC99 gene related products
- Applied Biological Materials CRISPR for SPDL1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for SPDL1
- GenScript: Design CRISPR guide RNA sequences for SPDL1
miRNA for SPDL1 Gene
- miRTarBase miRNAs that target SPDL1
miRNA Products
- Search ViGene Biosciences for SPDL1
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for SPDL1
- Browse OriGene Inhibitory RNA Products For SPDL1
- genomics-online: shRNA clones - Search results for available CCDC99 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for SPDL1 gene
Clone Products
- Sino Biological Human cDNA Clone for SPDL1
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for SPDL1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for SPDL1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- genomics-online: cdna clones - Search results for available CCDC99 gene related products
- orf clones - Search results for available CCDC99 gene related products
- Applied Biological Materials Clones for SPDL1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
ViGene Biosciences adenoviral particle packaged cDNA for SPDL1 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for SPDL1 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for SPDL1 gene
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SPDL1 Gene
Localization for SPDL1 Gene
Subcellular locations from UniProtKB/Swiss-Prot for SPDL1 Gene
- Cytoplasm, cytoskeleton, microtubule organizing center, centrosome. Chromosome, centromere, kinetochore. Nucleus. Cytoplasm, cytoskeleton, spindle pole. Note=Localizes to the nucleus in interphase and to the kinetochore in early prometaphase. Relocalizes to the mitotic spindle pole before metaphase and is subsequently lost from the spindle poles after chromosome congression is completed. Removal of this protein from the kinetochore requires the dynein/dynactin complex.
- Cytosol (2)
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000775 | chromosome, centromeric region | IEA | -- |
GO:0000776 | kinetochore | IEA | -- |
GO:0000777 | condensed chromosome kinetochore | IEA | -- |
GO:0000922 | spindle pole | IDA,IEA | 19468067 |
GO:0000940 | condensed chromosome outer kinetochore | IDA | 19468067 |
Pathways & Interactions for SPDL1 Gene
SuperPathway | Contained pathways | ||
---|---|---|---|
1 | Cell Cycle, Mitotic |
.83
|
.60
|
2 | Mitotic Metaphase and Anaphase |
.94
|
|
3 | Mitotic Prometaphase | ||
4 | Signaling by Rho GTPases | ||
5 | Signaling by GPCR |
Pathways by source for SPDL1 Gene
12 Reactome pathways for SPDL1 Gene
Interacting Proteins for SPDL1 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000132 | establishment of mitotic spindle orientation | IMP | 19468067 |
GO:0007049 | cell cycle | IEA | -- |
GO:0007062 | sister chromatid cohesion | TAS | -- |
GO:0007080 | mitotic metaphase plate congression | IMP | 19468067 |
GO:0031577 | spindle checkpoint | IEA | -- |
No data available for SIGNOR curated interactions for SPDL1 Gene
Transcripts for SPDL1 Gene
mRNA/cDNA for SPDL1 Gene
- (14) REFSEQ mRNAs :
- (8) Additional mRNA sequences :
- (109) Selected AceView cDNA sequences:
- (16) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for SPDL1 Gene
CRISPR Products
-
OriGene CRISPR knockouts for SPDL1
- genomics-online: gRNA clones - Search results for available CCDC99 gene related products
- Applied Biological Materials CRISPR for SPDL1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for SPDL1
- GenScript: Design CRISPR guide RNA sequences for SPDL1
miRNA Products
- Search ViGene Biosciences for SPDL1
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for SPDL1
- Browse OriGene Inhibitory RNA Products For SPDL1
- genomics-online: shRNA clones - Search results for available CCDC99 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for SPDL1 gene
Clone Products
- Sino Biological Human cDNA Clone for SPDL1
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for SPDL1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for SPDL1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- genomics-online: cdna clones - Search results for available CCDC99 gene related products
- orf clones - Search results for available CCDC99 gene related products
- Applied Biological Materials Clones for SPDL1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
ExUns: | 1 | ^ | 2 | ^ | 3 | ^ | 4 | ^ | 5 | ^ | 6 | ^ | 7a | · | 7b | · | 7c | · | 7d | ^ | 8 | ^ | 9 | ^ | 10a | · | 10b | ^ | 11 | ^ | 12 | ^ | 13 | ^ | 14 | ^ | 15 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
SP1: | - | ||||||||||||||||||||||||||||||||||||
SP2: | - | - | - | - | |||||||||||||||||||||||||||||||||
SP3: | |||||||||||||||||||||||||||||||||||||
SP4: | |||||||||||||||||||||||||||||||||||||
SP5: | - | - | |||||||||||||||||||||||||||||||||||
SP6: |
Expression for SPDL1 Gene
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for SPDL1 Gene
NURSA nuclear receptor signaling pathways regulating expression of SPDL1 Gene:
SPDL1SOURCE GeneReport for Unigene cluster for SPDL1 Gene:
Hs.368710Evidence on tissue expression from TISSUES for SPDL1 Gene
- Nervous system(4.5)
- Intestine(4.3)
Primer Products
-
OriGene qPCR primer pairs for SPDL1
-
OriGene qPCR primer pairs and template standards for SPDL1
- genomics-online: primer clones - Search results for available CCDC99 gene related products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for SPDL1 Gene
Orthologs for SPDL1 Gene
This gene was present in the common ancestor of chordates.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | SPDL1 33 34 |
|
||
dog (Canis familiaris) |
Mammalia | SPDL1 33 34 |
|
||
cow (Bos Taurus) |
Mammalia | SPDL1 33 34 |
|
||
rat (Rattus norvegicus) |
Mammalia | Spdl1 33 |
|
||
mouse (Mus musculus) |
Mammalia | Spdl1 33 16 34 |
|
||
oppossum (Monodelphis domestica) |
Mammalia | SPDL1 34 |
|
OneToOne | |
chicken (Gallus gallus) |
Aves | CCDC99 33 |
|
||
SPDL1 34 |
|
OneToOne | |||
lizard (Anolis carolinensis) |
Reptilia | SPDL1 34 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | spdl1 33 |
|
||
African clawed frog (Xenopus laevis) |
Amphibia | Xl.9016 33 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | zgc:171223 33 |
|
||
SPDL1 34 |
|
OneToOne | |||
sea squirt (Ciona savignyi) |
Ascidiacea | -- 34 |
|
OneToOne |
- Species where no ortholog for SPDL1 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- platypus (Ornithorhynchus anatinus)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Paralogs for SPDL1 Gene
No data available for Paralogs for SPDL1 Gene
Variants for SPDL1 Gene
SNP ID | Clin | Chr 05 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs730882228 | likely-pathogenic, Neonatal death, Severe primary microcephaly | 169,604,102(+) | AAAAGAAACTTCAAGCAAATTGGAAAAAGAAACTT/AAAAGAAACTT | coding_sequence_variant, genic_downstream_transcript_variant, inframe_deletion | |
rs879255411 | uncertain-significance, not specified | 169,594,464(+) | A/G | coding_sequence_variant, missense_variant | |
rs1000038946 | -- | 169,594,457(+) | G/C | coding_sequence_variant, missense_variant | |
rs1000045366 | -- | 169,592,442(+) | C/G/T | intron_variant | |
rs1000374017 | -- | 169,583,834(+) | G/A/C/T | 5_prime_UTR_variant, genic_upstream_transcript_variant, upstream_transcript_variant |
Variant ID | Type | Subtype | PubMed ID |
---|---|---|---|
nsv1031257 | CNV | gain | 25217958 |
nsv5123 | CNV | insertion | 18451855 |
Additional Variant Information for SPDL1 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SPDL1 Gene
Disorders for SPDL1 Gene
Additional Disease Information for SPDL1
No disorders were found for SPDL1 Gene.
No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SPDL1 Gene
Publications for SPDL1 Gene
- Spindly/CCDC99 is required for efficient chromosome congression and mitotic checkpoint regulation. (PMID: 20427577) Barisic M … Geley S (Molecular biology of the cell 2010) 2 3 58
- Mitotic control of kinetochore-associated dynein and spindle orientation by human Spindly. (PMID: 19468067) Chan YW … Santamaria A (The Journal of cell biology 2009) 3 4 58
- Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
- Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
Products for SPDL1 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for SPDL1
- Search Origene for MassSpec and Protein Over-expression Lysates for SPDL1
- Origene Custom Protein Services for SPDL1
- Origene shrna, sirna, and RNAi products in human, mouse, rat for SPDL1
- Browse OriGene Inhibitory RNA Products For SPDL1
- OriGene qPCR primer pairs and template standards for SPDL1
- OriGene qPCR primer pairs for SPDL1
- OriGene CRISPR knockouts for SPDL1
- OriGene ORF clones in human for SPDL1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For SPDL1
- GenScript: Next-day shipping of latest version cDNA ORF clones for SPDL1 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for SPDL1
- GenScript Custom Assay Services for SPDL1
- GenScript Custom overexpressing Cell Line Services for SPDL1
- GenScript: Design CRISPR guide RNA sequences for SPDL1
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for SPDL1
- Sino Biological Human cDNA Clone for SPDL1
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for SPDL1
- Novus Biologicals lysates and proteins for SPDL1
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Abcam antibodies for SPDL1
- Abcam proteins for SPDL1
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Invitrogen Antibodies for SPDL1
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Cyagen custom Knockout/knockin (KOKI) mouse models for SPDL1
- VectorBuilder custom plasmid, inducible vectors for SPDL1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for SPDL1
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for 44 available SPDL1 Antibodies ranked by validation data
- Compare Top SPDL1 Antibodies
- antibodies-online: Search results for available SPDL1 related products ranked by validation data
- antibodies-online: Search results for 5 available SPDL1 Proteins ranked by validation data
- Compare Top SPDL1 Proteins
- GeneTex SPDL1 antibody for SPDL1
- Search GeneTex for Proteins for SPDL1
- ViGene Biosciences adenoviral particle packaged cDNA for SPDL1 gene
- ViGene Biosciences lentiviral particle packaged cDNA for SPDL1 gene
- ViGene Biosciences ready-to-package AAV shRNAs for SPDL1 gene
- Search ViGene Biosciences for SPDL1
- genomics-online: cdna clones - Search results for available SPDL1 gene related products
- orf clones - Search results for available SPDL1 gene related products
- genomics-online: gRNA clones - Search results for available SPDL1 gene related products
- genomics-online: primer clones - Search results for available SPDL1 gene related products
- genomics-online: shRNA clones - Search results for available SPDL1 gene related products
Sources for SPDL1 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew