Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SLC16A1 Gene

Aliases for SLC16A1 Gene

  • Solute Carrier Family 16 Member 1 2 3 4 5
  • Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) 2 3
  • Solute Carrier Family 16 (Monocarboxylic Acid Transporters), Member 1 2 3
  • Solute Carrier Family 16 (Monocarboxylate Transporter), Member 1 2 3
  • MCT 1 3 4
  • MCT1 3 4
  • Monocarboxylate Transporter 1 3
  • MCT1D 3
  • HHF7 3
  • MCT 3

External Ids for SLC16A1 Gene

Previous GeneCards Identifiers for SLC16A1 Gene

  • GC01M113870
  • GC01M112339
  • GC01M112557
  • GC01M112753
  • GC01M113166
  • GC01M113255
  • GC01M113454
  • GC01M111313

Summaries for SLC16A1 Gene

Entrez Gene Summary for SLC16A1 Gene

  • The protein encoded by this gene is a proton-linked monocarboxylate transporter that catalyzes the movement of many monocarboxylates, such as lactate and pyruvate, across the plasma membrane. Mutations in this gene are associated with erythrocyte lactate transporter defect. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2009]

GeneCards Summary for SLC16A1 Gene

SLC16A1 (Solute Carrier Family 16 Member 1) is a Protein Coding gene. Diseases associated with SLC16A1 include Erythrocyte Lactate Transporter Defect and Monocarboxylate Transporter 1 Deficiency. Among its related pathways are Metabolism and Cell surface interactions at the vascular wall. GO annotations related to this gene include protein homodimerization activity and monocarboxylic acid transmembrane transporter activity. An important paralog of this gene is SLC16A7.

UniProtKB/Swiss-Prot for SLC16A1 Gene

  • Proton-coupled monocarboxylate transporter. Catalyzes the rapid transport across the plasma membrane of many monocarboxylates such as lactate, pyruvate, branched-chain oxo acids derived from leucine, valine and isoleucine, and the ketone bodies acetoacetate, beta-hydroxybutyrate and acetate. Depending on the tissue and on cicumstances, mediates the import or export of lactic acid and ketone bodies. Required for normal nutrient assimilation, increase of white adipose tissue and body weight gain when on a high-fat diet. Plays a role in cellular responses to a high-fat diet by modulating the cellular levels of lactate and pyruvate, small molecules that contribute to the regulation of central metabolic pathways and insulin secretion, with concomitant effects on plasma insulin levels and blood glucose homeostasis.

Tocris Summary for SLC16A1 Gene

  • Monocarboxylate transporters (MCT) catalyze the bidirectional proton-linked transport of short-chain monocarboxylates such as L-lactate, ketone bodies and pyruvate across the plasma membrane of mammalian cells. MCT1-4 are key in the regulation of many cellular processes.

Gene Wiki entry for SLC16A1 Gene

No data available for PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SLC16A1 Gene

Genomics for SLC16A1 Gene

Regulatory Elements for SLC16A1 Gene

Enhancers for SLC16A1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH01F112934 1.3 Ensembl ENCODE 19 +20.5 20490 4.2 ARNT ARID4B ZNF2 FOS REST TBX21 KAT8 MEF2D MIER3 ZNF610 LRIG2 LOC100421402 RSBN1 SLC16A1 AKR7A2P1 SLC16A1-AS1
GH01F113040 1.6 FANTOM5 Ensembl ENCODE 11.3 -85.3 -85327 4.1 PKNOX1 ATF1 ARNT ARID4B DMAP1 ELK1 GATA2 DEK NCOA1 REST LRIG2 LOC100996251 SLC16A1 RHOC PPM1J RPS15P1 GC01P113034 PIRC4
GH01F112903 1.2 Ensembl ENCODE 10.9 +51.8 51798 4.1 HDGF PKNOX1 ATF1 YY1 CBX5 GATA2 FOS ZNF263 SMARCB1 MBD2 SLC16A1 RSBN1 LOC100421402 RPL39P8 AKR7A2P1
GH01F112881 1.3 Ensembl ENCODE 8.3 +74.7 74690 2.6 HDGF ARNT ARID4B YBX1 GLIS2 ZNF143 KDM4B DEK ZNF263 MCM3 LRIG2 RSBN1 LOC100421402 SLC16A1 GC01M112861 LOC105378911
GH01F112953 1.2 ENCODE 7.8 +1.0 1005 4.8 PKNOX1 CREB3L1 MLX WRNIP1 ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF143 RPS15P1 LOC100421402 LOC105378910 RSBN1 CAPZA1 LRIG2 SLC16A1 SLC16A1-AS1 AKR7A2P1
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around SLC16A1 on UCSC Golden Path with GeneCards custom track

Promoters for SLC16A1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000542859 1113 5001 PKNOX1 CREB3L1 MLX WRNIP1 ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF143

Genomic Location for SLC16A1 Gene

112,911,847 bp from pter
112,957,013 bp from pter
45,167 bases
Minus strand

Genomic View for SLC16A1 Gene

Genes around SLC16A1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SLC16A1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SLC16A1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SLC16A1 Gene

Proteins for SLC16A1 Gene

  • Protein details for SLC16A1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Monocarboxylate transporter 1
    Protein Accession:
    Secondary Accessions:
    • Q49A45
    • Q5T8R6
    • Q9NSJ9

    Protein attributes for SLC16A1 Gene

    500 amino acids
    Molecular mass:
    53944 Da
    Quaternary structure:
    • Interacts with EMB. Interaction with either BSG or EMB is required for expression at the cell membrane (By similarity). Interacts with BSG; this is required for expression at the cell membrane.
    • Overexpression in pancreatic beta-cells triggers insulin secretion in response to pyruvate, causing hyperinsulemia and hypoglycemia during strenuous exercise.

    Alternative splice isoforms for SLC16A1 Gene


neXtProt entry for SLC16A1 Gene

Post-translational modifications for SLC16A1 Gene

  • Ubiquitination at Lys 224 and Lys 479
  • Modification sites at PhosphoSitePlus

Other Protein References for SLC16A1 Gene

Antibody Products

  • R&D Systems Antibodies for SLC16A1 (MCT1/SLC16A1)
  • Santa Cruz Biotechnology (SCBT) Antibodies for SLC16A1

No data available for DME Specific Peptides for SLC16A1 Gene

Domains & Families for SLC16A1 Gene

Gene Families for SLC16A1 Gene

Protein Domains for SLC16A1 Gene


Suggested Antigen Peptide Sequences for SLC16A1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the major facilitator superfamily. Monocarboxylate porter (TC 2.A.1.13) family.
  • Belongs to the major facilitator superfamily. Monocarboxylate porter (TC 2.A.1.13) family.
genes like me logo Genes that share domains with SLC16A1: view

Function for SLC16A1 Gene

Molecular function for SLC16A1 Gene

GENATLAS Biochemistry:
solute carrier family 16,member A1,monocarboxylic acids transporter,mediating movement of lactate and pyruvate across membranes
UniProtKB/Swiss-Prot Function:
Proton-coupled monocarboxylate transporter. Catalyzes the rapid transport across the plasma membrane of many monocarboxylates such as lactate, pyruvate, branched-chain oxo acids derived from leucine, valine and isoleucine, and the ketone bodies acetoacetate, beta-hydroxybutyrate and acetate. Depending on the tissue and on cicumstances, mediates the import or export of lactic acid and ketone bodies. Required for normal nutrient assimilation, increase of white adipose tissue and body weight gain when on a high-fat diet. Plays a role in cellular responses to a high-fat diet by modulating the cellular levels of lactate and pyruvate, small molecules that contribute to the regulation of central metabolic pathways and insulin secretion, with concomitant effects on plasma insulin levels and blood glucose homeostasis.

Gene Ontology (GO) - Molecular Function for SLC16A1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008028 monocarboxylic acid transmembrane transporter activity TAS --
GO:0015129 lactate transmembrane transporter activity EXP,IBA --
GO:0015130 mevalonate transmembrane transporter activity TAS 1429658
GO:0015293 symporter activity IEA --
GO:0042803 protein homodimerization activity IEA --
genes like me logo Genes that share ontologies with SLC16A1: view
genes like me logo Genes that share phenotypes with SLC16A1: view

Human Phenotype Ontology for SLC16A1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for SLC16A1 Gene

MGI Knock Outs for SLC16A1:

Animal Model Products

miRNA for SLC16A1 Gene

miRTarBase miRNAs that target SLC16A1

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for SLC16A1 Gene

Localization for SLC16A1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SLC16A1 Gene

Cell membrane; Multi-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SLC16A1 gene
Compartment Confidence
plasma membrane 5
extracellular 5
cytoskeleton 5
mitochondrion 3
peroxisome 1
nucleus 1
cytosol 1

Gene Ontology (GO) - Cellular Components for SLC16A1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IEA --
GO:0005813 centrosome IDA 23816619
GO:0005886 plasma membrane TAS --
GO:0005887 integral component of plasma membrane ISS --
GO:0016020 membrane IDA,TAS 19946888
genes like me logo Genes that share ontologies with SLC16A1: view

Pathways & Interactions for SLC16A1 Gene

genes like me logo Genes that share pathways with SLC16A1: view

Gene Ontology (GO) - Biological Process for SLC16A1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006090 pyruvate metabolic process TAS --
GO:0006629 lipid metabolic process IEA --
GO:0006810 transport IEA --
GO:0015718 monocarboxylic acid transport TAS 8124722
GO:0015728 mevalonate transport TAS 1429658
genes like me logo Genes that share ontologies with SLC16A1: view

No data available for SIGNOR curated interactions for SLC16A1 Gene

Drugs & Compounds for SLC16A1 Gene

(45) Drugs for SLC16A1 Gene - From: DrugBank, ApexBio, DGIdb, HMDB, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Nateglinide Approved, Investigational Pharma Transporter, substrate Insulin secretagog agent 23
Salicylic acid Approved, Vet_approved Pharma Channel blocker, Transporter, substrate 175
acetic acid Approved Nutra Full agonist, Agonist, Transporter, substrate 107
Foscarnet Approved Pharma Transporter, substrate 32
Gamma Hydroxybutyric Acid Approved, Illicit Pharma Transporter, inhibitor 0

(17) Additional Compounds for SLC16A1 Gene - From: Novoseek, Tocris, and HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
4-ene-Valproic acid
SR 13800

(3) Tocris Compounds for SLC16A1 Gene

Compound Action Cas Number
AR-C155858 MCT1 and MCT2 inhibitor; inhibits glycolysis in cancer cells 496791-37-8
SR 13800 Potent MCT1 inhibitor 227321-12-2
UK 5099 MCT inhibitor; also inhibits of pyruvate transport 56396-35-1

(3) ApexBio Compounds for SLC16A1 Gene

Compound Action Cas Number
7ACC1 50995-74-9
7ACC2 1472624-85-3
AR-C155858 MCT1 and MCT2 inhibitor 496791-37-8
genes like me logo Genes that share compounds with SLC16A1: view

Transcripts for SLC16A1 Gene

Unigene Clusters for SLC16A1 Gene

Solute carrier family 16, member 1 (monocarboxylic acid transporter 1):
Representative Sequences:

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for SLC16A1 Gene

ExUns: 1a · 1b ^ 2 ^ 3a · 3b ^ 4 ^ 5a · 5b ^ 6
SP3: -

Relevant External Links for SLC16A1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SLC16A1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for SLC16A1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for SLC16A1 Gene

This gene is overexpressed in Retina (10.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for SLC16A1 Gene

Protein tissue co-expression partners for SLC16A1 Gene

NURSA nuclear receptor signaling pathways regulating expression of SLC16A1 Gene:


SOURCE GeneReport for Unigene cluster for SLC16A1 Gene:


mRNA Expression by UniProt/SwissProt for SLC16A1 Gene:

Tissue specificity: Detected in heart and in blood lymphocytes and monocytes (at protein level). Widely expressed.
genes like me logo Genes that share expression patterns with SLC16A1: view

Primer Products

No data available for mRNA differential expression in normal tissues for SLC16A1 Gene

Orthologs for SLC16A1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for SLC16A1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SLC16A1 34 35
  • 99.67 (n)
(Canis familiaris)
Mammalia SLC16A1 34
  • 89.67 (n)
MCT1 35
  • 89 (a)
(Bos Taurus)
Mammalia SLC16A1 34 35
  • 87.47 (n)
(Rattus norvegicus)
Mammalia Slc16a1 34
  • 84.45 (n)
(Mus musculus)
Mammalia Slc16a1 34 16 35
  • 84.01 (n)
(Ornithorhynchus anatinus)
Mammalia SLC16A1 35
  • 80 (a)
(Monodelphis domestica)
Mammalia SLC16A1 35
  • 79 (a)
(Gallus gallus)
Aves SLC16A1 34 35
  • 73.57 (n)
(Anolis carolinensis)
Reptilia SLC16A1 35
  • 79 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia slc16a1 34
  • 70.14 (n)
African clawed frog
(Xenopus laevis)
Amphibia slc16a1-prov 34
(Danio rerio)
Actinopterygii SLC16A1 (1 of 2) 35
  • 74 (a)
slc16a1 34 35
  • 68.63 (n)
Species where no ortholog for SLC16A1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for SLC16A1 Gene

Gene Tree for SLC16A1 (if available)
Gene Tree for SLC16A1 (if available)

Paralogs for SLC16A1 Gene

(10) SIMAP similar genes for SLC16A1 Gene using alignment to 5 proteins: Pseudogenes for SLC16A1 Gene

genes like me logo Genes that share paralogs with SLC16A1: view

Variants for SLC16A1 Gene

Sequence variations from dbSNP and Humsavar for SLC16A1 Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type
rs606231302 Monocarboxylate transporter 1 deficiency (MCT1D) [MIM:616095], Pathogenic 112,917,468(-) AGCCC(A/G)ACCAT reference, missense
rs72552271 Symptomatic deficiency in lactate transport (SDLT) [MIM:245340], Pathogenic 112,913,980(-) TTGCT(A/G)GGAAG reference, missense
rs80358222 Symptomatic deficiency in lactate transport (SDLT) [MIM:245340], Pathogenic 112,917,796(-) CAACC(A/G)AGGCA reference, missense
rs387906403 Pathogenic 112,956,192(-) ACAAA(A/G)TGGTG upstream-variant-2KB, utr-variant-5-prime
rs606231172 Pathogenic 112,956,380(-) GGGGA(-/ACGCCGGTCACGTGGCGGGGTGGGG)GGGGG upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for SLC16A1 Gene

Variant ID Type Subtype PubMed ID
dgv83e212 CNV gain 25503493
esv24626 CNV loss 19812545
esv3584026 CNV gain 25503493
esv3894045 CNV gain 25118596
nsv1004102 CNV gain 25217958
nsv946145 CNV duplication 23825009
nsv999915 CNV gain 25217958

Variation tolerance for SLC16A1 Gene

Residual Variation Intolerance Score: 55.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.83; 17.45% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for SLC16A1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SLC16A1 Gene

Disorders for SLC16A1 Gene

MalaCards: The human disease database

(8) MalaCards diseases for SLC16A1 Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
erythrocyte lactate transporter defect
  • metabolic myopathy due to lactate transporter defect
monocarboxylate transporter 1 deficiency
  • mct1d
hyperinsulinemic hypoglycemia, familial, 7
  • exercise-induced hyperinsulinemic hypoglycemia
slc16a1-related hyperinsulinism
  • hyperinsulinemic hypoglycemia, familial, 7
  • hypoglycaemia
- elite association - COSMIC cancer census association via MalaCards


  • Familial hyperinsulinemic hypoglycemia 7 (HHF7) [MIM:610021]: Dominantly inherited hypoglycemic disorder characterized by inappropriate insulin secretion during anaerobic exercise or on pyruvate load. {ECO:0000269 PubMed:17701893}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Monocarboxylate transporter 1 deficiency (MCT1D) [MIM:616095]: A metabolic disorder characterized by recurrent ketoacidosis, a pathologic state due to ketone formation exceeding ketone utilization. The clinical consequences of ketoacidosis are vomiting, osmotic diuresis, dehydration, and Kussmaul breathing. The condition may progress to decreased consciousness and, ultimately, death. {ECO:0000269 PubMed:25390740}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Symptomatic deficiency in lactate transport (SDLT) [MIM:245340]: Deficiency of lactate transporter may result in an acidic intracellular environment created by muscle activity with consequent degeneration of muscle and release of myoglobin and creatine kinase. This defect might compromise extreme performance in otherwise healthy individuals. {ECO:0000269 PubMed:10590411}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for SLC16A1

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with SLC16A1: view

No data available for Genatlas for SLC16A1 Gene

Publications for SLC16A1 Gene

  1. cDNA cloning of the human monocarboxylate transporter 1 and chromosomal localization of the SLC16A1 locus to 1p13.2-p12. (PMID: 7835905) Garcia C.K. … Francke U. (Genomics 1994) 2 3 4 22 64
  2. Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore. (PMID: 19881260) Lean C.B. … Lee E.J. (Drug Metab. Pharmacokinet. 2009) 3 22 46 64
  3. Physical exercise-induced hypoglycemia caused by failed silencing of monocarboxylate transporter 1 in pancreatic beta cells. (PMID: 17701893) Otonkoski T. … Kere J. (Am. J. Hum. Genet. 2007) 3 4 22 64
  4. Presence and localization of three lactic acid transporters (MCT1, -2, and -4) in separated human granulocytes, lymphocytes, and monocytes. (PMID: 15505343) Merezhinskaya N. … Fishbein W.N. (J. Histochem. Cytochem. 2004) 3 4 22 64
  5. The human monocarboxylate transporter, MCT1: genomic organization and promoter analysis. (PMID: 11944921) Cuff M.A. … Shirazi-Beechey S.P. (Biochem. Biophys. Res. Commun. 2002) 3 4 22 64

Products for SLC16A1 Gene

Sources for SLC16A1 Gene

Loading form....