Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SLC16A1-AS1 Gene

Subcategory (RNA class) for SLC16A1-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is


Aliases for SLC16A1-AS1 Gene

  • SLC16A1 Antisense RNA 1 2 3 5

External Ids for SLC16A1-AS1 Gene

Previous GeneCards Identifiers for SLC16A1-AS1 Gene

  • GC01P113502

Summaries for SLC16A1-AS1 Gene

GeneCards Summary for SLC16A1-AS1 Gene

SLC16A1-AS1 (SLC16A1 Antisense RNA 1) is an RNA Gene, and is affiliated with the non-coding RNA class.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SLC16A1-AS1 Gene

Genomics for SLC16A1-AS1 Gene

Regulatory Elements for SLC16A1-AS1 Gene

Enhancers for SLC16A1-AS1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH01F113199 0.7 ENCODE 9.9 +244.2 244190 2.2 STAT1 ZNF680 NRF1 TEAD4 FEZF1 ZBTB40 ZNF143 HNF4G IRF1 ZNF548 LRIG2 LOC100421402 RPS15P1 SLC16A1-AS1 RSBN1 LOC643441
GH01F113026 0.8 ENCODE 7.9 +71.0 70994 1.8 ELF3 MLX ARID4B FEZF1 RAD21 RARA SLC30A9 CREM MIXL1 PPARG SLC16A1 SLC16A1-AS1 RPS15P1 GC01P113034 GC01M112980
GH01F112953 1.2 ENCODE 0.8 -0.4 -407 4.8 PKNOX1 CREB3L1 MLX WRNIP1 ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF143 RPS15P1 LOC100421402 LOC105378910 RSBN1 CAPZA1 LRIG2 SLC16A1 SLC16A1-AS1 AKR7A2P1
GH01F112934 1.3 Ensembl ENCODE 0.3 -19.9 -19892 4.2 ARNT ARID4B ZNF2 FOS REST TBX21 KAT8 MEF2D MIER3 ZNF610 LRIG2 LOC100421402 RSBN1 SLC16A1 AKR7A2P1 SLC16A1-AS1
GH01F112950 0.4 Ensembl 0.4 -5.7 -5715 0.2 GATA2 POLR2A SLC16A1 SLC16A1-AS1 AKR7A2P1
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around SLC16A1-AS1 on UCSC Golden Path with GeneCards custom track

Promoters for SLC16A1-AS1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000542859 -515 5001 PKNOX1 CREB3L1 MLX WRNIP1 ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF143

Genomic Location for SLC16A1-AS1 Gene

112,956,415 bp from pter
113,047,055 bp from pter
90,641 bases
Plus strand

Genomic View for SLC16A1-AS1 Gene

Genes around SLC16A1-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SLC16A1-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SLC16A1-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SLC16A1-AS1 Gene

Proteins for SLC16A1-AS1 Gene

Post-translational modifications for SLC16A1-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for SLC16A1-AS1 Gene

Domains & Families for SLC16A1-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for SLC16A1-AS1 Gene

Function for SLC16A1-AS1 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SLC16A1-AS1 Gene

Localization for SLC16A1-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for SLC16A1-AS1 Gene

Pathways & Interactions for SLC16A1-AS1 Gene

SuperPathways for SLC16A1-AS1 Gene

No Data Available

Interacting Proteins for SLC16A1-AS1 Gene

Gene Ontology (GO) - Biological Process for SLC16A1-AS1 Gene


No data available for Pathways by source and SIGNOR curated interactions for SLC16A1-AS1 Gene

Transcripts for SLC16A1-AS1 Gene

mRNA/cDNA for SLC16A1-AS1 Gene

(7) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for SLC16A1-AS1 Gene

No ASD Table

Relevant External Links for SLC16A1-AS1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SLC16A1-AS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for SLC16A1-AS1 Gene

genes like me logo Genes that share expression patterns with SLC16A1-AS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for SLC16A1-AS1 Gene

Orthologs for SLC16A1-AS1 Gene

Evolution for SLC16A1-AS1 Gene

Gene Tree for SLC16A1-AS1 (if available)
Gene Tree for SLC16A1-AS1 (if available)

No data available for Orthologs for SLC16A1-AS1 Gene

Paralogs for SLC16A1-AS1 Gene

No data available for Paralogs for SLC16A1-AS1 Gene

Variants for SLC16A1-AS1 Gene

Sequence variations from dbSNP and Humsavar for SLC16A1-AS1 Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type
rs387906403 Pathogenic 112,956,192(-) ACAAA(A/G)TGGTG upstream-variant-2KB, utr-variant-5-prime
rs606231172 Pathogenic 112,956,380(-) GGGGA(-/ACGCCGGTCACGTGGCGGGGTGGGG)GGGGG upstream-variant-2KB
rs11102570 -- 112,963,409(+) TCCAT(A/G)TGAAT intron-variant
rs111889661 -- 112,957,303(+) TGTGT(A/G)TTGAA intron-variant, nc-transcript-variant, upstream-variant-2KB
rs113040952 -- 112,959,847(+) CCCTG(A/G)GCTTT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for SLC16A1-AS1 Gene

Variant ID Type Subtype PubMed ID
nsv999915 CNV gain 25217958
nsv480662 CNV novel sequence insertion 20440878
nsv1004102 CNV gain 25217958
esv3894045 CNV gain 25118596
esv3584026 CNV gain 25503493
esv2670706 CNV deletion 23128226
esv24626 CNV loss 19812545

Relevant External Links for SLC16A1-AS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for SLC16A1-AS1 Gene

Disorders for SLC16A1-AS1 Gene

Relevant External Links for SLC16A1-AS1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for SLC16A1-AS1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SLC16A1-AS1 Gene

Publications for SLC16A1-AS1 Gene

  1. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 3 64

Products for SLC16A1-AS1 Gene

Sources for SLC16A1-AS1 Gene

Loading form....