Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SMG1P7 Gene

Aliases for SMG1P7 Gene

  • SMG1P7, Nonsense Mediated MRNA Decay Associated PI3K Related Kinase Pseudogene 7 2 3 5
  • SMG1 Pseudogene 7 2

External Ids for SMG1P7 Gene

Previous GeneCards Identifiers for SMG1P7 Gene

  • GC16M070260

Summaries for SMG1P7 Gene

GeneCards Summary for SMG1P7 Gene

SMG1P7 (SMG1P7, Nonsense Mediated MRNA Decay Associated PI3K Related Kinase Pseudogene 7) is a Pseudogene.

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SMG1P7 Gene

Genomics for SMG1P7 Gene

Regulatory Elements for SMG1P7 Gene

Enhancers for SMG1P7 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH16G070425 0.8 Ensembl dbSUPER 26 -179.4 -179391 0.4 ZBTB33 PRDM10 RELA ZNF592 SMG1P7 COG4 PDXDC2P-NPIPB14P PIR61296 LOC105371329
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around SMG1P7 on UCSC Golden Path with GeneCards custom track

Genomic Location for SMG1P7 Gene

70,219,574 bp from pter
70,246,610 bp from pter
27,037 bases
Minus strand

Genomic View for SMG1P7 Gene

Genes around SMG1P7 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SMG1P7 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SMG1P7 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SMG1P7 Gene

Proteins for SMG1P7 Gene

Post-translational modifications for SMG1P7 Gene

No Post-translational modifications

No data available for DME Specific Peptides for SMG1P7 Gene

Domains & Families for SMG1P7 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for SMG1P7 Gene

Function for SMG1P7 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SMG1P7 Gene

Localization for SMG1P7 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for SMG1P7 Gene

Pathways & Interactions for SMG1P7 Gene

SuperPathways for SMG1P7 Gene

No Data Available

Interacting Proteins for SMG1P7 Gene

Gene Ontology (GO) - Biological Process for SMG1P7 Gene


No data available for Pathways by source and SIGNOR curated interactions for SMG1P7 Gene

Transcripts for SMG1P7 Gene

mRNA/cDNA for SMG1P7 Gene

(4) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for SMG1P7 Gene

No ASD Table

Relevant External Links for SMG1P7 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SMG1P7 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SMG1P7 Gene

mRNA differential expression in normal tissues according to GTEx for SMG1P7 Gene

This gene is overexpressed in Brain - Cerebellum (x4.2) and Brain - Cerebellar Hemisphere (x4.1).

NURSA nuclear receptor signaling pathways regulating expression of SMG1P7 Gene:

genes like me logo Genes that share expression patterns with SMG1P7: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for SMG1P7 Gene

Orthologs for SMG1P7 Gene

Evolution for SMG1P7 Gene

Gene Tree for SMG1P7 (if available)
Gene Tree for SMG1P7 (if available)

No data available for Orthologs for SMG1P7 Gene

Paralogs for SMG1P7 Gene

No data available for Paralogs for SMG1P7 Gene

Variants for SMG1P7 Gene

Sequence variations from dbSNP and Humsavar for SMG1P7 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs1000459457 -- 70,220,676(+) AGTAA(C/T)GACCA intron-variant
rs1000511505 -- 70,220,437(+) AAATT(A/T)ACGTA intron-variant
rs1000719620 -- 70,226,044(+) GTGTC(-/T)TCCCT downstream-variant-500B, upstream-variant-2KB
rs1001070242 -- 70,226,592(+) TTATA(C/T)AAATA upstream-variant-2KB, utr-variant-3-prime
rs1001172158 -- 70,225,432(+) GGCAT(-/GAGAGGGAGACCGTGGAAAGAGAGG)GAGAG nc-transcript-variant

Structural Variations from Database of Genomic Variants (DGV) for SMG1P7 Gene

Variant ID Type Subtype PubMed ID
dgv3006n100 CNV loss 25217958
dgv3012n100 CNV loss 25217958
dgv3013n100 CNV gain 25217958
dgv849e212 CNV gain 25503493
dgv851e212 CNV loss 25503493
esv25519 CNV gain+loss 19812545
esv2758652 CNV gain+loss 17122850
esv2762188 CNV gain+loss 21179565
esv33745 CNV gain+loss 17666407
esv3638950 CNV gain 21293372
nsv1061286 CNV gain 25217958
nsv1853 CNV deletion 18451855
nsv428328 CNV gain+loss 18775914
nsv469646 CNV gain 16826518
nsv471695 CNV loss 15918152
nsv572916 CNV loss 21841781
nsv7285 OTHER inversion 18451855
nsv820087 CNV loss 19587683
nsv833271 CNV gain+loss 17160897
nsv959934 CNV duplication 23825009
nsv978165 CNV duplication 23825009

Relevant External Links for SMG1P7 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for SMG1P7 Gene

Disorders for SMG1P7 Gene

Relevant External Links for SMG1P7

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for SMG1P7 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SMG1P7 Gene

Publications for SMG1P7 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 64

Products for SMG1P7 Gene

Sources for SMG1P7 Gene

Loading form....