Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SLC38A7 Gene

Aliases for SLC38A7 Gene

  • Solute Carrier Family 38 Member 7 2 3 4 5
  • SNAT7 3 4
  • Putative Sodium-Coupled Neutral Amino Acid Transporter 7 3
  • Solute Carrier Family 38, Member 7 2
  • Amino Acid Transporter 3

External Ids for SLC38A7 Gene

Previous GeneCards Identifiers for SLC38A7 Gene

  • GC16M057258
  • GC16M044565

Summaries for SLC38A7 Gene

GeneCards Summary for SLC38A7 Gene

SLC38A7 (Solute Carrier Family 38 Member 7) is a Protein Coding gene. GO annotations related to this gene include L-glutamate transmembrane transporter activity and L-serine transmembrane transporter activity. An important paralog of this gene is SLC38A8.

UniProtKB/Swiss-Prot for SLC38A7 Gene

  • Mediates sodium-dependent transport of amino acids, preferentially L-glutamine.

No data available for Entrez Gene Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SLC38A7 Gene

Genomics for SLC38A7 Gene

Regulatory Elements for SLC38A7 Gene

Enhancers for SLC38A7 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around SLC38A7 on UCSC Golden Path with GeneCards custom track

Promoters for SLC38A7 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around SLC38A7 on UCSC Golden Path with GeneCards custom track

Genomic Location for SLC38A7 Gene

58,665,109 bp from pter
58,685,104 bp from pter
19,996 bases
Minus strand

Genomic View for SLC38A7 Gene

Genes around SLC38A7 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SLC38A7 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SLC38A7 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SLC38A7 Gene

Proteins for SLC38A7 Gene

  • Protein details for SLC38A7 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Putative sodium-coupled neutral amino acid transporter 7
    Protein Accession:
    Secondary Accessions:
    • Q53GJ9
    • Q9H9I5

    Protein attributes for SLC38A7 Gene

    462 amino acids
    Molecular mass:
    49966 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for SLC38A7 Gene


neXtProt entry for SLC38A7 Gene

Post-translational modifications for SLC38A7 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for SLC38A7 Gene

Domains & Families for SLC38A7 Gene

Gene Families for SLC38A7 Gene

Protein Domains for SLC38A7 Gene


Suggested Antigen Peptide Sequences for SLC38A7 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the amino acid/polyamine transporter 2 family.
  • Belongs to the amino acid/polyamine transporter 2 family.
genes like me logo Genes that share domains with SLC38A7: view

Function for SLC38A7 Gene

Molecular function for SLC38A7 Gene

UniProtKB/Swiss-Prot Function:
Mediates sodium-dependent transport of amino acids, preferentially L-glutamine.

Gene Ontology (GO) - Molecular Function for SLC38A7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005290 L-histidine transmembrane transporter activity IBA --
GO:0005313 L-glutamate transmembrane transporter activity IBA --
GO:0005515 protein binding IPI 25416956
GO:0015179 L-amino acid transmembrane transporter activity ISS --
GO:0015180 L-alanine transmembrane transporter activity IBA --
genes like me logo Genes that share ontologies with SLC38A7: view
genes like me logo Genes that share phenotypes with SLC38A7: view

Animal Model Products

  • Taconic Biosciences Mouse Models for SLC38A7

CRISPR Products

miRNA for SLC38A7 Gene

miRTarBase miRNAs that target SLC38A7

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SLC38A7 Gene

Localization for SLC38A7 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SLC38A7 Gene

Membrane; Multi-pass membrane protein. Note=In neurons, located in soma and axons. {ECO:0000250}.

Subcellular locations from

Jensen Localization Image for SLC38A7 Gene COMPARTMENTS Subcellular localization image for SLC38A7 gene
Compartment Confidence
plasma membrane 3
cytosol 2
nucleus 2

Gene Ontology (GO) - Cellular Components for SLC38A7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016021 integral component of membrane IEA --
GO:0030424 axon ISS --
GO:0043025 neuronal cell body ISS --
genes like me logo Genes that share ontologies with SLC38A7: view

Pathways & Interactions for SLC38A7 Gene

SuperPathways for SLC38A7 Gene

No Data Available

Interacting Proteins for SLC38A7 Gene

Gene Ontology (GO) - Biological Process for SLC38A7 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006814 sodium ion transport ISS --
GO:0006867 asparagine transport IBA --
GO:0006868 glutamine transport IEA --
GO:0015803 branched-chain amino acid transport IEA --
GO:0015808 L-alanine transport IBA --
genes like me logo Genes that share ontologies with SLC38A7: view

No data available for Pathways by source and SIGNOR curated interactions for SLC38A7 Gene

Drugs & Compounds for SLC38A7 Gene

No Compound Related Data Available

Transcripts for SLC38A7 Gene

Unigene Clusters for SLC38A7 Gene

Solute carrier family 38, member 7:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for SLC38A7 Gene

ExUns: 1 ^ 2a · 2b · 2c ^ 3a · 3b · 3c ^ 4a · 4b · 4c ^ 5a · 5b ^ 6 ^ 7a · 7b ^ 8a · 8b ^ 9 ^ 10a · 10b ^ 11a · 11b ^ 12a · 12b · 12c ^ 13 ^
SP1: - - - - - - - - -
SP2: - - - - - - - - - -
SP3: - - - - - - - - - - - -
SP4: - - - - - -
SP5: - - - -
SP6: - - - - - - - - - - - - -
SP7: - - - - - - - - - - - - - -
SP8: - - - -
SP9: - - - - -
SP10: - - - - - - - -
SP11: - - - - - - - - - - -
SP13: - -
SP14: - -

ExUns: 14 ^ 15 ^ 16a · 16b · 16c · 16d
SP1: -
SP2: - -
SP3: -
SP7: -
SP8: -

Relevant External Links for SLC38A7 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SLC38A7 Gene

mRNA expression in normal human tissues for SLC38A7 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for SLC38A7 Gene

This gene is overexpressed in Testis (x4.3).

Protein differential expression in normal tissues from HIPED for SLC38A7 Gene

This gene is overexpressed in Testis (23.5), Placenta (21.2), Blymphocyte (7.9), and Retina (6.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for SLC38A7 Gene

Protein tissue co-expression partners for SLC38A7 Gene

NURSA nuclear receptor signaling pathways regulating expression of SLC38A7 Gene:


SOURCE GeneReport for Unigene cluster for SLC38A7 Gene:

genes like me logo Genes that share expression patterns with SLC38A7: view

Primer Products

No data available for mRNA Expression by UniProt/SwissProt for SLC38A7 Gene

Orthologs for SLC38A7 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for SLC38A7 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia SLC38A7 34
  • 90.91 (n)
  • 93.94 (a)
SLC38A7 35
  • 94 (a)
(Canis familiaris)
Mammalia SLC38A7 34
  • 90.98 (n)
  • 94.16 (a)
SLC38A7 35
  • 94 (a)
(Mus musculus)
Mammalia Slc38a7 34
  • 89.25 (n)
  • 95.02 (a)
Slc38a7 16
Slc38a7 35
  • 93 (a)
(Pan troglodytes)
Mammalia SLC38A7 34
  • 99.71 (n)
  • 99.78 (a)
SLC38A7 35
  • 100 (a)
(Rattus norvegicus)
Mammalia Slc38a7 34
  • 88.74 (n)
  • 94.37 (a)
(Monodelphis domestica)
Mammalia SLC38A7 35
  • 84 (a)
(Ornithorhynchus anatinus)
Mammalia SLC38A7 35
  • 86 (a)
(Gallus gallus)
Aves SLC38A7 34
  • 79.52 (n)
  • 82.14 (a)
SLC38A7 35
  • 81 (a)
(Anolis carolinensis)
Reptilia SLC38A7 35
  • 77 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia slc38a7 34
  • 66.74 (n)
  • 69.87 (a)
(Danio rerio)
Actinopterygii slc38a7 34
  • 70.14 (n)
  • 72.51 (a)
wufi23b07 34
slc38a7 35
  • 69 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.5352 34
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes AVT5 35
  • 19 (a)
AVT6 35
  • 20 (a)
AVT7 35
  • 16 (a)
AVT6 37
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 41 (a)
-- 35
  • 41 (a)
Species where no ortholog for SLC38A7 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for SLC38A7 Gene

Gene Tree for SLC38A7 (if available)
Gene Tree for SLC38A7 (if available)

Paralogs for SLC38A7 Gene

Paralogs for SLC38A7 Gene

(1) SIMAP similar genes for SLC38A7 Gene using alignment to 9 proteins:

genes like me logo Genes that share paralogs with SLC38A7: view

Variants for SLC38A7 Gene

Sequence variations from dbSNP and Humsavar for SLC38A7 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
rs7193572 - 58,679,990(+) TGTCC(A/G)GACCC reference, missense
rs7191331 - 58,679,894(+) CCGCA(A/G)TGCTG reference, missense
rs3179798 -- 58,665,110(-) CTGCT(A/G)AGCCG utr-variant-3-prime
rs3784911 -- 58,669,712(+) GCTCA(C/T)GCCTG intron-variant
rs3837753 -- 58,669,769(+) aggag(-/GCCGAGGAAGGAGGATCACCTAAGGTCAGGAG)ttcga intron-variant

Structural Variations from Database of Genomic Variants (DGV) for SLC38A7 Gene

Variant ID Type Subtype PubMed ID
esv2758650 CNV loss 17122850
nsv509623 CNV insertion 20534489
nsv510686 CNV deletion 20534489
nsv511049 OTHER complex 20534489
nsv528513 CNV loss 19592680

Variation tolerance for SLC38A7 Gene

Residual Variation Intolerance Score: 37.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 7.42; 81.89% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for SLC38A7 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SLC38A7 Gene

Disorders for SLC38A7 Gene

Relevant External Links for SLC38A7

Genetic Association Database (GAD)
Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for SLC38A7 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SLC38A7 Gene

Publications for SLC38A7 Gene

  1. Common variants at ten loci influence QT interval duration in the QTGEN Study. (PMID: 19305408) Newton-Cheh C. … Stricker B.H. (Nat. Genet. 2009) 3 46 65
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 65
  3. Biological insights from 108 schizophrenia-associated genetic loci. (PMID: 25056061) (Nature 2014) 3 65
  4. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T. … Vidal M. (Cell 2014) 3 65
  5. Evolutionary origin of amino acid transporter families SLC32, SLC36 and SLC38 and physiological, pathological and therapeutic aspects. (PMID: 23506890) SchiAPth H.B. … Fredriksson R. (Mol. Aspects Med. 2013) 3 65

Products for SLC38A7 Gene

Sources for SLC38A7 Gene
