Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SNORD116-9 Gene

Subcategory (RNA class) for SNORD116-9 Gene


Quality Score for this RNA gene is


Aliases for SNORD116-9 Gene

  • Small Nucleolar RNA, C/D Box 116-9 2 3
  • HBII-85-9 3

External Ids for SNORD116-9 Gene

ORGUL Members for SNORD116-9 Gene

Previous GeneCards Identifiers for SNORD116-9 Gene

  • GC15P023239
  • GC15P023325
  • GC15U900935
  • GC15P023436
  • GC15P023576
  • GC15P023676
  • GC15P025318
  • GC15P003454
  • GC15P025074

Summaries for SNORD116-9 Gene

GeneCards Summary for SNORD116-9 Gene

SNORD116-9 (Small Nucleolar RNA, C/D Box 116-9) is an RNA Gene, and is affiliated with the snoRNA class.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SNORD116-9 Gene

Genomics for SNORD116-9 Gene

Regulatory Elements for SNORD116-9 Gene

Transcription factor binding sites by QIAGEN in the SNORD116-9 gene promoter:

Genomic Location for SNORD116-9 Gene

25,073,106 bp from pter
25,073,202 bp from pter
97 bases
Plus strand

Genomic View for SNORD116-9 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for SNORD116-9 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SNORD116-9 Gene

Proteins for SNORD116-9 Gene

Post-translational modifications for SNORD116-9 Gene

No Post-translational modifications

No data available for DME Specific Peptides for SNORD116-9 Gene

Domains & Families for SNORD116-9 Gene

Gene Families for SNORD116-9 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with SNORD116-9: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for SNORD116-9 Gene

Function for SNORD116-9 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SNORD116-9 Gene

Localization for SNORD116-9 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for SNORD116-9 Gene

Pathways & Interactions for SNORD116-9 Gene

SuperPathways for SNORD116-9 Gene

No Data Available

Interacting Proteins for SNORD116-9 Gene

Gene Ontology (GO) - Biological Process for SNORD116-9 Gene


No data available for Pathways by source and SIGNOR curated interactions for SNORD116-9 Gene

Drugs & Compounds for SNORD116-9 Gene

No Compound Related Data Available

Transcripts for SNORD116-9 Gene

mRNA/cDNA for SNORD116-9 Gene

(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for SNORD116-9 Gene

No ASD Table

Relevant External Links for SNORD116-9 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SNORD116-9 Gene

mRNA expression in normal human tissues for SNORD116-9 Gene

genes like me logo Genes that share expression patterns with SNORD116-9: view

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for SNORD116-9 Gene

Orthologs for SNORD116-9 Gene

This gene was present in the common ancestor of human and mouse.

Orthologs for SNORD116-9 Gene

Organism Taxonomy Gene Similarity Type Details
(Mus musculus)
Mammalia Gm22046 36
  • 87 (a)
Gm22047 36
  • 87 (a)
Gm22110 36
  • 88 (a)
Gm22128 36
  • 88 (a)
Gm22131 36
  • 87 (a)
Gm22173 36
  • 86 (a)
Gm22188 36
  • 87 (a)
Gm22258 36
  • 89 (a)
Gm22285 36
  • 88 (a)
Gm22289 36
  • 86 (a)
Gm22417 36
  • 88 (a)
Gm22584 36
  • 89 (a)
Gm22631 36
  • 87 (a)
Gm22776 36
  • 86 (a)
Gm22812 36
  • 88 (a)
Gm22851 36
  • 85 (a)
Gm22863 36
  • 88 (a)
Gm22941 36
  • 89 (a)
Gm23047 36
  • 85 (a)
Gm23089 36
  • 87 (a)
Gm23141 36
  • 86 (a)
Gm23265 36
  • 88 (a)
Gm23313 36
  • 87 (a)
Gm23357 36
  • 88 (a)
Gm23359 36
  • 88 (a)
Gm23446 36
  • 87 (a)
Gm23524 36
  • 88 (a)
Gm23549 36
  • 88 (a)
Gm23619 36
  • 87 (a)
Gm23696 36
  • 88 (a)
Gm23724 36
  • 88 (a)
Gm23767 36
  • 87 (a)
Gm23862 36
  • 87 (a)
Gm23953 36
  • 88 (a)
Gm24153 36
  • 88 (a)
Gm24264 36
  • 87 (a)
Gm24518 36
  • 86 (a)
Gm24609 36
  • 88 (a)
Gm24618 36
  • 88 (a)
Gm24658 36
  • 88 (a)
Gm24711 36
  • 87 (a)
Gm24742 36
  • 88 (a)
Gm24760 36
  • 88 (a)
Gm25074 36
  • 87 (a)
Gm25155 36
  • 88 (a)
Gm25157 36
  • 89 (a)
Gm25210 36
  • 87 (a)
Gm25350 36
  • 88 (a)
Gm25471 36
  • 87 (a)
Gm25474 36
  • 87 (a)
Gm25597 36
  • 88 (a)
Gm25615 36
  • 87 (a)
Gm25816 36
  • 88 (a)
Gm25944 36
  • 87 (a)
Gm26032 36
  • 87 (a)
Gm26094 36
  • 88 (a)
Gm26097 36
  • 90 (a)
Gm26136 36
  • 88 (a)
Gm26188 36
  • 87 (a)
Gm26201 36
  • 88 (a)
Gm26223 36
  • 88 (a)
Gm26246 36
  • 88 (a)
Gm26270 36
  • 88 (a)
Gm26332 36
  • 88 (a)
Gm26433 36
  • 88 (a)
Gm26502 36
  • 87 (a)
Gm26504 36
  • 87 (a)
Snord116l1 36
  • 88 (a)
Snord116l2 36
  • 88 (a)
(Pan troglodytes)
Mammalia SNORD116 36
  • 100 (a)
Species with no ortholog for SNORD116-9:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for SNORD116-9 Gene

Gene Tree for SNORD116-9 (if available)
Gene Tree for SNORD116-9 (if available)

Paralogs for SNORD116-9 Gene

No data available for Paralogs for SNORD116-9 Gene

Variants for SNORD116-9 Gene

Sequence variations from dbSNP and Humsavar for SNORD116-9 Gene

SNP ID Clin Chr 15 pos Sequence Context AA Info Type MAF
rs781225582 -- 25,071,600(+) GATGC(C/T)TCCGT upstream-variant-2KB
rs778871722 -- 25,071,563(+) TCCCA(A/G)TGGCA upstream-variant-2KB
rs533902200 -- 25,071,717(+) GCCAT(A/G)CCACA upstream-variant-2KB
rs533613526 -- 25,071,631(+) TTCAA(A/G)TGCTG upstream-variant-2KB
rs386782148 -- 25,071,575(+) TGCCA(CAGAGAATCTTTTGACTTGGGATGCCTCCGTGCC/TG)ACTGT upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for SNORD116-9 Gene

Variant ID Type Subtype PubMed ID
esv29021 CNV Gain+Loss 19812545

Relevant External Links for SNORD116-9 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for SNORD116-9 Gene

Disorders for SNORD116-9 Gene

Relevant External Links for SNORD116-9

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with SNORD116-9: view

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SNORD116-9 Gene

Publications for SNORD116-9 Gene

  1. The IC-SNURF-SNRPN transcript serves as a host for multiple small nucleolar RNA species and as an antisense RNA for UBE3A. (PMID: 11726556) Runte M. … Buiting K. (Hum. Mol. Genet. 2001) 2 67
  2. Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization. (PMID: 11106375) CavaillAc J. … HA1ttenhofer A. (Proc. Natl. Acad. Sci. U.S.A. 2000) 2 67
  3. Eukaryotic snoRNAs: a paradigm for gene expression flexibility. (PMID: 19446021) Dieci G. … Montanini B. (Genomics 2009) 67

Products for SNORD116-9 Gene

Sources for SNORD116-9 Gene

Back to Top
