Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SPDL1 Gene

Aliases for SPDL1 Gene

  • Spindle Apparatus Coiled-Coil Protein 1 2 3 5
  • Coiled-Coil Domain-Containing Protein 99 3 4
  • Rhabdomyosarcoma Antigen MU-RMS-40.4A 3 4
  • Arsenite-Related Gene 1 Protein 3 4
  • CCDC99 3 4
  • Spindle Apparatus Coiled-Coil Domain-Containing Protein 1 4
  • Rrhabdomyosarcoma Antigen Protein MU-RMS-40.4A 3
  • Coiled-Coil Domain Containing 99 2
  • Spindly Homolog (Drosophila) 2
  • Protein Spindly 3
  • HSpindly 4

External Ids for SPDL1 Gene

Previous HGNC Symbols for SPDL1 Gene

  • CCDC99

Previous GeneCards Identifiers for SPDL1 Gene

  • GC05P169011

Summaries for SPDL1 Gene

Entrez Gene Summary for SPDL1 Gene

  • This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]

GeneCards Summary for SPDL1 Gene

SPDL1 (Spindle Apparatus Coiled-Coil Protein 1) is a Protein Coding gene. Among its related pathways are Mitotic Metaphase and Anaphase and Signaling by GPCR. GO annotations related to this gene include enzyme binding and kinetochore binding.

UniProtKB/Swiss-Prot for SPDL1 Gene

  • Required for the localization of dynein and dynactin to the mitotic kintochore. Dynein is believed to control the initial lateral interaction between the kinetochore and spindle microtubules and to facilitate the subsequent formation of end-on kinetochore-microtubule attachments mediated by the NDC80 complex. Also required for correct spindle orientation. Does not appear to be required for the removal of spindle assembly checkpoint (SAC) proteins from the kinetochore upon bipolar spindle attachment (PubMed:17576797, PubMed:19468067). Acts as an adapter protein linking the dynein motor complex to various cargos and converts dynein from a non-processive to a highly processive motor in the presence of dynactin. Facilitates the interaction between dynein and dynactin and activates dynein processivity (the ability to move along a microtubule for a long distance without falling off the track) (PubMed:25035494).

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SPDL1 Gene

Genomics for SPDL1 Gene

Regulatory Elements for SPDL1 Gene

Enhancers for SPDL1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH05G169582 1 ENCODE 46.2 +0.6 559 2.5 PKNOX1 ATF1 FOXA2 CREB3L1 WRNIP1 ARID4B SIN3A GLI4 BRCA1 ZNF48 SPDL1 GC05M169584
GH05G169628 1 FANTOM5 ENCODE 29.1 +45.7 45714 2.3 STAT1 ZNF133 JUN SIN3A CEBPB ZNF398 EP300 ZNF644 JUND POLR2A SPDL1 SLIT3 DOCK2 GC05M169584
GH05G169636 1.2 ENCODE dbSUPER 21.7 +54.0 54027 2.1 HDGF PKNOX1 WRNIP1 SIN3A ZBTB40 EGR1 ELK1 ZNF143 RELB ETV6 SPDL1 DOCK2 GC05M169639
GH05G169626 0.6 ENCODE 32.2 +43.4 43396 1.3 JUND JUN BHLHE40 FOS MAFK NFE2L2 SPDL1 DOCK2 GC05M169584
GH05G169591 0.4 ENCODE 43 +8.2 8184 0.7 NR2F2 SPDL1 GC05M169584 DOCK2
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around SPDL1 on UCSC Golden Path with GeneCards custom track

Promoters for SPDL1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

Genomic Location for SPDL1 Gene

169,583,634 bp from pter
169,604,778 bp from pter
21,145 bases
Plus strand

Genomic View for SPDL1 Gene

Genes around SPDL1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SPDL1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SPDL1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SPDL1 Gene

Proteins for SPDL1 Gene

  • Protein details for SPDL1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein Spindly
    Protein Accession:
    Secondary Accessions:
    • B4E393
    • C9JS47
    • Q8TEC8
    • Q9HD44
    • Q9NX97

    Protein attributes for SPDL1 Gene

    605 amino acids
    Molecular mass:
    70172 Da
    Quaternary structure:
    • Interacts with KNTC1 and ZW10. These interactions appear weak and may be transient or indirect (PubMed:19468067). Interacts with dynein intermediate chain and dynactin (DCTN1) (PubMed:25035494).
    • Sequence=AAG01408.1; Type=Frameshift; Positions=604; Evidence={ECO:0000305}; Sequence=BAA91119.1; Type=Frameshift; Positions=412; Evidence={ECO:0000305}; Sequence=BAB85022.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};

    Alternative splice isoforms for SPDL1 Gene


neXtProt entry for SPDL1 Gene

Post-translational modifications for SPDL1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for SPDL1 Gene

Domains & Families for SPDL1 Gene

Protein Domains for SPDL1 Gene


Suggested Antigen Peptide Sequences for SPDL1 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the Spindly family.
  • Belongs to the Spindly family.
genes like me logo Genes that share domains with SPDL1: view

No data available for Gene Families for SPDL1 Gene

Function for SPDL1 Gene

Molecular function for SPDL1 Gene

UniProtKB/Swiss-Prot Function:
Required for the localization of dynein and dynactin to the mitotic kintochore. Dynein is believed to control the initial lateral interaction between the kinetochore and spindle microtubules and to facilitate the subsequent formation of end-on kinetochore-microtubule attachments mediated by the NDC80 complex. Also required for correct spindle orientation. Does not appear to be required for the removal of spindle assembly checkpoint (SAC) proteins from the kinetochore upon bipolar spindle attachment (PubMed:17576797, PubMed:19468067). Acts as an adapter protein linking the dynein motor complex to various cargos and converts dynein from a non-processive to a highly processive motor in the presence of dynactin. Facilitates the interaction between dynein and dynactin and activates dynein processivity (the ability to move along a microtubule for a long distance without falling off the track) (PubMed:25035494).

Gene Ontology (GO) - Molecular Function for SPDL1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 19468067
GO:0019899 enzyme binding IPI 23382074
GO:0043515 kinetochore binding IDA 19468067
genes like me logo Genes that share ontologies with SPDL1: view
genes like me logo Genes that share phenotypes with SPDL1: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SPDL1 Gene

Localization for SPDL1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SPDL1 Gene

Cytoplasm, cytoskeleton, microtubule organizing center, centrosome. Chromosome, centromere, kinetochore. Nucleus. Cytoplasm, cytoskeleton, spindle pole. Note=Localizes to the nucleus in interphase and to the kinetochore in early prometaphase. Relocalizes to the mitotic spindle pole before metaphase and is subsequently lost from the spindle poles after chromosome congression is completed. Removal of this protein from the kinetochore requires the dynein/dynactin complex.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SPDL1 gene
Compartment Confidence
cytoskeleton 5
nucleus 5
cytosol 5

Gene Ontology (GO) - Cellular Components for SPDL1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000775 chromosome, centromeric region IEA --
GO:0000776 kinetochore IEA --
GO:0000777 condensed chromosome kinetochore IEA --
GO:0000922 spindle pole IEA,IDA 19468067
GO:0000940 condensed chromosome outer kinetochore IDA 19468067
genes like me logo Genes that share ontologies with SPDL1: view

Pathways & Interactions for SPDL1 Gene

genes like me logo Genes that share pathways with SPDL1: view

Pathways by source for SPDL1 Gene

Gene Ontology (GO) - Biological Process for SPDL1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000132 establishment of mitotic spindle orientation IMP 19468067
GO:0007049 cell cycle IEA --
GO:0007062 sister chromatid cohesion TAS --
GO:0007067 mitotic nuclear division IEA --
GO:0007080 mitotic metaphase plate congression IMP 19468067
genes like me logo Genes that share ontologies with SPDL1: view

No data available for SIGNOR curated interactions for SPDL1 Gene

Drugs & Compounds for SPDL1 Gene

No Compound Related Data Available

Transcripts for SPDL1 Gene

Unigene Clusters for SPDL1 Gene

Spindle apparatus coiled-coil protein 1:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SPDL1 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7a · 7b · 7c · 7d ^ 8 ^ 9 ^ 10a · 10b ^ 11 ^ 12 ^ 13 ^ 14 ^ 15
SP1: -
SP2: - - - -
SP5: - -

Relevant External Links for SPDL1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SPDL1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SPDL1 Gene

Protein differential expression in normal tissues from HIPED for SPDL1 Gene

This gene is overexpressed in Urinary Bladder (33.7), Testis (12.4), Bone (9.5), and Ovary (8.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for SPDL1 Gene

Protein tissue co-expression partners for SPDL1 Gene

NURSA nuclear receptor signaling pathways regulating expression of SPDL1 Gene:


SOURCE GeneReport for Unigene cluster for SPDL1 Gene:


Evidence on tissue expression from TISSUES for SPDL1 Gene

  • Nervous system(4.5)
  • Intestine(4.3)
genes like me logo Genes that share expression patterns with SPDL1: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for SPDL1 Gene

Orthologs for SPDL1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for SPDL1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SPDL1 34 35
  • 99.39 (n)
(Canis familiaris)
Mammalia SPDL1 34 35
  • 90.22 (n)
(Bos Taurus)
Mammalia SPDL1 34 35
  • 87.4 (n)
(Rattus norvegicus)
Mammalia Spdl1 34
  • 78.28 (n)
(Mus musculus)
Mammalia Spdl1 34 16 35
  • 77.34 (n)
(Monodelphis domestica)
Mammalia SPDL1 35
  • 67 (a)
(Gallus gallus)
Aves CCDC99 34
  • 66.94 (n)
SPDL1 35
  • 59 (a)
(Anolis carolinensis)
Reptilia SPDL1 35
  • 53 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia spdl1 34
  • 61.28 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.9016 34
(Danio rerio)
Actinopterygii zgc:171223 34
  • 57.07 (n)
SPDL1 35
  • 46 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 25 (a)
Species where no ortholog for SPDL1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for SPDL1 Gene

Gene Tree for SPDL1 (if available)
Gene Tree for SPDL1 (if available)

Paralogs for SPDL1 Gene

No data available for Paralogs for SPDL1 Gene

Variants for SPDL1 Gene

Sequence variations from dbSNP and Humsavar for SPDL1 Gene

SNP ID Clin Chr 05 pos Sequence Context AA Info Type
rs730882228 Likely pathogenic 169,604,113(+) AACTT(-/CAAGCAAATTGGAAAAAGAAACTT)GTAAG cds-indel
rs879255411 Uncertain significance 169,594,464(+) TCCCA(A/G)TAGTA reference, missense
rs1000038946 -- 169,594,457(+) CCTTG(C/G)ATCCC reference, missense
rs1000045366 -- 169,592,442(+) TAACT(C/T)CTGAC intron-variant
rs1000374017 -- 169,583,834(+) TGGAC(A/G)CCCTG upstream-variant-2KB, utr-variant-5-prime

Structural Variations from Database of Genomic Variants (DGV) for SPDL1 Gene

Variant ID Type Subtype PubMed ID
nsv1031257 CNV gain 25217958
nsv5123 CNV insertion 18451855

Variation tolerance for SPDL1 Gene

Residual Variation Intolerance Score: 93.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.24; 52.61% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for SPDL1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SPDL1 Gene

Disorders for SPDL1 Gene

Relevant External Links for SPDL1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for SPDL1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SPDL1 Gene

Publications for SPDL1 Gene

  1. Spindly/CCDC99 is required for efficient chromosome congression and mitotic checkpoint regulation. (PMID: 20427577) Barisic M. … Geley S. (Mol. Biol. Cell 2010) 2 3 64
  2. Mitotic control of kinetochore-associated dynein and spindle orientation by human Spindly. (PMID: 19468067) Chan Y.W. … Santamaria A. (J. Cell Biol. 2009) 3 4 64
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 64
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
  5. Widespread macromolecular interaction perturbations in human genetic disorders. (PMID: 25910212) Sahni N. … Vidal M. (Cell 2015) 3 64

Products for SPDL1 Gene

Sources for SPDL1 Gene

Loading form....