Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SMG1P7 Gene

Aliases for SMG1P7 Gene

  • SMG1P7, Nonsense Mediated MRNA Decay Associated PI3K Related Kinase Pseudogene 7 2 3 5
  • SMG1 Pseudogene 7 2

External Ids for SMG1P7 Gene

Previous GeneCards Identifiers for SMG1P7 Gene

  • GC16M070260

Summaries for SMG1P7 Gene

GeneCards Summary for SMG1P7 Gene

SMG1P7 (SMG1P7, Nonsense Mediated MRNA Decay Associated PI3K Related Kinase Pseudogene 7) is a Pseudogene.

Additional gene information for SMG1P7 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SMG1P7 Gene

Genomics for SMG1P7 Gene

Regulatory Elements for SMG1P7 Gene

Enhancers for SMG1P7 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH16H070287 1.4 ENCODE dbSUPER 35.9 -42.8 -42849 4.1 PKNOX1 FOXA2 ARID4B SIN3A FEZF1 DMAP1 ZNF2 YY1 ZNF766 FOS PDPR DDX19A DDX19B SMG1P7 LOC400541 NFAT5 SF3B3 NONOP1 PDXDC2P-NPIPB14P COG4
GH16H070436 1.4 ENCODE dbSUPER 26.7 -191.5 -191531 3.9 HDGF PKNOX1 ARNT ARID4B SIN3A FEZF1 ZNF2 ZBTB7B YY1 SLC30A9 SMG1P7 DDX19B COG4 CLEC18A PDXDC2P-NPIPB14P SF3B3 NFAT5 NONOP1 FUK PDXDC2P
GH16H070453 1.3 ENCODE dbSUPER 24.6 -208.5 -208506 3.3 HDGF MLX ZFP64 ARID4B SIN3A DMAP1 ZBTB7B YY1 SLC30A9 ZNF766 SMG1P7 COG4 LOC100506083 PDXDC2P-NPIPB14P NPIPB14P FUK
GH16H070414 1.9 FANTOM5 Ensembl ENCODE dbSUPER 9.6 -172.6 -172646 10.3 HDGF PKNOX1 ATF1 ARNT ARID4B TCF12 ZNF121 ZNF766 GATA2 ATF7 FUK COG4 RPS27P26 RNU6-23P LOC100506083 AARS DDX19B SMG1P7 PDXDC2P-NPIPB14P WWP2
GH16H070425 0.7 Ensembl dbSUPER 26 -179.4 -179391 0.4 ZBTB33 RELA ZNF592 SMG1P7 COG4 PDXDC2P-NPIPB14P PIR61296 LOC105371329
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around SMG1P7 on UCSC Golden Path with GeneCards custom track

Genomic Locations for SMG1P7 Gene

Genomic Locations for SMG1P7 Gene
chr16:70,219,574-70,246,610
(GRCh38/hg38)
Size:
27,037 bases
Orientation:
Minus strand
chr16:70,253,477-70,279,519
(GRCh37/hg19)

Genomic View for SMG1P7 Gene

Genes around SMG1P7 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SMG1P7 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SMG1P7 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SMG1P7 Gene

Proteins for SMG1P7 Gene

Post-translational modifications for SMG1P7 Gene

No Post-translational modifications

No data available for DME Specific Peptides for SMG1P7 Gene

Domains & Families for SMG1P7 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for SMG1P7 Gene

Function for SMG1P7 Gene

Phenotypes From GWAS Catalog for SMG1P7 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SMG1P7 Gene

Localization for SMG1P7 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for SMG1P7 Gene

Pathways & Interactions for SMG1P7 Gene

SuperPathways for SMG1P7 Gene

No Data Available

Interacting Proteins for SMG1P7 Gene

Gene Ontology (GO) - Biological Process for SMG1P7 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for SMG1P7 Gene

Drugs & Compounds for SMG1P7 Gene

No Compound Related Data Available

Transcripts for SMG1P7 Gene

mRNA/cDNA for SMG1P7 Gene

(4) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for SMG1P7 Gene

No ASD Table

Relevant External Links for SMG1P7 Gene

GeneLoc Exon Structure for
SMG1P7
ECgene alternative splicing isoforms for
SMG1P7

Expression for SMG1P7 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SMG1P7 Gene

mRNA differential expression in normal tissues according to GTEx for SMG1P7 Gene

This gene is overexpressed in Brain - Cerebellum (x4.2) and Brain - Cerebellar Hemisphere (x4.1).

NURSA nuclear receptor signaling pathways regulating expression of SMG1P7 Gene:

SMG1P7
genes like me logo Genes that share expression patterns with SMG1P7: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for SMG1P7 Gene

Orthologs for SMG1P7 Gene

Evolution for SMG1P7 Gene

ENSEMBL:
Gene Tree for SMG1P7 (if available)
TreeFam:
Gene Tree for SMG1P7 (if available)

No data available for Orthologs for SMG1P7 Gene

Paralogs for SMG1P7 Gene

No data available for Paralogs for SMG1P7 Gene

Variants for SMG1P7 Gene

Sequence variations from dbSNP and Humsavar for SMG1P7 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs1000459457 -- 70,220,676(+) AGTAA(C/T)GACCA intron-variant
rs1000511505 -- 70,220,437(+) AAATT(A/T)ACGTA intron-variant
rs1000719620 -- 70,226,044(+) GTGTC(-/T)TCCCT downstream-variant-500B, upstream-variant-2KB
rs1001070242 -- 70,226,592(+) TTATA(C/T)AAATA upstream-variant-2KB, utr-variant-3-prime
rs1001172158 -- 70,225,432(+) GGCAT(-/GAGAGGGAGACCGTGGAAAGAGAGG)GAGAG nc-transcript-variant

Structural Variations from Database of Genomic Variants (DGV) for SMG1P7 Gene

Variant ID Type Subtype PubMed ID
nsv978165 CNV duplication 23825009
nsv959934 CNV duplication 23825009
nsv833271 CNV gain+loss 17160897
nsv820087 CNV loss 19587683
nsv7285 OTHER inversion 18451855
nsv572916 CNV loss 21841781
nsv471695 CNV loss 15918152
nsv469646 CNV gain 16826518
nsv428328 CNV gain+loss 18775914
nsv1853 CNV deletion 18451855
nsv1061286 CNV gain 25217958
esv3638950 CNV gain 21293372
esv33745 CNV gain+loss 17666407
esv2762188 CNV gain+loss 21179565
esv2758652 CNV gain+loss 17122850
esv25519 CNV gain+loss 19812545
dgv851e212 CNV loss 25503493
dgv849e212 CNV gain 25503493
dgv3013n100 CNV gain 25217958
dgv3012n100 CNV loss 25217958
dgv3006n100 CNV loss 25217958

Relevant External Links for SMG1P7 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
SMG1P7

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for SMG1P7 Gene

Disorders for SMG1P7 Gene

Relevant External Links for SMG1P7

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
SMG1P7

No disorders were found for SMG1P7 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SMG1P7 Gene

Publications for SMG1P7 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 60

Products for SMG1P7 Gene

Sources for SMG1P7 Gene

Content
Loading form....