Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SPAG8 Gene

Aliases for SPAG8 Gene

  • Sperm Associated Antigen 8 2 3 5
  • Sperm Membrane Protein BS-84 3 4
  • Sperm Membrane Protein 1 3 4
  • HSD-1 3 4
  • Testicular Tissue Protein Li 177 3
  • Sperm-Associated Antigen 8 3
  • CILD28 3
  • HSMP-1 3
  • BS-84 3
  • CT142 3
  • SPAG3 3
  • SMP-1 4
  • SMP1 3

External Ids for SPAG8 Gene

Previous GeneCards Identifiers for SPAG8 Gene

  • GC09M036120
  • GC09M035977

Summaries for SPAG8 Gene

Entrez Gene Summary for SPAG8 Gene

  • The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined. [provided by RefSeq, Jul 2012]

GeneCards Summary for SPAG8 Gene

SPAG8 (Sperm Associated Antigen 8) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include microtubule binding.

UniProtKB/Swiss-Prot for SPAG8 Gene

  • Plays a role in spermatogenesis by enhancing the binding of CREM isoform tau to its coactivator FHL5 and increasing the FHL5-regulated transcriptional activation of CREM isoform tau (By similarity). Involved in the acrosome reaction and in binding of sperm to the zona pellucida (By similarity). Plays a role in regulation of the cell cycle by controlling progression through the G2/M phase, possibly by delaying the activation of CDK1 which is required for entry into mitosis (PubMed:19548270). May play a role in fertility and microtubule formation through interaction with RANBP9 (PubMed:10500252).

Gene Wiki entry for SPAG8 Gene

Additional gene information for SPAG8 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SPAG8 Gene

Genomics for SPAG8 Gene

GeneHancer (GH) Regulatory Elements for SPAG8 Gene

Promoters and enhancers for SPAG8 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH09I035811 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 550.8 +0.2 161 1.9 HDGF PKNOX1 FOXA2 ZFP64 ARID4B SIN3A FEZF1 DMAP1 ZNF2 IRF4 SPAG8 TPM2 CD72 HINT2 ENSG00000227388
GH09I035726 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.6 +81.9 81857 8.6 YBX1 DMAP1 IRF4 YY1 SLC30A9 E2F8 ZNF143 SP3 NFYC MEF2D TLN1 CREB3 TMEM8B GBA2 ARHGEF39 TPM2 HMGB3P24 PIGO RN7SL22P ENSG00000228843
GH09I035487 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.5 +321.8 321777 5.5 PKNOX1 FOXA2 ARID4B SIN3A DMAP1 ZNF2 ZNF766 ZNF213 E2F8 ZNF143 RUSC2 LOC105376026 PIGO RGP1 FANCG ARHGEF39 TMEM8B FAM214B SPAG8 FAM166B
GH09I035813 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 11.3 -2.4 -2391 3.1 HDGF FOXA2 MLX ARID4B SIN3A FEZF1 DMAP1 ZNF2 ZBTB7B YY1 TMEM8B HINT2 HMGB3P24 RNF38 SPAG8 C9orf131 ATP8B5P VCP CREB3
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SPAG8 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SPAG8 gene promoter:

Genomic Locations for SPAG8 Gene

Genomic Locations for SPAG8 Gene
4,488 bases
Minus strand

Genomic View for SPAG8 Gene

Genes around SPAG8 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SPAG8 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SPAG8 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SPAG8 Gene

Proteins for SPAG8 Gene

  • Protein details for SPAG8 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Sperm-associated antigen 8
    Protein Accession:
    Secondary Accessions:
    • B4DY89
    • E9PDV6
    • Q12937
    • Q5TCV8
    • Q8WWB4

    Protein attributes for SPAG8 Gene

    426 amino acids
    Molecular mass:
    44819 Da
    Quaternary structure:
    • Interacts with FHL5 (via second LIM domain) (By similarity). Interacts with RANBP9 (PubMed:15014887).
    • Sequence=AAB46833.1; Type=Erroneous termination; Positions=427; Note=Translated as stop.; Evidence={ECO:0000305};

    Alternative splice isoforms for SPAG8 Gene


neXtProt entry for SPAG8 Gene

Post-translational modifications for SPAG8 Gene

No Post-translational modifications

No data available for DME Specific Peptides for SPAG8 Gene

Domains & Families for SPAG8 Gene

Gene Families for SPAG8 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for SPAG8 Gene


Suggested Antigen Peptide Sequences for SPAG8 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the SPAG8 family.
  • Belongs to the SPAG8 family.
genes like me logo Genes that share domains with SPAG8: view

Function for SPAG8 Gene

Molecular function for SPAG8 Gene

UniProtKB/Swiss-Prot Function:
Plays a role in spermatogenesis by enhancing the binding of CREM isoform tau to its coactivator FHL5 and increasing the FHL5-regulated transcriptional activation of CREM isoform tau (By similarity). Involved in the acrosome reaction and in binding of sperm to the zona pellucida (By similarity). Plays a role in regulation of the cell cycle by controlling progression through the G2/M phase, possibly by delaying the activation of CDK1 which is required for entry into mitosis (PubMed:19548270). May play a role in fertility and microtubule formation through interaction with RANBP9 (PubMed:10500252).

Phenotypes From GWAS Catalog for SPAG8 Gene

Gene Ontology (GO) - Molecular Function for SPAG8 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
GO:0005515 protein binding IPI 25416956
GO:0008017 microtubule binding IEA --
genes like me logo Genes that share ontologies with SPAG8: view

Phenotypes for SPAG8 Gene

GenomeRNAi human phenotypes for SPAG8:
genes like me logo Genes that share phenotypes with SPAG8: view

Animal Model Products

Clone Products

  • Addgene plasmids for SPAG8

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SPAG8 Gene

Localization for SPAG8 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SPAG8 Gene

Cytoplasm. Nucleus. Cytoplasmic vesicle, secretory vesicle, acrosome. Cytoplasm, cytoskeleton, microtubule organizing center. Cytoplasm, cytoskeleton, spindle. Note=In mature sperm cells, detected in the acrosomal region of the head and in the middle piece of the tail (By similarity). Localized to the nucleus and cytoplasm of spermatocytes and round spermatids while, in elongating spermatids, expressed in the cytoplasm but not in the nucleus (By similarity). During the cell cycle, localized on the microtubule-organizing center (MTOC) during prophase. In metaphase, extends along spindle microtubules. In anaphase, detected on the astral microtubules and mid-zone. In telophase, remains at the mid-zone. After cytokinesis, returns to the MTOC (PubMed:19548270). {ECO:0000250 UniProtKB:Q3V0Q6, ECO:0000269 PubMed:19548270}.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SPAG8 gene
Compartment Confidence
nucleus 4
cytoskeleton 3
cytosol 2

Gene Ontology (GO) - Cellular Components for SPAG8 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001669 acrosomal vesicle IEA --
GO:0005634 nucleus IBA --
GO:0005737 cytoplasm IBA --
GO:0005819 spindle IEA --
GO:0005856 cytoskeleton IEA --
genes like me logo Genes that share ontologies with SPAG8: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for SPAG8 Gene

Pathways & Interactions for SPAG8 Gene

SuperPathways for SPAG8 Gene

No Data Available

Gene Ontology (GO) - Biological Process for SPAG8 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007049 cell cycle IEA --
GO:0007283 spermatogenesis IEA --
GO:0007338 single fertilization IEA --
GO:0008150 biological_process ND --
GO:0030154 cell differentiation IEA --
genes like me logo Genes that share ontologies with SPAG8: view

No data available for Pathways by source and SIGNOR curated interactions for SPAG8 Gene

Drugs & Compounds for SPAG8 Gene

No Compound Related Data Available

Transcripts for SPAG8 Gene

Unigene Clusters for SPAG8 Gene

Sperm associated antigen 8:
Representative Sequences:

Clone Products

  • Addgene plasmids for SPAG8

Alternative Splicing Database (ASD) splice patterns (SP) for SPAG8 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2a · 2b · 2c ^ 3 ^ 4 ^ 5a · 5b · 5c ^ 6a · 6b ^ 7a · 7b · 7c
SP1: - - -
SP2: - -
SP3: -
SP4: -
SP5: - -

Relevant External Links for SPAG8 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SPAG8 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SPAG8 Gene

mRNA differential expression in normal tissues according to GTEx for SPAG8 Gene

This gene is overexpressed in Testis (x5.5).

NURSA nuclear receptor signaling pathways regulating expression of SPAG8 Gene:


SOURCE GeneReport for Unigene cluster for SPAG8 Gene:


mRNA Expression by UniProt/SwissProt for SPAG8 Gene:

Tissue specificity: Expressed in testis (germ cells), but not in liver, kidney, prostate and small intestine.
genes like me logo Genes that share expression patterns with SPAG8: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for SPAG8 Gene

Orthologs for SPAG8 Gene

This gene was present in the common ancestor of chordates.

Orthologs for SPAG8 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SPAG8 33 34
  • 98.27 (n)
(Canis familiaris)
Mammalia SPAG8 33 34
  • 81.36 (n)
(Rattus norvegicus)
Mammalia Spag8 33
  • 73.6 (n)
(Mus musculus)
Mammalia Spag8 33 16 34
  • 69.48 (n)
(Bos Taurus)
Mammalia SPAG8 34
  • 56 (a)
(Ornithorhynchus anatinus)
Mammalia SPAG8 34
  • 35 (a)
(Gallus gallus)
Aves SPAG8 34
  • 40 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.10155 34
  • 28 (a)
Species where no ortholog for SPAG8 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for SPAG8 Gene

Gene Tree for SPAG8 (if available)
Gene Tree for SPAG8 (if available)

Paralogs for SPAG8 Gene

No data available for Paralogs for SPAG8 Gene

Variants for SPAG8 Gene

Sequence variations from dbSNP and Humsavar for SPAG8 Gene

SNP ID Clin Chr 09 pos Variation AA Info Type
rs1057519336 pathogenic, Acromesomelic dysplasia Maroteaux type 35,808,811(-) G/A genic_downstream_transcript_variant, intron_variant
rs138254005 uncertain-significance, Acromesomelic Dysplasia, not specified 35,809,388(-) A/C downstream_transcript_variant, genic_downstream_transcript_variant, intron_variant
rs587777595 pathogenic, Epiphyseal chondrodysplasia, miura type 35,807,333(-) G/A downstream_transcript_variant
rs772856710 likely-benign, Acromesomelic dysplasia Maroteaux type, Epiphyseal chondrodysplasia, miura type 35,809,203(-) C/T genic_downstream_transcript_variant, intron_variant
rs773162332 benign, Acromesomelic Dysplasia 35,807,405(-) GCTGGGGCCGCTG/GCTG/GCTGGGGCCGCTGGGGCCGCTG downstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for SPAG8 Gene

Variant ID Type Subtype PubMed ID
nsv1125318 OTHER inversion 24896259

Variation tolerance for SPAG8 Gene

Residual Variation Intolerance Score: 71.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 11.50; 92.92% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SPAG8 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SPAG8 Gene

Disorders for SPAG8 Gene

Additional Disease Information for SPAG8

No disorders were found for SPAG8 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SPAG8 Gene

Publications for SPAG8 Gene

  1. Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1). (PMID: 10500252) Wang H … Koide SS (Biochimica et biophysica acta 1999) 2 3 4 22 58
  2. Expression and characterization of a novel human sperm membrane protein. (PMID: 8788182) Liu QY … Catterall JF (Biology of reproduction 1996) 2 3 4 22 58
  3. Regulation of the G2/M phase of the cell cycle by sperm associated antigen 8 (SPAG8) protein. (PMID: 19548270) Li R … Wang LF (Cell biochemistry and function 2009) 3 4 22 58
  4. Inhibition of mouse acrosome reaction and sperm-zona pellucida binding by anti-human sperm membrane protein 1 antibody. (PMID: 17187156) Cheng GY … Xu C (Asian journal of andrology 2007) 3 4 22 58
  5. Sperm membrane protein (hSMP-1) and RanBPM complex in the microtubule-organizing centre. (PMID: 15014887) Tang X … Wang L (Journal of molecular medicine (Berlin, Germany) 2004) 3 4 58

Products for SPAG8 Gene

  • Addgene plasmids for SPAG8

Sources for SPAG8 Gene

Loading form....