Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SLC26A4-AS1 Gene

Subcategory (RNA class) for SLC26A4-AS1 Gene


Quality Score for this RNA gene is


Aliases for SLC26A4-AS1 Gene

  • SLC26A4 Antisense RNA 1 2 3
  • SLC26A4 Antisense RNA 1 (Non-Protein Coding) 2

External Ids for SLC26A4-AS1 Gene

ORGUL Members for SLC26A4-AS1 Gene

Previous GeneCards Identifiers for SLC26A4-AS1 Gene

  • GC07M107296

Summaries for SLC26A4-AS1 Gene

GeneCards Summary for SLC26A4-AS1 Gene

SLC26A4-AS1 (SLC26A4 Antisense RNA 1) is an RNA Gene, and is affiliated with the antisense RNA class.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SLC26A4-AS1 Gene

Genomics for SLC26A4-AS1 Gene

Genomic Location for SLC26A4-AS1 Gene

107,653,976 bp from pter
107,662,151 bp from pter
8,176 bases
Minus strand

Genomic View for SLC26A4-AS1 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for SLC26A4-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SLC26A4-AS1 Gene

No data available for Regulatory Elements for SLC26A4-AS1 Gene

Proteins for SLC26A4-AS1 Gene

Post-translational modifications for SLC26A4-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for SLC26A4-AS1 Gene

Domains for SLC26A4-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for SLC26A4-AS1 Gene

Function for SLC26A4-AS1 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SLC26A4-AS1 Gene

Localization for SLC26A4-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for SLC26A4-AS1 Gene

Pathways for SLC26A4-AS1 Gene

SuperPathways for SLC26A4-AS1 Gene

No Data Available

Interacting Proteins for SLC26A4-AS1 Gene

Gene Ontology (GO) - Biological Process for SLC26A4-AS1 Gene


No data available for Pathways by source for SLC26A4-AS1 Gene

Transcripts for SLC26A4-AS1 Gene

mRNA/cDNA for SLC26A4-AS1 Gene

(6) Additional mRNA sequences :
(5) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SLC26A4-AS1 Gene

SLC26A4 antisense RNA 1:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for SLC26A4-AS1 Gene

No ASD Table

Relevant External Links for SLC26A4-AS1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SLC26A4-AS1 Gene

mRNA expression in normal human tissues for SLC26A4-AS1 Gene

mRNA differential expression in normal tissues according to GTEx for SLC26A4-AS1 Gene

This gene is overexpressed in Thyroid (20.5), Brain - Anterior cingulate cortex (BA24) (8.9), Brain - Frontal Cortex (BA9) (6.8), and Brain - Cortex (5.0).

SOURCE GeneReport for Unigene cluster for SLC26A4-AS1 Gene Hs.512611

genes like me logo Genes that share expressions with SLC26A4-AS1: view

Primer Products

  • QuantiTect SYBR Green Assays in human,mouse,rat
  • Pre-validated RT² qPCR Primer Assay in human,mouse,rat
  • QuantiFast Probe-based Assays in human,mouse,rat

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Expression partners for SLC26A4-AS1 Gene

Orthologs for SLC26A4-AS1 Gene

Evolution for SLC26A4-AS1 Gene

Gene Tree for SLC26A4-AS1 (if available)
Gene Tree for SLC26A4-AS1 (if available)

No data available for Orthologs for SLC26A4-AS1 Gene

Paralogs for SLC26A4-AS1 Gene

No data available for Paralogs for SLC26A4-AS1 Gene

Variants for SLC26A4-AS1 Gene

Sequence variations from dbSNP and Humsavar for SLC26A4-AS1 Gene

SNP ID Clin Chr 07 pos Sequence Context AA Info Type MAF
rs576660428 -- 107,657,934(+) AGGGT(A/G)TAAGC nc-transcript-variant
rs575697590 -- 107,657,899(+) TGATT(A/G)GTGTC nc-transcript-variant
rs575433694 -- 107,656,915(+) ATGTG(A/G)TTACT nc-transcript-variant
rs575396247 -- 107,656,274(+) GCACA(C/T)GCCTA downstream-variant-500B
rs573459170 -- 107,658,564(+) CATTT(-/CAAATAAGAATTCTATTAGCTTG)CAAAT nc-transcript-variant

Relevant External Links for SLC26A4-AS1 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for SLC26A4-AS1 Gene

Disorders for SLC26A4-AS1 Gene

No disorders were found for SLC26A4-AS1 Gene.

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Novoseek inferred disease relationships , Genatlas and External Links for SLC26A4-AS1 Gene

Publications for SLC26A4-AS1 Gene

  1. Shotgun sequencing of the human transcriptome with ORF expressed sequence tags. (PMID: 10737800) Dias Neto E. … Simpson A.J.G. (Proc. Natl. Acad. Sci. U.S.A. 2000) 3
  2. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 3
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3
  4. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K. … Sugano S. (Genome Res. 2006) 3

Products for SLC26A4-AS1 Gene

Sources for SLC26A4-AS1 Gene

Back to Top
