Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



SLC6A2 Gene

protein-coding   GIFtS: 67
GCID: GC16P055745

Solute Carrier Family 6 (Neurotransmitter Transporter),...

(Previous names: solute carrier family 6 (neurotransmitter transporter, noradrenalin),...)
(Previous symbols: NET1, NAT1, SLC6A5)
  See SLC6A2-related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Solute Carrier Family 6 (Neurotransmitter Transporter), Member 21 2     NET2 3
NAT11 2 3 5     Neurotransmitter Transporter2
NET11 2 3 5     Sodium-Dependent Noradrenaline Transporter2
SLC6A51 2 3     Solute Carrier Family 6 Member 52
Norepinephrine Transporter1 2 3     Solute Carrier Family 6 Member 23
Solute Carrier Family 6 (Neurotransmitter Transporter, Noradrenalin),
Member 21 2
     

External Ids:    HGNC: 110481   Entrez Gene: 65302   Ensembl: ENSG000001035467   OMIM: 1639705   UniProtKB: P239753   

Export aliases for SLC6A2 gene to outside databases

Previous GC identifers: GC16M046129 GC16P055428 GC16P055469 GC16P054247 GC16P041576


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for SLC6A2 Gene:
This gene encodes a member of the sodium:neurotransmitter symporter family. This member is a multi-pass membrane
protein, which is responsible for reuptake of norepinephrine into presynaptic nerve terminals and is a regulator
of norepinephrine homeostasis. Mutations in this gene cause orthostatic intolerance, a syndrome characterized by
lightheadedness, fatigue, altered mentation and syncope. Alternatively spliced transcript variants encoding
different isoforms have been identified in this gene.(provided by RefSeq, Feb 2010)

GeneCards Summary for SLC6A2 Gene:
SLC6A2 (solute carrier family 6 (neurotransmitter transporter), member 2) is a protein-coding gene. Diseases associated with SLC6A2 include substance abuse, and generalized anxiety disorder. GO annotations related to this gene include norepinephrine:sodium symporter activity and monoamine transmembrane transporter activity. An important paralog of this gene is SLC6A6.

UniProtKB/Swiss-Prot: SC6A2_HUMAN, P23975
Function: Amine transporter. Terminates the action of noradrenaline by its high affinity sodium-dependent reuptake
into presynaptic terminals

summary for SLC6A2 Gene:
Adrenergic transporters (NET) are sodium- and chloride-dependent members of the solute carrier family 6
(SLC6) widely distributed throughout the brain within noradrenergic neuronal plasma membranes. They are
responsible for the re-uptake of adrenalin, noradrenalin and (to a lesser extent) dopamine from the synaptic
cleft back into vesicles for storage until later use, resulting in the termination of neurotransmitter
action. Adrenergic transporters contain the following structural motifs: 12-TM domains, extracellular loops,
cytoplasmic C- and N-termini and putative phosphorylation sites. A role for NETs has been proposed in
attention deficit disorder, substance abuse, neurodegenerative disorders and clinical depression.

Gene Wiki entry for SLC6A2 (Norepinephrine transporter) Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000016.9  NT_010498.16  NC_018927.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the SLC6A2 gene promoter:
         C/EBPbeta   AP-1   POU3F1   MIF-1   Nkx2-5   GATA-1   GATA-2   Arnt   COMP1   LyF-1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidSLC6A2 promoter sequence
   Search Chromatin IP Primers for SLC6A2

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat SLC6A2


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 16q12.2   Ensembl cytogenetic band:  16q12.2   HGNC cytogenetic band: 16q12.2

SLC6A2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
SLC6A2 gene location

GeneLoc information about chromosome 16         GeneLoc Exon Structure

GeneLoc location for GC16P055745:  view genomic region     (about GC identifiers)

Start:
55,689,516 bp from pter      End:
55,740,104 bp from pter
Size:
50,589 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, and/or antibodies-online,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: SC6A2_HUMAN, P23975 (See protein sequence)
Recommended Name: Sodium-dependent noradrenaline transporter  
Size: 617 amino acids; 69332 Da
Subunit: Interacts with PRKCABP
Miscellaneous: This protein is the target of psychomotor stimulants such as amphetamines or cocaine
Secondary accessions: B2R707 Q96KH8
Alternative splicing: 2 isoforms:  P23975-1   P23975-2   

Explore the universe of human proteins at neXtProt for SLC6A2: NX_P23975

Explore proteomics data for SLC6A2 at MOPED

Post-translational modifications: 

  • Glycosylation2 at Asn184, Asn192, Asn198
  • Modification sites at PhosphoSitePlus

  • See SLC6A2 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (4 alternative transcripts): 
    NP_001034.1  NP_001165972.1  NP_001165973.1  NP_001165975.1  

    ENSEMBL proteins: 
     ENSP00000457473   ENSP00000456377   ENSP00000394956   ENSP00000454603   ENSP00000369237  
     ENSP00000454439   ENSP00000456210   ENSP00000457375   ENSP00000460214   ENSP00000219833  
    Reactome Protein details: P23975

    SLC6A2 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for SLC6A2
    OriGene Custom MassSpec
    OriGene Custom Protein Services for SLC6A2
    GenScript Custom Purified and Recombinant Proteins Services for SLC6A2
    Novus Biologicals SLC6A2 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Browse Proteins at Cloud-Clone Corp.

     
    Search eBioscience for Proteins for SLC6A2 

     
    Search antibodies-online for proteins for SLC6A2 

     
    antibodies-online peptides for SLC6A2

    SLC6A2 Antibody Products:

    EMD Millipore Mono- and Polyclonal Antibodies for the study of SLC6A2
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for SLC6A2
    Novus Biologicals SLC6A2 Antibodies
    Abcam antibodies for SLC6A2
    Browse Antibodies at Cloud-Clone Corp.
    Search ThermoFisher Antibodies for SLC6A2
    antibodies-online antibodies for SLC6A2 (19 products) 

    SLC6A2 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for SLC6A2
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for SLC6A2
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp.
    Browse CLIAs at Cloud-Clone Corp.
    Search eBioscience for ELISAs for SLC6A2 
    antibodies-online kits for SLC6A2 (8 products) 


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    SLC: Solute carriers

    IUPHAR Guide to PHARMACOLOGY protein family classification: NET
    Monoamine transporter subfamily

    2 InterPro protein domains:
     IPR000175 Na/ntran_symport
     IPR002435 Na/ntran_symport_noradrenaline

    Graphical View of Domain Structure for InterPro Entry P23975

    ProtoNet protein and cluster: P23975

    1 Blocks protein domain: IPB002435 Noradrenaline neurotransmitter transporter signature

    UniProtKB/Swiss-Prot: SC6A2_HUMAN, P23975
    Similarity: Belongs to the sodium:neurotransmitter symporter (SNF) (TC 2.A.22) family. SLC6A2 subfamily


    Find genes that share domains with SLC6A2           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: SC6A2_HUMAN, P23975
    Function: Amine transporter. Terminates the action of noradrenaline by its high affinity sodium-dependent reuptake
    into presynaptic terminals

         Genatlas biochemistry entry for SLC6A2:
    solute carrier family 6,member 2,neurotransmitter transporter,noradrenalin/morepinephrine

         Gene Ontology (GO): Selected molecular function terms (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005328neurotransmitter:sodium symporter activity ----
    GO:0005333norepinephrine transmembrane transporter activity ----
    GO:0005334norepinephrine:sodium symporter activity TAS2008212
    GO:0005515protein binding IPI11343649
    GO:0008504monoamine transmembrane transporter activity IDA16024787
         
    Find genes that share ontologies with SLC6A2           About GenesLikeMe


    Phenotypes:
         4 GenomeRNAi human phenotypes for SLC6A2:
     Cell division defect  Decreased viability with cispl  Increased G2M DNA content  Increased number of mitotic ce 

         6 MGI mutant phenotypes (inferred from 2 alleles(MGI details for Slc6a2):
     behavior/neurological  cardiovascular system  growth/size/body  homeostasis/metabolism  integument 
     nervous system 

    Find genes that share phenotypes with SLC6A2           About GenesLikeMe

    Animal Models:
       genOway: Develop your customized and physiologically relevant rodent model for SLC6A2

    miRNA
    Products:
        
    miRTarBase miRNAs that target SLC6A2:
    hsa-mir-25-3p (MIRT050208), hsa-mir-26b-5p (MIRT030309)

    Block miRNA regulation of human, mouse, rat SLC6A2 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate SLC6A2 (see all 25):
    hsa-miR-579 hsa-miR-3910 hsa-miR-181c hsa-miR-197 hsa-miR-23b* hsa-miR-124 hsa-miR-9 hsa-miR-1255a
    SwitchGear 3'UTR luciferase reporter plasmidSLC6A2 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for SLC6A2
    Predesigned siRNA for gene silencing in human, mouse, rat SLC6A2

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for SLC6A2

    Clone
    Products:
         
    OriGene clones in human, mouse for SLC6A2 (see all 20)
    OriGene ORF clones in mouse, rat for SLC6A2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 4): SLC6A2 (NM_001043)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for SLC6A2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat SLC6A2
    Addgene plasmids for SLC6A2 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for SLC6A2
    Browse ESI BIO Cell Lines and PureStem Progenitors for SLC6A2 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for SLC6A2


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    SC6A2_HUMAN, P23975: Membrane; Multi-pass membrane protein
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    plasma membrane4
    extracellular2
    nucleus2
    cytosol1
    mitochondrion1
    peroxisome1

    Gene Ontology (GO): Selected cellular component terms (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005886plasma membrane TAS--
    GO:0005887integral component of plasma membrane IEA--
    GO:0009986cell surface IEA--
    GO:0016020membrane TAS2008212
    GO:0016021integral component of membrane ----

    Find genes that share ontologies with SLC6A2           About GenesLikeMe


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for SLC6A2 About    
    See pathways by source

    SuperPathContained pathways About
    1Transport of glucose and other sugars, bile salts and organic acids, metal ions and amine compounds
    SLC-mediated transmembrane transport0.47
    Transport of glucose and other sugars, bile salts and organic acids, metal ions and amine compounds0.38
    Transmembrane transport of small molecules0.47
    Na+/Cl- dependent neurotransmitter transporters0.00
    2Venlafaxine Pathway, Pharmacokinetics
    Venlafaxine Pathway, Pharmacokinetics0.67
    3Sympathetic Nerve Pathway (Neuroeffector Junction)
    Sympathetic Nerve Pathway (Neuroeffector Junction)
    4Monoamine Transport
    Monoamine Transport


    Find genes that share SuperPaths with SLC6A2           About GenesLikeMe

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    Selected Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for SLC6A2 (see all 21)
        RhoA Pathway
    Guidance Cues and Growth Cone Motility
    Molecular Mechanisms of Cancer
    Interferon Pathway
    G-AlphaI Signaling

    1 BioSystems Pathway for SLC6A2
        Monoamine Transport

    1 Reactome Pathway for SLC6A2
        Na+/Cl- dependent neurotransmitter transporters

    2 PharmGKB Pathways for SLC6A2
        Sympathetic Nerve Pathway (Neuroeffector Junction)
    Venlafaxine Pathway, Pharmacokinetics

        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for SLC6A2
    Interactions:

        GeneGlobe Interaction Network for SLC6A2

    STRING Interaction Network Preview (showing 5 interactants - click image to see 9)

    Selected Interacting proteins for SLC6A2 (P239752, 3 ENSP000003692374) via UniProtKB, MINT, STRING, and/or I2D (see all 9)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    PICK1Q9NRD52, 3, ENSP000003494654MINT-73297 MINT-73299 MINT-73295 I2D: score=2 STRING: ENSP00000349465
    PPP2R1AP301533, ENSP000003248044I2D: score=1 STRING: ENSP00000324804
    STX1AQ166233, ENSP000002228124I2D: score=2 STRING: ENSP00000222812
    LGALSLENSP000002388754STRING: ENSP00000238875
    MAGED1ENSP000003648474STRING: ENSP00000364847
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 8):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006810transport TAS2008212
    GO:0006836neurotransmitter transport ----
    GO:0007268synaptic transmission TAS2008212
    GO:0015844monoamine transport IDA16024787
    GO:0015874norepinephrine transport IEA--

    Find genes that share ontologies with SLC6A2           About GenesLikeMe



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Enzo Life Sciences drugs & compounds for SLC6A2
      Browse compounds at ApexBio 

    Compounds for SLC6A2 available from Tocris Bioscience    About this table
    CompoundAction CAS #
    Tomoxetine hydrochloride Potent, selective noradrenalin re-uptake inhibitor [82248-59-7]
    Desipramine hydrochlorideSelective inhibitor of noradrenalin transporters[58-28-6]
    Nisoxetine hydrochlorideNoradrenalin re-uptake inhibitor[57754-86-6]
    Talopram hydrochloride Potent, selective inhibitor of noradrenalin transporters [7013-41-4]
    Reboxetine mesylate Potent, selective noradrenalin uptake inhibitor; orally active [98769-84-7]

    5 HMDB Compounds for SLC6A2    About this table
    CompoundSynonyms CAS #PubMed Ids
    Bupropion(+-)-Bupropion (see all 7)34841-39-9--
    ImipramineAntideprin (see all 27)50-49-7--
    Norepinephrine(-)-(R)-Norepinephrine (see all 32)51-41-2--
    SodiumSodium (see all 2)7440-23-5--
    VenlafaxineEfectin (see all 6)93413-69-5--

    Selected DrugBank Compounds for SLC6A2 (see all 54)    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    DuloxetineDuloxetine HCl (see all 2)136434-34-9targetinhibitor15892657 15316838 12481192 16139169 16650830 11752352 17335951 9669506 18408530 15184278 2784100 20432324 14744476 19480470 16199241
    SibutramineSibutramina [Spanish] (see all 2)106650-56-0targetinhibitor10929704 19475780 16678551 12417543 11152984 15382615 15685250 11752352 18671470 15944869 17284621
    AtomoxetineTomoxetina [Spanish] (see all 4)82248-59-7target--12523874 18033153 12456942 14709944 12862507 9537821 16142049 15801334 19445548 12547466
    Dexmethylphenidate-- 40431-64-9targetinhibitor18698001 17218796 15322419 9181638 18480678 17611273 11160413 9537821 11862378 16246598
    DesipramineDemethylimipramine (see all 11)50-47-5targetinhibitor10424850 15814154 12137927 11752352 9537821 15002740 12837768
    Methylphenidated-methylphenidate HCl (see all 10)113-45-1targetinhibitor18698001 17218796 15322419 17611273 11160413 9537821 16246598
    Venlafaxine-- 93413-69-5targetinhibitor19238127 19728573 10884561 15910402 16893531 9669506 14744476
    DesvenlafaxineO-desmethylvenlafaxine (see all 2)93413-62-8targetinhibitor17673606 19919295 16675639 19086875 20944767 19698900
    Mazindol-- 22232-71-9targetinhibitor15300361 16954558 2120386 9537821 12885787 10966747
    Nortriptyline-- 72-69-5targetinhibitor11502876 8863842 17018806 11092898 9537821 14744476

    6 IUPHAR Ligands for SLC6A2 (NET)    About this table
    LigandTypeActionAffinityPubmed IDs
    [3H]mazindol
    NoneNone9.3--
    mazindol
    InhibitorInhibition8.9--
    nisoxetine
    InhibitorInhibition8.4--
    [3H]nisoxetine
    NoneNone8.4--
    nomifensine
    InhibitorInhibition8.1--
    reboxetine
    InhibitorInhibition810812041

    Selected Novoseek inferred chemical compound relationships for SLC6A2 gene (see all 101)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    norepinephrine 93.5 1314 18259012 (7), 8610762 (7), 15814154 (6), 16427744 (6) (see all 99)
    nisoxetine 89.8 16 8848002 (2), 10447954 (2), 8218295 (1), 16361258 (1) (see all 11)
    lortalamine 87.2 7 15914010 (2), 15998285 (1), 17073682 (1)
    reboxetine 85.5 24 15998285 (2), 17983754 (2), 12414883 (1), 15170818 (1) (see all 19)
    desipramine 84.6 66 15814154 (5), 17850785 (3), 10424850 (3), 8374761 (2) (see all 36)
    atomoxetine 82.6 29 16896954 (4), 19387424 (3), 17515448 (2), 17707807 (2) (see all 17)
    dopamine 82.2 299 8667208 (4), 16336224 (4), 9092590 (2), 12716261 (2) (see all 99)
    m-tyramine 78.5 2 9681456 (1), 12814837 (1)
    mibg 78.4 41 17979223 (3), 10455418 (1), 16787344 (1), 17387017 (1) (see all 24)
    6-fluorodopamine 76.4 4 11107129 (2), 10899926 (1)



    Find genes that share compounds with SLC6A2           About GenesLikeMe



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for SLC6A2 gene (4 alternative transcripts): 
    NM_001043.3  NM_001172501.1  NM_001172502.1  NM_001172504.1  

    Unigene Cluster for SLC6A2:

    Solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
    Hs.78036  [show with all ESTs]
    Unigene Representative Sequence: NM_001172501
    10 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000568943 ENST00000568529 ENST00000414754 ENST00000568655 ENST00000379906(uc002eif.3 uc002eig.3)
    ENST00000561820 ENST00000566163 ENST00000567238(uc002eii.3 uc002eij.3 uc021tip.1)
    ENST00000574918 ENST00000219833(uc021tio.1)
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat SLC6A2 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate SLC6A2 (see all 25):
    hsa-miR-579 hsa-miR-3910 hsa-miR-181c hsa-miR-197 hsa-miR-23b* hsa-miR-124 hsa-miR-9 hsa-miR-1255a
    SwitchGear 3'UTR luciferase reporter plasmidSLC6A2 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for SLC6A2
    Predesigned siRNA for gene silencing in human, mouse, rat SLC6A2
    Clone
    Products:
         
    OriGene clones in human, mouse for SLC6A2 (see all 20)
    OriGene ORF clones in mouse, rat for SLC6A2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 4): SLC6A2 (NM_001043)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for SLC6A2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat SLC6A2
    Addgene plasmids for SLC6A2 
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for SLC6A2
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat SLC6A2
      QuantiTect SYBR Green Assays in human, mouse, rat SLC6A2
      QuantiFast Probe-based Assays in human, mouse, rat SLC6A2

    Additional mRNA sequence: 

    AB022846.1 AB022847.1 AK301811.1 AK310410.1 AK312793.1 BC000563.2 BC039309.1 BC060831.1 
    M65105.1 

    12 DOTS entries:

    DT.100748456  DT.111177  DT.40281724  DT.95281015  DT.91706962  DT.100711624  DT.91745002  DT.100741072 
    DT.120668967  DT.100705791  DT.99968829  DT.91745171 

    Selected AceView cDNA sequences (see all 74):

    CB989377 BC000563 AI399889 AA610011 M65105 CB989013 NM_001043 BC060831 
    BX479214 R21410 BQ022169 BQ026494 BE313934 BF111741 BX369133 BQ022097 
    CB990905 AI765218 BC039309 AL524923 BV199237 BF445572 CD359232 BF447532 

    GeneLoc Exon Structure

    4 Alternative Splicing Database (ASD) splice patterns (SP) for SLC6A2    About this scheme

    ExUns: 1 ^ 2 ^ 3a · 3b ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b ^ 14 ^ 15 ^ 16
    SP1:                                                                                                                  
    SP2:        -     -                                                                                                   
    SP3:              -                                                                                                   
    SP4:                                                                                                  -               


    ECgene alternative splicing isoforms for SLC6A2

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    SLC6A2 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: --
    SLC6A2 Expression
    About this image


    SLC6A2 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 4) fully expand
     
     Endothelium (Cardiovascular System)
             Extraembryonic Angioblasts Extraembryonic Capillary Plexus
     
     Extraembryonic Mesoderm (Extraembryonic Tissues)
             Extraembryonic Angioblasts Extraembryonic Capillary Plexus
     
     Neural Tube (Nervous System)
             Metencephalon
     
     Brain (Nervous System)
             Cerebellum
    SLC6A2 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    SLC6A2 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.78036
        Custom PCR Arrays for SLC6A2
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for SLC6A2
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat SLC6A2
    QuantiTect SYBR Green Assays in human, mouse, rat SLC6A2
    QuantiFast Probe-based Assays in human, mouse, rat SLC6A2
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for SLC6A2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals.

    Orthologs for SLC6A2 gene from Selected species (see all 15)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Slc6a21 , 5 solute carrier family 6 (neurotransmitter transporter, more1, 5 86.6(n)1
    94.33(a)1
      8 (44.99 cM)5
    205381  NM_009209.31  NP_033235.31 
     929610475 
    chicken
    (Gallus gallus)
    Aves SLC6A21 solute carrier family 6 (neurotransmitter transporter, more 76.11(n)
    85.67(a)
      395458  NM_204716.1  NP_990047.1 
    lizard
    (Anolis carolinensis)
    Reptilia SLC6A26
    solute carrier family 6 (neurotransmitter transpor...
    76(a)
    1 ↔ 1
    LGc(2383537-2465626)
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia slc6a21 solute carrier family 6 (neurotransmitter transporter, more 71.38(n)
    79.81(a)
      100486589  XM_002939226.2  XP_002939272.2 
    zebrafish
    (Danio rerio)
    Actinopterygii LOC5657761 sodium-dependent noradrenaline transporter-like 69.72(n)
    73.37(a)
      565776  XM_689046.5  XP_694138.3 
    fruit fly
    (Drosophila melanogaster)
    Insecta DAT1 , 3 dopamine transporter3
    Dopamine transporter1
    55(a)
    (best of 10)3
    58.92(n)1
    59.1(a)1
      368491  NM_079039.31  NP_523763.21 
    worm
    (Caenorhabditis elegans)
    Secernentea mod-53
    dat-11
    dat-11 46(a)
    (best of 6)3
    53.58(n)1
    51.33(a)1
      I(3035239-3047795)3
    1763041  NM_066642.51  NP_499043.11 


    ENSEMBL Gene Tree for SLC6A2 (if available)
    TreeFam Gene Tree for SLC6A2 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for SLC6A2 gene
    SLC6A62  SLC6A112  SLC6A122  SLC6A82  SLC6A52  SLC6A142  SLC6A32  SLC6A12  
    SLC6A42  SLC6A132  SLC6A72  SLC6A92  
    Selected SIMAP similar genes for SLC6A2 using alignment to 9 protein entries:     SC6A2_HUMAN (see all proteins) (see all similar genes):
    SLC6A4    SLC6A12    SLC6A13    SLC6A3    5HTT    SLC6A5
    SLC6A1    SLC6A6    SLC6A9    SLC6A7    DAT1    SLC6A8
    SLC6A14    SLC6A11    SLC6A15    SLC6A19    DKFZp761I0921    SLC6A18

    Find genes that share paralogs with SLC6A2           About GenesLikeMe



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for SLC6A2 (see all 1198)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 16 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0100224
    Orthostatic intolerance (OI)4--see VAR_0100222 A P mis40--------
    rs1219181261,2
    Cpathogenic156745761(+) TTCTCC/G/TCCCTG 8 P A mis11NA 4552
    rs358719531,2
    C--41614733(+) AAAAA-/A/AA  
            
    TCTGA
    4 -- int11NA 2
    rs114075771,2
    C--55691028(+) ACGGGA/-AAAAA 3 -- int1 trp32Minor allele frequency- -:0.25NA CSA 4
    rs112997181,2
    C--55697997(+) ACAGG-/GTTCAG 3 -- int10--------
    rs671441221,2
    C--55721103(+) ATTTT-/TTAATCTTAACTTTACCTTGAAGTCAA/TTAATCTTAACTTTACCTTGAAGTCAATTTCACATCCAGT
    AGTCGAATTACATTTCAATAGAAATACAAACTGTGGGTTTCAAAACTGTAATTAAATCAGCTTAATGGGT
    CATCA
    8 -- int1 cds11NA 2
    rs114730831,2
    C--55727280(+) AAAAA-/A/AA  
            
    TCTGA
    4 -- int1 trp31CSA 2
    rs797426371,2
    C--55727289(+) AAAAAC/AAAATC 4 -- int11Minor allele frequency- A:0.50WA 2
    rs354345991,2
    C--55731636(+) AGAAC-/AGGACA 4 -- int12Minor allele frequency- A:0.25NA 4
    rs2017743811,2
    C--55736659(+) AAAAA-/ACTAAA 4 -- ut31 int10--------

    HapMap Linkage Disequilibrium report for SLC6A2 (55689516 - 55740104 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 10 variations for SLC6A2:    About this table    
    Variant IDTypeSubtypePubMed ID
    nsv1813CNV Insertion18451855
    nsv103423CNV Insertion16902084
    esv1621115CNV Insertion17803354
    nsv517827CNV Loss19592680
    nsv906673CNV Loss21882294
    esv8787CNV Gain19470904
    esv9043CNV Gain19470904
    nsv906674CNV Gain21882294
    nsv819933CNV Gain19587683
    dgv892e1CNV Complex17122850

    Human Gene Mutation Database (HGMD): SLC6A2
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing SLC6A2
    DNA2.0 Custom Variant and Variant Library Synthesis for SLC6A2

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 163970   
    OMIM disorders: 604715  
    UniProtKB/Swiss-Prot: SC6A2_HUMAN, P23975
  • Orthostatic intolerance (OI) [MIM:604715]: Syndrome characterized by lightheadedness, fatigue, altered
    mentation and syncope. It is associated with postural tachycardia. Plasma norepinephrine concentration is
    abnormally high. Note=The disease is caused by mutations affecting the gene represented in this entry

  • 11 diseases for SLC6A2:    
    About MalaCards
    substance abuse    generalized anxiety disorder    syncope    orthostatic intolerance
    oppositional defiant disorder    mitral valve prolapse    anxiety disorder    agoraphobia
    multiple endocrine neoplasia type 2a    attention deficit hyperactivity disorder    anorexia nervosa

    4 diseases from the University of Copenhagen DISEASES database for SLC6A2:
    Attention deficit hyperactivity disorder     Panic disorder     Neuroblastoma     Schizophrenia

    Find genes that share disorders with SLC6A2           About GenesLikeMe

    Selected Novoseek inferred disease relationships for SLC6A2 gene (see all 37)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    attention-deficit hyperactivity disorder 68.5 26 19387424 (2), 16969268 (2), 12716261 (1), 16896954 (1) (see all 15)
    mitral valve prolapse 52.6 14 12391111 (2), 11804991 (2), 12805287 (2), 14726430 (1) (see all 9)
    major depression 51 51 10512149 (4), 11927173 (4), 15118352 (4), 17353941 (4) (see all 15)
    autonomic disorder 50.7 1 12805287 (1)
    pheochromocytoma 46.4 15 17102094 (3), 16047163 (2), 19088695 (2), 12574193 (1) (see all 7)
    neuroendocrine tumors 40.4 5 15154969 (1), 17979223 (1), 18196892 (1)
    panic disorder 40 11 15722184 (4), 16785272 (1), 12401556 (1), 18629431 (1)
    mood disorders 33.4 5 11927173 (1), 11606618 (1), 17654409 (1)
    generalized anxiety disorder 29.1 1 19337457 (1)
    tachycardia 23.7 6 19808400 (2), 19698724 (1), 11458707 (1), 15946904 (1)

    Genetic Association Database (GAD): SLC6A2
    Human Genome Epidemiology (HuGE) Navigator: SLC6A2 (90 documents)

    Export disorders for SLC6A2 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for SLC6A2 gene, integrated from 10 sources (see all 647):
    (articles sorted by number of sources associating them with SLC6A2)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Norepinephrine transporter gene (NET) polymorphism in patients with type 2 diabetes. (PubMed id 17124432)1, 4, 7, 9 Ksiazek P....Buraczynska M. (amp 2006)
    2. Norepinephrine transporter gene variation modulates acute response to D-amphetamine. (PubMed id 17239355)1, 4, 7, 9 Dlugos A....de Wit H. (Biol. Psychiatry 2007)
    3. Orthostatic intolerance and tachycardia associated with norepinephrine-transporter deficiency. (PubMed id 10684912)1, 2, 4, 9 Shannon J.R.... Robertson D. (N. Engl. J. Med. 2000)
    4. Further evidence of association between amphetamine response and SLC6A2 gene variants. (PubMed id 19727679)1, 4, 7 Dlugos A.M....de Wit H. (Psychopharmacology (Berl.) 2009)
    5. Association of norepinephrine transporter gene with methylphenidate response. (PubMed id 15322419)1, 4, 7 Yang L....Faraone S.V. (J Am Acad Child Adolesc Psychiatry 2004)
    6. Expression cloning of a cocaine- and antidepressant-sensitive human noradrenaline transporter. (PubMed id 2008212)1, 2, 3 Pacholczyk T.... Amara S.G. (Nature 1991)
    7. Chronic depolarization stimulates norepinephrine transporter expression via catecholamines. (PubMed id 16573647)1, 7, 9 Habecker B.A....Woodward W.R. (J. Neurochem. 2006)
    8. Association of major depression with rare functional variants in norepinephrine transporter and serotonin1A receptor genes. (PubMed id 19105200)1, 4, 9 Haenisch B....BAPnisch H. (Am. J. Med. Genet. B Neuropsychiatr. Genet. 2009)
    9. A haplotype of the norepinephrine transporter (Net) gene Slc6a2 is associated with clinical response to atomoxetine in attention-deficit hyperactivity disorder (ADHD). (PubMed id 19387424)1, 4, 9 Ramoz N....Gorwood P. (Neuropsychopharmacology 2009)
    10. Novel and functional norepinephrine transporter protein variants identified in attention-deficit hyperactivity disorder. (PubMed id 19698724)1, 4, 9 Hahn M.K....Krueger J.J. (Neuropharmacology 2009)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 6530 HGNC: 11048 AceView: SLC6A2 Ensembl:ENSG00000103546 euGenes: HUgn6530
    ECgene: SLC6A2 H-InvDB: SLC6A2

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for SLC6A2 Pharmacogenomics, SNPs, Pathways
    GeneReviewshttp://www.ncbi.nlm.nih.gov/books/NBK1116/?term=SLC6A5[genesymbol]

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for SLC6A2 gene:
    Search GeneIP for patents involving SLC6A2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from genOway)
    About This Section

    TryGeneCards Plus

     Browse Purified and Recombinant Proteins at EMD Millipore
     Browse Small Molecules at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of SLC6A2
     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for SLC6A2  
     Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for SLC6A2  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for SLC6A2  
     OriGene qSTAR qPCR primer pairs in human, mouse for SLC6A2   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for SLC6A2   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for SLC6A2   OriGene Custom Protein Services for SLC6A2  

     
     
     Block miRNA regulation of human, mouse, rat SLC6A2 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing SLC6A2
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat SLC6A2 Predesigned siRNA for gene silencing in human, mouse, rat SLC6A2
     QuantiFast Probe-based Assays in human, mouse, rat SLC6A2 QuantiTect SYBR Green Assays in human, mouse, rat SLC6A2
     Custom PCR Arrays for SLC6A2 Search Chromatin IP Primers for SLC6A2
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat SLC6A2  GeneGlobe Interaction Network for SLC6A2
     Regulatory tfbs in SLC6A2 promoter
     GenScript Custom Purified and Recombinant Proteins Services for SLC6A2 GenScript cDNA clones with any tag delivered in your preferred vector for SLC6A2
     GenScript Custom Assay Services for SLC6A2 GenScript Custom overexpressing Cell Line Services for SLC6A2
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Tocris compounds for SLC6A2
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Drugs for SLC6A2
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     SLC6A2 antibodies
     SLC6A2 lysates
     Antibodies for SLC6A2
     See all of Abcam's Antibodies, Kits and Proteins for SLC6A2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.



     Browse ESI BIO Cell Lines and PureStem Progenitors for SLC6A2
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for SLC6A2
     SwitchGear 3'UTR luciferase reporter plasmids for SLC6A2
     SwitchGear Promoter luciferase reporter plasmids for SLC6A2
     Search ThermoFisher Antibodies for SLC6A2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat SLC6A2
     Browse compounds at ApexBio
     Addgene plasmids for SLC6A2
      Search eBioscience for proteins for SLC6A2
      Search eBioscience for elisas for SLC6A2
      eBioscience FlowRNA Probe Sets
     genOway: Develop your customized and physiologically relevant rodent model for SLC6A2
     antibodies-online antibodies for SLC6A2 (19 products)
     antibodies-online kits for SLC6A2 (8 products)
     antibodies-online peptides for SLC6A2
      Search antibodies-online for proteins for SLC6A2
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014 , 7 Oct 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      SLC6A2 gene at Home site.
    Version: 3.12.258 10 Dec 2014
    hostname: 356977-web1.xennexinc.com index build: 128 solr: 1.4