Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SLC16A1-AS1 Gene

Subcategory (RNA class) for SLC16A1-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for SLC16A1-AS1 Gene

  • SLC16A1 Antisense RNA 1 2 3 5
  • ENST00000421157.1 3

External Ids for SLC16A1-AS1 Gene

Previous GeneCards Identifiers for SLC16A1-AS1 Gene

  • GC01P113502

Summaries for SLC16A1-AS1 Gene

GeneCards Summary for SLC16A1-AS1 Gene

SLC16A1-AS1 (SLC16A1 Antisense RNA 1) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for SLC16A1-AS1 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SLC16A1-AS1 Gene

Genomics for SLC16A1-AS1 Gene

Regulatory Elements for SLC16A1-AS1 Gene

Enhancers for SLC16A1-AS1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH01H112696 1.7 Ensembl ENCODE dbSUPER 10.2 -254.0 -253963 11.2 MLX DMAP1 YY1 ZNF143 SP3 ZC3H11A MEF2D SSRP1 GLIS1 NBN ST7L LOC100421402 LRIG2 CAPZA1 SLC16A1-AS1 DDX20 WNT2B RHOC GC01M112698 PIR32287
GH01H112671 1.1 ENCODE 10.2 -282.4 -282395 4.6 HDGF PKNOX1 ARNT ARID4B SIN3A YY1 ZNF207 SP3 REST SMARCB1 ST7L LRIG2 LOC100421402 SLC16A1-AS1 CAPZA1 MOV10 GC01P112680
GH01H111990 1 ENCODE 11.2 -965.2 -965194 2.3 HDGF PKNOX1 ZNF133 SIN3A GLI4 ZNF2 ZBTB7B YY1 GLIS2 ZNF207 ST7L ENSG00000243960 DDX20 CEPT1 KCND3-AS1 DRAM2 HIGD1AP12 MOV10 LINC01750 LOC105378910
GH01H113026 0.9 ENCODE 7.9 +71.0 70994 1.8 ELF3 FOXA2 MLX ARID4B FEZF1 RAD21 RARA SLC30A9 CREM MIXL1 SLC16A1 SLC16A1-AS1 RPS15P1 GC01P113034 GC01M112980
GH01H113199 0.6 ENCODE 9.9 +244.2 244190 2.2 NFIC STAT1 PRDM6 ZNF680 NFIB NRF1 FEZF1 ZNF548 LRIG2 LOC100421402 RPS15P1 SLC16A1-AS1 RSBN1 ST7L LOC643441
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around SLC16A1-AS1 on UCSC Golden Path with GeneCards custom track

Promoters for SLC16A1-AS1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000011557 -315 3801 HDGF PKNOX1 MLX ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF143

Genomic Locations for SLC16A1-AS1 Gene

Genomic Locations for SLC16A1-AS1 Gene
chr1:112,956,415-113,047,055
(GRCh38/hg38)
Size:
90,641 bases
Orientation:
Plus strand
chr1:113,499,020-113,542,118
(GRCh37/hg19)

Genomic View for SLC16A1-AS1 Gene

Genes around SLC16A1-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SLC16A1-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SLC16A1-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SLC16A1-AS1 Gene

Proteins for SLC16A1-AS1 Gene

Post-translational modifications for SLC16A1-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for SLC16A1-AS1 Gene

Domains & Families for SLC16A1-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for SLC16A1-AS1 Gene

Function for SLC16A1-AS1 Gene

Phenotypes From GWAS Catalog for SLC16A1-AS1 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SLC16A1-AS1 Gene

Localization for SLC16A1-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for SLC16A1-AS1 Gene

Pathways & Interactions for SLC16A1-AS1 Gene

SuperPathways for SLC16A1-AS1 Gene

No Data Available

Interacting Proteins for SLC16A1-AS1 Gene

Gene Ontology (GO) - Biological Process for SLC16A1-AS1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for SLC16A1-AS1 Gene

Drugs & Compounds for SLC16A1-AS1 Gene

No Compound Related Data Available

Transcripts for SLC16A1-AS1 Gene

mRNA/cDNA for SLC16A1-AS1 Gene

(7) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for SLC16A1-AS1 Gene

No ASD Table

Relevant External Links for SLC16A1-AS1 Gene

GeneLoc Exon Structure for
SLC16A1-AS1
ECgene alternative splicing isoforms for
SLC16A1-AS1

Expression for SLC16A1-AS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SLC16A1-AS1 Gene

genes like me logo Genes that share expression patterns with SLC16A1-AS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for SLC16A1-AS1 Gene

Orthologs for SLC16A1-AS1 Gene

Evolution for SLC16A1-AS1 Gene

ENSEMBL:
Gene Tree for SLC16A1-AS1 (if available)
TreeFam:
Gene Tree for SLC16A1-AS1 (if available)

No data available for Orthologs for SLC16A1-AS1 Gene

Paralogs for SLC16A1-AS1 Gene

No data available for Paralogs for SLC16A1-AS1 Gene

Variants for SLC16A1-AS1 Gene

Sequence variations from dbSNP and Humsavar for SLC16A1-AS1 Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type
rs387906403 Pathogenic 112,956,192(-) ACAAA(A/G)TGGTG upstream-variant-2KB, utr-variant-5-prime
rs606231172 Pathogenic 112,956,380(-) GGGGA(-/ACGCCGGTCACGTGGCGGGGTGGGG)GGGGG upstream-variant-2KB
rs58047463 Likely benign 112,956,232(-) GCCCC(-/C)GGCGG upstream-variant-2KB, utr-variant-5-prime
rs60958518 Likely benign 112,956,274(-) GCGGC(-/GGCGGC)CGGGA upstream-variant-2KB, utr-variant-5-prime
rs144301005 Uncertain significance 112,956,082(+) GGTGG(A/C)GCAGG upstream-variant-2KB, utr-variant-5-prime

Structural Variations from Database of Genomic Variants (DGV) for SLC16A1-AS1 Gene

Variant ID Type Subtype PubMed ID
nsv999915 CNV gain 25217958
nsv480662 CNV novel sequence insertion 20440878
nsv1004102 CNV gain 25217958
esv3894045 CNV gain 25118596
esv3584026 CNV gain 25503493
esv2670706 CNV deletion 23128226
esv24626 CNV loss 19812545

Relevant External Links for SLC16A1-AS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
SLC16A1-AS1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for SLC16A1-AS1 Gene

Disorders for SLC16A1-AS1 Gene

Relevant External Links for SLC16A1-AS1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
SLC16A1-AS1

No disorders were found for SLC16A1-AS1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SLC16A1-AS1 Gene

Publications for SLC16A1-AS1 Gene

  1. Expression pattern of genome-scale long noncoding RNA following acute myocardial infarction in Chinese Uyghur patients. (PMID: 28418905) Zhai H … Yang YN (Oncotarget 2017) 2 3 60
  2. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 3 60

Products for SLC16A1-AS1 Gene

Sources for SLC16A1-AS1 Gene

Content
Loading form....