Free for academic non-profit institutions. Other users need a Commercial license

SMARCD2 Gene(Protein Coding)

SWI/SNF Related, Matrix Associated, Actin Dependent Regulator Of Chromatin, Subfamily D, Member 2


Aliases for SMARCD2 Gene

Aliases for SMARCD2 Gene

  • SWI/SNF Related, Matrix Associated, Actin Dependent Regulator Of Chromatin, Subfamily D, Member 2 2 3 5
  • Mammalian Chromatin Remodeling Complex BRG1-Associated Factor 60B 2 3
  • 60 KDa BRG-1/Brm-Associated Factor Subunit B 3 4
  • Chromatin Remodeling Complex BAF60B Subunit 2 3
  • SWI/SNF Complex 60 KDa Subunit B 2 3
  • BRG1-Associated Factor 60B 3 4
  • Swp73-Like Protein 2 3
  • BAF60B 3 4
  • SWI/SNF-Related Matrix-Associated Actin-Dependent Regulator Of Chromatin Subfamily D Member 2 3
  • PRO2451 3
  • CRACD2 3
  • Rsc6p 3

External Ids for SMARCD2 Gene

Previous GeneCards Identifiers for SMARCD2 Gene

  • GC17M061559
  • GC17M064335
  • GC17M062250
  • GC17M062382
  • GC17M059263
  • GC17M061909
  • GC17M057277

Summaries for SMARCD2 Gene

Entrez Gene Summary for SMARCD2 Gene

  • The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

GeneCards Summary for SMARCD2 Gene

SMARCD2 (SWI/SNF Related, Matrix Associated, Actin Dependent Regulator Of Chromatin, Subfamily D, Member 2) is a Protein Coding gene. Diseases associated with SMARCD2 include Specific Granule Deficiency. Among its related pathways are PEDF Induced Signaling and Transcription Ligand-dependent activation of the ESR1/SP pathway. GO annotations related to this gene include transcription coactivator activity and RNA polymerase II distal enhancer sequence-specific DNA binding. An important paralog of this gene is SMARCD1.

UniProtKB/Swiss-Prot for SMARCD2 Gene

  • Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology).

Gene Wiki entry for SMARCD2 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SMARCD2 Gene

Genomics for SMARCD2 Gene

Regulatory Elements for SMARCD2 Gene

Enhancers for SMARCD2 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH17G063760 1.4 Ensembl ENCODE dbSUPER 10.9 +81.3 81338 1.5 ZNF493 ZFP64 NFXL1 ZNF155 ZNF121 ZNF366 ZNF138 EGR1 ZNF302 ZNF354C CEP95 DDX42 DDX5 POLG2 FTSJ3 PSMC5 LIMD2 SMARCD2 GC17P063754
GH17G063664 1.1 Ensembl ENCODE dbSUPER 10.5 +177.4 177396 1.8 MAX NFXL1 RAD21 NR2F2 ETV6 HES1 BCLAF1 SPI1 LIMD2 TACO1 STRADA ENSG00000125695 SMARCD2 PSMC5 EEF1DP7 LOC101927898
GH17G063816 0.6 ENCODE 11.5 +26.3 26340 1.4 PAF1 MAFF ZNF316 MAFG NFXL1 EMSY BCLAF1 MAFK FTSJ3 CSH2 SMARCD2 PSMC5 PIR56411
GH17G063679 0.6 dbSUPER 10.5 +162.8 162753 1.0 JUNB NFXL1 ARID3A NONO ZNF316 MLLT1 ETV6 BCLAF1 MAFK EMSY PSMC5 FTSJ3 SMARCD2 TACO1 LOC101927898 EEF1DP7
GH17G063757 0.5 dbSUPER 10.9 +85.3 85292 0.7 NONO NFXL1 BCLAF1 FTSJ3 LIMD2 SMARCD2 GC17P063754 DDX42
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around SMARCD2 on UCSC Golden Path with GeneCards custom track

Promoters for SMARCD2 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000096846 365 2201 CREB3L1 ZFP64 FEZF1 DMAP1 YY1 SLC30A9 ZNF143 ZNF548 ZNF263 SP3

Genomic Location for SMARCD2 Gene

63,832,081 bp from pter
63,843,065 bp from pter
10,985 bases
Minus strand

Genomic View for SMARCD2 Gene

Genes around SMARCD2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SMARCD2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SMARCD2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SMARCD2 Gene

Proteins for SMARCD2 Gene

  • Protein details for SMARCD2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily D member 2
    Protein Accession:
    Secondary Accessions:
    • A5PLL5
    • A6NNQ7
    • B4DV56
    • B4E1R6
    • Q7L2I6
    • Q9UHZ1

    Protein attributes for SMARCD2 Gene

    531 amino acids
    Molecular mass:
    58921 Da
    Quaternary structure:
    • Component of the BAF complex, which includes at least actin (ACTB), ARID1A, ARID1B/BAF250, SMARCA2, SMARCA4/BRG1, ACTL6A/BAF53, ACTL6B/BAF53B, SMARCE1/BAF57, SMARCC1/BAF155, SMARCC2/BAF170, SMARCB1/SNF5/INI1, and one or more of SMARCD1/BAF60A, SMARCD2/BAF60B, or SMARCD3/BAF60C. In muscle cells, the BAF complex also contains DPF3. May interact with SMARCA4, the catalytic subunit of the SWI/SNF related nucleosome-remodeling complexes BRG1(I) and BRG1(II). The precise distribution of the related SMARCD1, SMARCD2 and SMARCD3 proteins among these and other SWI/SNF nucleosome-remodeling complexes is not fully known. Interacts with UNKL.
    • Sequence=AAC50696.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=AAF20280.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};

    Alternative splice isoforms for SMARCD2 Gene


neXtProt entry for SMARCD2 Gene

Post-translational modifications for SMARCD2 Gene

  • Ubiquitinated through a signaling process involving RAC1 and the RING finger protein UNKL.
  • Ubiquitination at isoforms=2, 3168, Lys226, Lys262, isoforms=2, 3289, isoforms=2, 3451, Lys480, and isoforms=2, 3514
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for SMARCD2 Gene

Domains & Families for SMARCD2 Gene

Protein Domains for SMARCD2 Gene

Suggested Antigen Peptide Sequences for SMARCD2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the SMARCD family.
  • Belongs to the SMARCD family.
genes like me logo Genes that share domains with SMARCD2: view

No data available for Gene Families for SMARCD2 Gene

Function for SMARCD2 Gene

Molecular function for SMARCD2 Gene

GENATLAS Biochemistry:
general transcriptional activator S cerevisiae SWI/SNF related protein,matrix associated,actin-dependent regulator of chromatin,subfamily D,member 2,component of the chromatin remodeling complex,preferentially expressed in muscle and pancreas
UniProtKB/Swiss-Prot Function:
Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology).

Gene Ontology (GO) - Molecular Function for SMARCD2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000978 contributes_to RNA polymerase II core promoter proximal region sequence-specific DNA binding IDA 16217013
GO:0000980 contributes_to RNA polymerase II distal enhancer sequence-specific DNA binding IDA 16217013
GO:0003713 transcription coactivator activity NAS 8804307
GO:0005515 protein binding IPI 20148946
GO:0031492 contributes_to nucleosomal DNA binding IDA 16217013
genes like me logo Genes that share ontologies with SMARCD2: view
genes like me logo Genes that share phenotypes with SMARCD2: view

Animal Models for SMARCD2 Gene

MGI Knock Outs for SMARCD2:

Animal Model Products

CRISPR Products

miRNA for SMARCD2 Gene

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for SMARCD2 Gene

Localization for SMARCD2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SMARCD2 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SMARCD2 gene
Compartment Confidence
nucleus 5
cytosol 2
mitochondrion 1
golgi apparatus 1

Gene Ontology (GO) - Cellular Components for SMARCD2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000790 nuclear chromatin IDA 16217013
GO:0005634 nucleus IEA --
GO:0005654 nucleoplasm IDA --
GO:0016514 SWI/SNF complex IEA,IDA 8804307
GO:0043234 protein complex IDA 16217013
genes like me logo Genes that share ontologies with SMARCD2: view

Pathways & Interactions for SMARCD2 Gene

genes like me logo Genes that share pathways with SMARCD2: view

Gene Ontology (GO) - Biological Process for SMARCD2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006337 nucleosome disassembly IDA 8895581
GO:0006338 chromatin remodeling IDA 11726552
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006357 regulation of transcription from RNA polymerase II promoter NAS 8804307
genes like me logo Genes that share ontologies with SMARCD2: view

No data available for SIGNOR curated interactions for SMARCD2 Gene

Drugs & Compounds for SMARCD2 Gene

No Compound Related Data Available

Transcripts for SMARCD2 Gene

mRNA/cDNA for SMARCD2 Gene

(6) REFSEQ mRNAs :
(9) Additional mRNA sequences :
(7) Selected AceView cDNA sequences:
(12) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SMARCD2 Gene

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SMARCD2 Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4a · 4b ^ 5a · 5b · 5c ^ 6a · 6b · 6c ^ 7a · 7b · 7c · 7d ^ 8a · 8b ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b ^ 14
SP1: - -
SP2: -
SP3: - - - - - -
SP4: - - - -
SP5: - - - -
SP6: - - -
SP7: - -
SP8: - -
SP9: -
SP10: - - -

Relevant External Links for SMARCD2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SMARCD2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SMARCD2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for SMARCD2 Gene

This gene is overexpressed in Bone marrow mesenchymal stem cell (37.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for SMARCD2 Gene

Protein tissue co-expression partners for SMARCD2 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of SMARCD2 Gene:


SOURCE GeneReport for Unigene cluster for SMARCD2 Gene:


mRNA Expression by UniProt/SwissProt for SMARCD2 Gene:

Tissue specificity: Isoform 2 is expressed in the pancreas.

Evidence on tissue expression from TISSUES for SMARCD2 Gene

  • Intestine(4.3)
  • Liver(4.3)
  • Lung(2.4)
  • Nervous system(2.3)
genes like me logo Genes that share expression patterns with SMARCD2: view

Primer Products

No data available for mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for SMARCD2 Gene

Orthologs for SMARCD2 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for SMARCD2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SMARCD2 34 35
  • 99.69 (n)
(Canis familiaris)
Mammalia SMARCD2 34 35
  • 93.85 (n)
(Bos Taurus)
Mammalia SMARCD2 34 35
  • 93.35 (n)
(Rattus norvegicus)
Mammalia Smarcd2 34
  • 91.4 (n)
(Monodelphis domestica)
Mammalia SMARCD2 35
  • 91 (a)
(Mus musculus)
Mammalia Smarcd2 34 16 35
  • 90.96 (n)
(Gallus gallus)
Aves SMARCD2 34 35
  • 80.95 (n)
(Anolis carolinensis)
Reptilia SMARCD2 35
  • 81 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia smarcd2 34
  • 75.15 (n)
Str.1281 34
(Danio rerio)
Actinopterygii smarcd2 34 35
  • 73.73 (n)
fruit fly
(Drosophila melanogaster)
Insecta Bap60 36 35
  • 67 (a)
(Caenorhabditis elegans)
Secernentea ham-3 35
  • 51 (a)
ZK1128.5 36
  • 49 (a)
swsn-2.2 35
  • 48 (a)
C18E3.2 36
  • 47 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes RSC6 37
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 68 (a)
-- 35
  • 46 (a)
Species where no ortholog for SMARCD2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for SMARCD2 Gene

Gene Tree for SMARCD2 (if available)
Gene Tree for SMARCD2 (if available)

Paralogs for SMARCD2 Gene

Paralogs for SMARCD2 Gene

(2) SIMAP similar genes for SMARCD2 Gene using alignment to 7 proteins:

genes like me logo Genes that share paralogs with SMARCD2: view

Variants for SMARCD2 Gene

Sequence variations from dbSNP and Humsavar for SMARCD2 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs1057518731 Pathogenic 63,833,908(-) ATTAG(A/G)TAAAT splice-donor-variant
rs1057518732 Pathogenic 63,837,200(-) TACCT(-/AGGTAGAACCTTATCTGCCATCTTC)CAGCG reference, frameshift-variant
rs1057518733 Pathogenic 63,837,439(-) GGGGG(C/T)AAGAG splice-donor-variant
rs1000218054 -- 63,841,256(+) GAAGG(-/A)AAAAA intron-variant, upstream-variant-2KB
rs1000291856 -- 63,841,693(+) CAACT(C/G)TCGCA intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for SMARCD2 Gene

Variant ID Type Subtype PubMed ID
nsv510720 CNV deletion 20534489
nsv517272 CNV gain+loss 19592680
nsv833510 CNV loss 17160897

Variation tolerance for SMARCD2 Gene

Residual Variation Intolerance Score: 15.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.17; 39.32% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for SMARCD2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SMARCD2 Gene

Disorders for SMARCD2 Gene

MalaCards: The human disease database

(1) MalaCards diseases for SMARCD2 Gene - From: ClinVar

Disorder Aliases PubMed IDs
specific granule deficiency
  • neutrophil-specific granule deficiency
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for SMARCD2

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with SMARCD2: view

No data available for UniProtKB/Swiss-Prot and Genatlas for SMARCD2 Gene

Publications for SMARCD2 Gene

  1. Diversity and specialization of mammalian SWI/SNF complexes. (PMID: 8804307) Wang W. … Crabtree G.R. (Genes Dev. 1996) 2 3 4 64
  2. The SWI/SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt. (PMID: 20148946) Lores P. … Gacon G. (FEBS J. 2010) 3 4 64
  3. A probability-based approach for high-throughput protein phosphorylation analysis and site localization. (PMID: 16964243) Beausoleil S.A. … Gygi S.P. (Nat. Biotechnol. 2006) 3 4 64
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
  5. Five SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin (SMARC) genes are dispersed in the human genome. (PMID: 9693044) Ring H.Z. … Francke U. (Genomics 1998) 2 3 64

Products for SMARCD2 Gene

Sources for SMARCD2 Gene

Loading form....