Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SLC25A29 Gene

Aliases for SLC25A29 Gene

  • Solute Carrier Family 25 Member 29 2 3 4 5
  • Solute Carrier Family 25 (Mitochondrial Carnitine/Acylcarnitine Carrier), Member 29 2 3
  • Mitochondrial Carnitine/Acylcarnitine Carrier Protein CACL 3 4
  • Mitochondrial Ornithine Transporter 3 3 4
  • C14orf69 3 4
  • ORNT3 3 4
  • Mitochondrial Basic Amino Acids Transporter 3
  • Carnitine-Acylcarnitine Translocase Like 3
  • Carnitine/Acylcarnitine Translocase-Like 4
  • Chromosome 14 Open Reading Frame 69 2
  • Solute Carrier Family 25, Member 29 2
  • CACT-Like 4
  • CACL 3

External Ids for SLC25A29 Gene

Previous HGNC Symbols for SLC25A29 Gene

  • C14orf69

Previous GeneCards Identifiers for SLC25A29 Gene

  • GC14M098749
  • GC14M098750
  • GC14M099827
  • GC14M100759
  • GC14M080938

Summaries for SLC25A29 Gene

Entrez Gene Summary for SLC25A29 Gene

  • This gene encodes a nuclear-encoded mitochondrial protein that is a member of the large family of solute carrier family 25 (SLC25) mitochondrial transporters. The members of this superfamily are involved in numerous metabolic pathways and cell functions. This gene product was previously reported to be a mitochondrial carnitine-acylcarnitine-like (CACL) translocase (PMID:128829710) or an ornithine transporter (designated ORNT3, PMID:19287344), however, a recent study characterized the main role of this protein as a mitochondrial transporter of basic amino acids, with a preference for arginine and lysine (PMID:24652292). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]

GeneCards Summary for SLC25A29 Gene

SLC25A29 (Solute Carrier Family 25 Member 29) is a Protein Coding gene. Diseases associated with SLC25A29 include Hyperornithinemia-Hyperammonemia-Homocitrullinuria Syndrome. Gene Ontology (GO) annotations related to this gene include acyl carnitine transmembrane transporter activity. An important paralog of this gene is SLC25A45.

UniProtKB/Swiss-Prot for SLC25A29 Gene

  • Transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine (PubMed:24652292). Can restore ornithine transport in cells lacking the primary mitochondrial ornithine transporter SLC25A15 (PubMed:19287344). Does not transport carnitine nor acylcarnitines (PubMed:24652292). Functions by both counter-exchange and uniport mechanisms (PubMed:24652292).

Additional gene information for SLC25A29 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SLC25A29 Gene

Genomics for SLC25A29 Gene

GeneHancer (GH) Regulatory Elements for SLC25A29 Gene

Promoters and enhancers for SLC25A29 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH14I100304 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 570.2 +0.4 441 3.6 SIN3A ZBTB7B ZNF48 GLIS2 ZNF213 ELK1 ZNF207 ZNF143 SP3 SP5 SLC25A29 GC14P100308 MIR345 CCNK YY1 MEG3 ENSG00000259052
GH14I100308 Enhancer 0.9 ENCODE dbSUPER 550.8 -1.7 -1742 0.2 SMARCE1 CTCF PKNOX1 ZNF687 L3MBTL2 MAX SIN3A DPF2 MNT RAD21 GC14P100308 MIR345 SLC25A29 RN7SL523P
GH14I100295 Promoter/Enhancer 0.7 EPDnew dbSUPER 550.4 +10.7 10708 0.1 SLC25A29 ENSG00000259052
GH14I100371 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 15.5 -68.4 -68358 6.5 CLOCK MLX DMAP1 IRF4 YY1 E2F8 ZNF143 ZNF548 SP3 NFYC WARS WDR25 SLC25A29 CCNK MEG9 YY1 GC14P100385
GH14I100296 Enhancer 1.1 Ensembl ENCODE dbSUPER 18.7 +9.1 9124 2.8 HDGF PKNOX1 ZNF449 MAX ZMYM3 EBF1 ZNF121 ZFHX2 FOXK2 POLR2A SLC25A29 EVL ENSG00000259052
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SLC25A29 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SLC25A29 gene promoter:

Genomic Locations for SLC25A29 Gene

Genomic Locations for SLC25A29 Gene
27,371 bases
Minus strand

Genomic View for SLC25A29 Gene

Genes around SLC25A29 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SLC25A29 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SLC25A29 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SLC25A29 Gene

Proteins for SLC25A29 Gene

  • Protein details for SLC25A29 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Mitochondrial basic amino acids transporter
    Protein Accession:
    Secondary Accessions:
    • A3KMR5
    • Q541V0

    Protein attributes for SLC25A29 Gene

    303 amino acids
    Molecular mass:
    32062 Da
    Quaternary structure:
    No Data Available
    • Sequence=CAD62317.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Alternative splice isoforms for SLC25A29 Gene


neXtProt entry for SLC25A29 Gene

Post-translational modifications for SLC25A29 Gene

No Post-translational modifications

No data available for DME Specific Peptides for SLC25A29 Gene

Domains & Families for SLC25A29 Gene

Gene Families for SLC25A29 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Transporters

Protein Domains for SLC25A29 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the mitochondrial carrier (TC 2.A.29) family.
  • Belongs to the mitochondrial carrier (TC 2.A.29) family.
genes like me logo Genes that share domains with SLC25A29: view

Function for SLC25A29 Gene

Molecular function for SLC25A29 Gene

UniProtKB/Swiss-Prot Function:
Transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine (PubMed:24652292). Can restore ornithine transport in cells lacking the primary mitochondrial ornithine transporter SLC25A15 (PubMed:19287344). Does not transport carnitine nor acylcarnitines (PubMed:24652292). Functions by both counter-exchange and uniport mechanisms (PubMed:24652292).

Phenotypes From GWAS Catalog for SLC25A29 Gene

Gene Ontology (GO) - Molecular Function for SLC25A29 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005289 high-affinity arginine transmembrane transporter activity IDA 24652292
GO:0005292 high-affinity lysine transmembrane transporter activity IDA 24652292
GO:0015171 amino acid transmembrane transporter activity IBA --
GO:0015174 basic amino acid transmembrane transporter activity TAS --
GO:0015227 NOT acyl carnitine transmembrane transporter activity IBA,IDA 24652292
genes like me logo Genes that share ontologies with SLC25A29: view
genes like me logo Genes that share phenotypes with SLC25A29: view

Animal Model Products

miRNA for SLC25A29 Gene

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SLC25A29 Gene

Localization for SLC25A29 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SLC25A29 Gene

Mitochondrion inner membrane; Multi-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SLC25A29 gene
Compartment Confidence
mitochondrion 5
extracellular 2
peroxisome 1
endoplasmic reticulum 1
cytosol 1
lysosome 1

Gene Ontology (GO) - Cellular Components for SLC25A29 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IDA,IEA 19287344
GO:0005743 mitochondrial inner membrane TAS --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA,IBA --
genes like me logo Genes that share ontologies with SLC25A29: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for SLC25A29 Gene

Pathways & Interactions for SLC25A29 Gene

SuperPathways for SLC25A29 Gene

No Data Available

Interacting Proteins for SLC25A29 Gene

Gene Ontology (GO) - Biological Process for SLC25A29 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006810 transport IEA --
GO:0006839 mitochondrial transport IBA --
GO:0006844 acyl carnitine transport IEA --
GO:0006865 amino acid transport TAS,IBA --
GO:0015822 ornithine transport IDA 24652292
genes like me logo Genes that share ontologies with SLC25A29: view

No data available for Pathways by source and SIGNOR curated interactions for SLC25A29 Gene

Drugs & Compounds for SLC25A29 Gene

(2) Drugs for SLC25A29 Gene - From: DrugBank, DGIdb, and HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
L-Carnitine Approved, Investigational Pharma Target 0
genes like me logo Genes that share compounds with SLC25A29: view

Transcripts for SLC25A29 Gene

Unigene Clusters for SLC25A29 Gene

Solute carrier family 25 (mitochondrial carnitine/acylcarnitine carrier), member 29:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SLC25A29 Gene

ExUns: 1a · 1b · 1c · 1d · 1e ^ 2a · 2b · 2c ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8a · 8b ^ 9 ^ 10a · 10b ^ 11a · 11b · 11c · 11d · 11e · 11f
SP1: - - - - - - - - - -
SP3: - - - - - - - - - - -
SP4: - -
SP5: -
SP6: - - - - -
SP7: - - - - - - - - - - - -
SP8: - - - - - -
SP10: -

Relevant External Links for SLC25A29 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SLC25A29 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SLC25A29 Gene

mRNA differential expression in normal tissues according to GTEx for SLC25A29 Gene

This gene is overexpressed in Thyroid (x10.0).

Protein differential expression in normal tissues from HIPED for SLC25A29 Gene

This gene is overexpressed in Breast (35.1), Bone (15.0), and Adrenal (9.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for SLC25A29 Gene

NURSA nuclear receptor signaling pathways regulating expression of SLC25A29 Gene:


SOURCE GeneReport for Unigene cluster for SLC25A29 Gene:


Evidence on tissue expression from TISSUES for SLC25A29 Gene

  • Nervous system(4.8)
  • Thyroid gland(2)
genes like me logo Genes that share expression patterns with SLC25A29: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for SLC25A29 Gene

Orthologs for SLC25A29 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for SLC25A29 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SLC25A29 33 34
  • 99.23 (n)
(Bos Taurus)
Mammalia SLC25A29 33 34
  • 90.38 (n)
(Canis familiaris)
Mammalia SLC25A29 33 34
  • 89.67 (n)
(Rattus norvegicus)
Mammalia Slc25a29 33
  • 84.27 (n)
(Mus musculus)
Mammalia Slc25a29 33 16 34
  • 83.8 (n)
(Monodelphis domestica)
Mammalia SLC25A29 34
  • 80 (a)
(Ornithorhynchus anatinus)
Mammalia SLC25A29 34
  • 76 (a)
(Gallus gallus)
Aves SLC25A29 33 34
  • 70.12 (n)
(Anolis carolinensis)
Reptilia SLC25A29 34
  • 73 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia slc25a29 33
  • 68.08 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.16277 33
(Danio rerio)
Actinopterygii slc25a29 33 34
  • 71.6 (n)
SLC25A29 (2 of 2) 34
  • 70 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.7448 33
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP009128 33
  • 59.7 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG4995 33 34
  • 54.84 (n)
(Caenorhabditis elegans)
Secernentea C54G10.4 33 34
  • 51.21 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0F17864g 33
  • 45.42 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes YMC1 34 36
  • 32 (a)
YMC2 34
  • 30 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons BAC2 33
  • 47.51 (n)
(Oryza sativa)
Liliopsida Os01g0225000 33
  • 55.35 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 50 (a)
Species where no ortholog for SLC25A29 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for SLC25A29 Gene

Gene Tree for SLC25A29 (if available)
Gene Tree for SLC25A29 (if available)

Paralogs for SLC25A29 Gene

Paralogs for SLC25A29 Gene

genes like me logo Genes that share paralogs with SLC25A29: view

Variants for SLC25A29 Gene

Sequence variations from dbSNP and Humsavar for SLC25A29 Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs1000073123 -- 100,291,885(-) C/T 3_prime_UTR_variant, genic_downstream_transcript_variant, non_coding_transcript_variant
rs1000120847 -- 100,287,181(-) T/C genic_downstream_transcript_variant, intron_variant
rs1000160459 -- 100,282,162(-) C/T genic_downstream_transcript_variant, intron_variant
rs1000176288 -- 100,305,693(-) G/A 5_prime_UTR_variant, coding_sequence_variant, genic_upstream_transcript_variant, intron_variant, missense_variant
rs1000214916 -- 100,295,212(-) ACCCCTCAGTACCCCTCAGT/ACCCCTCAGT 5_prime_UTR_variant, downstream_transcript_variant, genic_downstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for SLC25A29 Gene

Variant ID Type Subtype PubMed ID
esv3635502 CNV gain 21293372
nsv565781 CNV loss 21841781
nsv832875 CNV loss 17160897

Variation tolerance for SLC25A29 Gene

Residual Variation Intolerance Score: 81.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.00; 20.53% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SLC25A29 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SLC25A29 Gene

Disorders for SLC25A29 Gene

MalaCards: The human disease database

(1) MalaCards diseases for SLC25A29 Gene - From: DISEASES

Disorder Aliases PubMed IDs
hyperornithinemia-hyperammonemia-homocitrullinuria syndrome
  • hhh syndrome; hhhs; hhh
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for SLC25A29

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with SLC25A29: view

No data available for UniProtKB/Swiss-Prot and Genatlas for SLC25A29 Gene

Publications for SLC25A29 Gene

  1. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids. (PMID: 24652292) Porcelli V … Palmieri F (The Journal of biological chemistry 2014) 3 4 58
  2. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PMID: 20877624) Hendrickson SL … O'Brien SJ (PloS one 2010) 3 44 58
  3. The human and mouse SLC25A29 mitochondrial transporters rescue the deficient ornithine metabolism in fibroblasts of patients with the hyperornithinemia-hyperammonemia-homocitrullinuria (HHH) syndrome. (PMID: 19287344) Camacho JA … Rioseco-Camacho N (Pediatric research 2009) 3 4 58
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  5. A novel mitochondrial carnitine-acylcarnitine translocase induced by partial hepatectomy and fasting. (PMID: 12882971) Sekoguchi E … Matsuura A (The Journal of biological chemistry 2003) 3 25 58

Products for SLC25A29 Gene

Sources for SLC25A29 Gene

Loading form....