Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SPATA32 Gene

Aliases for SPATA32 Gene

  • Spermatogenesis Associated 32 2 3 5
  • Testis-Expressed Protein 34 3 4
  • Acrosome Expressed 2 2 3
  • Testis Expressed 34 2 3
  • C17orf46 3 4
  • TEX34 3 4
  • Spermatogenesis-Associated Protein 32 3
  • Testis-Expressed Sequence 34 Protein 3
  • Chromosome 17 Open Reading Frame 46 2
  • CTD-2020K17.4 3
  • VAD1.2 3
  • AEP2 3

External Ids for SPATA32 Gene

Previous HGNC Symbols for SPATA32 Gene

  • C17orf46
  • TEX34

Previous GeneCards Identifiers for SPATA32 Gene

  • GC17M043333

Summaries for SPATA32 Gene

GeneCards Summary for SPATA32 Gene

SPATA32 (Spermatogenesis Associated 32) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include actin binding.

Additional gene information for SPATA32 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SPATA32 Gene

Genomics for SPATA32 Gene

GeneHancer (GH) Regulatory Elements for SPATA32 Gene

Promoters and enhancers for SPATA32 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17I045261 Promoter/Enhancer 1.8 EPDnew Ensembl ENCODE dbSUPER 560.2 -0.8 -750 2.9 HDGF CTCF SMAD5 CEBPB ZIC2 SP1 ZFHX2 POLR2A NFATC1 ZBTB33 SPATA32 GC17M045264 GC17M045296 ENSG00000233175 MAP3K14-AS1 MAP3K14
GH17I045305 Promoter/Enhancer 2.8 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 17.3 -51.6 -51619 17.2 MLX ZFP64 FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 ZNF143 SP3 MAP3K14 FMNL1 SPATA32 PLEKHM1 ENSG00000262372 KANSL1 LINC02210 ARHGAP27 EFTUD2 ENSG00000224505
GH17I045404 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 11.1 -148.7 -148691 13.3 HDGF PKNOX1 FOXA2 MLX ARID4B SIN3A DMAP1 ZNF48 GLIS2 ATF7 ARHGAP27 GC17M045407 LINC02210 LRRC37A4P FMNL1 SPATA32 LRRC37A PLEKHM1 ENSG00000224505
GH17I045282 Enhancer 0.8 ENCODE dbSUPER 23.4 -21.5 -21544 3.2 CTCF ZNF398 ZIC2 RAD21 ZNF121 ZFHX2 GLIS1 HNF4A ZNF600 FOS GC17M045284 GC17M045285 SPATA32 FMNL1 MAP3K14 ENSG00000233175 ENSG00000233483 GC17M045274 GC17M045281
GH17I045287 Enhancer 0.8 ENCODE dbSUPER 21.4 -26.8 -26828 3.3 RFX1 ZIC2 TEAD3 ZNF335 GLIS2 POLR2A GLIS1 SCRT2 HNF4A ZNF600 GC17M045287 GC17M045288 GC17M045289 GC17M045290 GC17M045291 GC17M045292 GC17M045294 GC17M045301 SPATA32 MAP3K14
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SPATA32 on UCSC Golden Path with GeneCards custom track

Genomic Locations for SPATA32 Gene

Genomic Locations for SPATA32 Gene
chr17:45,247,274-45,262,112
(GRCh38/hg38)
Size:
14,839 bases
Orientation:
Minus strand
chr17:43,331,760-43,339,479
(GRCh37/hg19)

Genomic View for SPATA32 Gene

Genes around SPATA32 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SPATA32 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SPATA32 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SPATA32 Gene

Proteins for SPATA32 Gene

  • Protein details for SPATA32 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96LK8-SPT32_HUMAN
    Recommended name:
    Spermatogenesis-associated protein 32
    Protein Accession:
    Q96LK8
    Secondary Accessions:
    • Q7Z4U1
    • Q8N6V6

    Protein attributes for SPATA32 Gene

    Size:
    384 amino acids
    Molecular mass:
    42325 Da
    Quaternary structure:
    • Interacts with syntaxin-1 and ACTB.

neXtProt entry for SPATA32 Gene

Post-translational modifications for SPATA32 Gene

No Post-translational modifications

Other Protein References for SPATA32 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for SPATA32 Gene

Domains & Families for SPATA32 Gene

Gene Families for SPATA32 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for SPATA32 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for SPATA32 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with SPATA32: view

No data available for UniProtKB/Swiss-Prot for SPATA32 Gene

Function for SPATA32 Gene

Phenotypes From GWAS Catalog for SPATA32 Gene

Gene Ontology (GO) - Molecular Function for SPATA32 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003779 actin binding IBA --
genes like me logo Genes that share ontologies with SPATA32: view
genes like me logo Genes that share phenotypes with SPATA32: view

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SPATA32 Gene

Localization for SPATA32 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SPATA32 gene
Compartment Confidence
nucleus 3
mitochondrion 2
cytosol 1

Gene Ontology (GO) - Cellular Components for SPATA32 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0048471 perinuclear region of cytoplasm IBA --
genes like me logo Genes that share ontologies with SPATA32: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Subcellular locations from the Human Protein Atlas (HPA) for SPATA32 Gene

Pathways & Interactions for SPATA32 Gene

SuperPathways for SPATA32 Gene

No Data Available

Interacting Proteins for SPATA32 Gene

STRING Interaction Network Preview (showing 3 interactants - click image to see details)
http://version10.5.string-db.org/api/image/networkList?limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000331532%0d%0a9606.ENSP00000308750%0d%0a9606.ENSP00000334922%0d%0a9606.ENSP00000270617%0d%0a
Selected Interacting proteins: ENSP00000331532 for SPATA32 Gene via STRING

Gene Ontology (GO) - Biological Process for SPATA32 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007283 spermatogenesis IBA --
genes like me logo Genes that share ontologies with SPATA32: view

No data available for Pathways by source and SIGNOR curated interactions for SPATA32 Gene

Drugs & Compounds for SPATA32 Gene

No Compound Related Data Available

Transcripts for SPATA32 Gene

mRNA/cDNA for SPATA32 Gene

(1) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(13) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SPATA32 Gene

Spermatogenesis associated 32:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for SPATA32 Gene

No ASD Table

Relevant External Links for SPATA32 Gene

GeneLoc Exon Structure for
SPATA32
ECgene alternative splicing isoforms for
SPATA32

Expression for SPATA32 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SPATA32 Gene

mRNA differential expression in normal tissues according to GTEx for SPATA32 Gene

This gene is overexpressed in Testis (x46.0).

NURSA nuclear receptor signaling pathways regulating expression of SPATA32 Gene:

SPATA32

SOURCE GeneReport for Unigene cluster for SPATA32 Gene:

Hs.412719

mRNA Expression by UniProt/SwissProt for SPATA32 Gene:

Q96LK8-SPT32_HUMAN
Tissue specificity: Detected in testis, and on the acrosomal cap of spermatids.

Evidence on tissue expression from TISSUES for SPATA32 Gene

  • Nervous system(4.2)
genes like me logo Genes that share expression patterns with SPATA32: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for SPATA32 Gene

Orthologs for SPATA32 Gene

This gene was present in the common ancestor of mammals.

Orthologs for SPATA32 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SPATA32 33 34
  • 98.78 (n)
cow
(Bos Taurus)
Mammalia LOC767871 33
  • 65.89 (n)
SPATA32 34
  • 42 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Spata32 33 16 34
  • 61.68 (n)
rat
(Rattus norvegicus)
Mammalia Spata32 33
  • 60.96 (n)
dog
(Canis familiaris)
Mammalia SPATA32 34
  • 46 (a)
OneToOne
Species where no ortholog for SPATA32 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for SPATA32 Gene

ENSEMBL:
Gene Tree for SPATA32 (if available)
TreeFam:
Gene Tree for SPATA32 (if available)

Paralogs for SPATA32 Gene

No data available for Paralogs for SPATA32 Gene

Variants for SPATA32 Gene

Sequence variations from dbSNP and Humsavar for SPATA32 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs1000251424 -- 45,262,136(-) CTGTGATGTCGCCGCCTCTGTGA/CTGTGA upstream_transcript_variant
rs1000335712 -- 45,263,553(-) A/G upstream_transcript_variant
rs1000888056 -- 45,259,066(-) C/G intron_variant
rs1000894770 -- 45,255,500(-) G/A/C/T coding_sequence_variant, missense_variant, synonymous_variant
rs1000968958 -- 45,261,028(-) C/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for SPATA32 Gene

Variant ID Type Subtype PubMed ID
nsv1146669 OTHER inversion 26484159
nsv953904 CNV deletion 24416366

Variation tolerance for SPATA32 Gene

Residual Variation Intolerance Score: 69.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.10; 69.08% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SPATA32 Gene

Human Gene Mutation Database (HGMD)
SPATA32
SNPedia medical, phenotypic, and genealogical associations of SNPs for
SPATA32

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SPATA32 Gene

Disorders for SPATA32 Gene

Additional Disease Information for SPATA32

No disorders were found for SPATA32 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SPATA32 Gene

Publications for SPATA32 Gene

  1. Characterization of an acrosome protein VAD1.2/AEP2 which is differentially expressed in spermatogenesis. (PMID: 18621766) Lee KF … Luk JM (Molecular human reproduction 2008) 2 3 4 58
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  4. Single nucleotide polymorphisms of matrix metalloproteinase 9 (MMP9) and tumor protein 73 (TP73) interact with Epstein-Barr virus in chronic lymphocytic leukemia: results from the European case-control study EpiLymph. (PMID: 21048031) Casabonne D … de Sanjose S (Haematologica 2011) 3 58
  5. DNA sequence of human chromosome 17 and analysis of rearrangement in the human lineage. (PMID: 16625196) Zody MC … Nusbaum C (Nature 2006) 4 58

Products for SPATA32 Gene

Sources for SPATA32 Gene

Content
Loading form....