Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SIGLEC8 Gene

Aliases for SIGLEC8 Gene

  • Sialic Acid Binding Ig Like Lectin 8 2 3 5
  • Sialoadhesin Family Member 2 3 4
  • SIGLEC-8 3 4
  • SAF-2 3 4
  • SAF2 3 4
  • Sialic Acid Binding Ig-Like Lectin 8 2
  • Sialic Acid-Binding Ig-Like Lectin 8 3
  • SIGLEC8L 3
  • CDw329 3

External Ids for SIGLEC8 Gene

Previous GeneCards Identifiers for SIGLEC8 Gene

  • GC19M052585
  • GC19M052315
  • GC19M056630
  • GC19M056646
  • GC19M051955
  • GC19M048286
  • GC19M051956

Summaries for SIGLEC8 Gene

Entrez Gene Summary for SIGLEC8 Gene

  • Sialic acid-binding immunoglobulin (Ig)-like lectins, or SIGLECs (e.g., CD33 (MIM 159590)), are a family of type 1 transmembrane proteins each having a unique expression pattern, mostly in hemopoietic cells. SIGLEC8 is a member of the CD33-like subgroup of SIGLECs, which are localized to 19q13.3-q13.4 and have 2 conserved cytoplasmic tyrosine-based motifs: an immunoreceptor tyrosine-based inhibitory motif, or ITIM (see MIM 604964), and a motif homologous to one identified in signaling lymphocyte activation molecule (SLAM; MIM 603492) that mediates an association with SLAM-associated protein (SAP; MIM 300490) (summarized by Foussias et al., 2000 [PubMed 11095983]).[supplied by OMIM, May 2010]

GeneCards Summary for SIGLEC8 Gene

SIGLEC8 (Sialic Acid Binding Ig Like Lectin 8) is a Protein Coding gene. Among its related pathways are Hematopoietic Stem Cell Differentiation Pathways and Lineage-specific Markers and Innate Immune System. Gene Ontology (GO) annotations related to this gene include transmembrane signaling receptor activity and carbohydrate binding. An important paralog of this gene is SIGLEC12.

UniProtKB/Swiss-Prot for SIGLEC8 Gene

  • Putative adhesion molecule that mediates sialic-acid dependent binding to red blood cells (PubMed:10856141, PubMed:10625619). Preferentially binds to alpha-2,3-linked sialic acid. Also binds to alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface (PubMed:10625619). Recognizes simultaneously epitopes having a terminal N-acetylneuraminic acid (sialic acid) and an underlying 6-O-sulfated galactose. Preferentially binds to Gal-6-sulfated sialyl-Lewis X glycan epitopes (PubMed:27357658).

Gene Wiki entry for SIGLEC8 Gene

Additional gene information for SIGLEC8 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SIGLEC8 Gene

Genomics for SIGLEC8 Gene

GeneHancer (GH) Regulatory Elements for SIGLEC8 Gene

Promoters and enhancers for SIGLEC8 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19I051458 Promoter 0.5 EPDnew 550.8 0.0 -18 0.1 SIGLEC8 SIGLEC25P
GH19I051545 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 16 -91.3 -91317 8 HDGF PKNOX1 SMAD1 MLX ARNT ZFP64 ARID4B SIN3A IRF4 POLR2B SIGLEC6 ZNF175 ZNF841 ZNF616 ZNF836 ZNF808 SIGLEC14 SIGLEC8 ZNF350 CEACAM18
GH19I051360 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 10.2 +93.5 93513 8.5 MLX ZFP64 DMAP1 YY1 SLC30A9 ZNF143 SP3 NFYC PPARGC1A MEF2D ETFB CLDND2 ENSG00000268520 ZNF616 POLD1 ZNF766 ZNF836 ZNF841 ZNF577 ZNF175
GH19I051570 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10 -113.8 -113771 3.6 HDGF PKNOX1 SMAD1 ARNT ARID4B ZNF2 IRF4 YY1 POLR2B ZNF766 ZNF175 ZNF766 ZNF701 ZNF350 ZNF616 ZNF808 ZNF841 SIGLEC14 SIGLEC5 RPL7P51
GH19I051338 Promoter/Enhancer 1.6 Ensembl ENCODE 10.8 +118.7 118671 2.8 HDGF PKNOX1 CLOCK ARNT ARID4B SIN3A YY1 POLR2B ZNF766 ZNF416 ENSG00000267905 ZNF841 ZNF577 POLD1 ZNF616 ZNF175 ZNF480 ZNF766 ZNF350 ZNF836
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SIGLEC8 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SIGLEC8 gene promoter:

Genomic Locations for SIGLEC8 Gene

Genomic Locations for SIGLEC8 Gene
chr19:51,450,847-51,458,456
(GRCh38/hg38)
Size:
7,610 bases
Orientation:
Minus strand
chr19:51,954,101-51,961,710
(GRCh37/hg19)

Genomic View for SIGLEC8 Gene

Genes around SIGLEC8 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SIGLEC8 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SIGLEC8 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SIGLEC8 Gene

Proteins for SIGLEC8 Gene

  • Protein details for SIGLEC8 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9NYZ4-SIGL8_HUMAN
    Recommended name:
    Sialic acid-binding Ig-like lectin 8
    Protein Accession:
    Q9NYZ4
    Secondary Accessions:
    • Q7Z728

    Protein attributes for SIGLEC8 Gene

    Size:
    499 amino acids
    Molecular mass:
    54042 Da
    Quaternary structure:
    No Data Available

    Three dimensional structures from OCA and Proteopedia for SIGLEC8 Gene

    Alternative splice isoforms for SIGLEC8 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for SIGLEC8 Gene

Post-translational modifications for SIGLEC8 Gene

  • Glycosylation at posLast=172172, posLast=249249, and isoforms=2, 3267

Other Protein References for SIGLEC8 Gene

No data available for DME Specific Peptides for SIGLEC8 Gene

Domains & Families for SIGLEC8 Gene

Gene Families for SIGLEC8 Gene

HGNC:
Human Protein Atlas (HPA):
  • CD markers
  • Plasma proteins
  • Predicted membrane proteins

Suggested Antigen Peptide Sequences for SIGLEC8 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9NYZ4

UniProtKB/Swiss-Prot:

SIGL8_HUMAN :
  • Contains 1 copy of a cytoplasmic motif that is referred to as the immunoreceptor tyrosine-based inhibitor motif (ITIM). This motif is involved in modulation of cellular responses. The phosphorylated ITIM motif can bind the SH2 domain of several SH2-containing phosphatases.
  • Belongs to the immunoglobulin superfamily. SIGLEC (sialic acid binding Ig-like lectin) family.
Domain:
  • Contains 1 copy of a cytoplasmic motif that is referred to as the immunoreceptor tyrosine-based inhibitor motif (ITIM). This motif is involved in modulation of cellular responses. The phosphorylated ITIM motif can bind the SH2 domain of several SH2-containing phosphatases.
Family:
  • Belongs to the immunoglobulin superfamily. SIGLEC (sialic acid binding Ig-like lectin) family.
genes like me logo Genes that share domains with SIGLEC8: view

Function for SIGLEC8 Gene

Molecular function for SIGLEC8 Gene

GENATLAS Biochemistry:
sialic acid binding Ig-like lectin 8,specifically expressed by eosinophils,sialoadhesin family,Ig superfamily
UniProtKB/Swiss-Prot Function:
Putative adhesion molecule that mediates sialic-acid dependent binding to red blood cells (PubMed:10856141, PubMed:10625619). Preferentially binds to alpha-2,3-linked sialic acid. Also binds to alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface (PubMed:10625619). Recognizes simultaneously epitopes having a terminal N-acetylneuraminic acid (sialic acid) and an underlying 6-O-sulfated galactose. Preferentially binds to Gal-6-sulfated sialyl-Lewis X glycan epitopes (PubMed:27357658).

Phenotypes From GWAS Catalog for SIGLEC8 Gene

Gene Ontology (GO) - Molecular Function for SIGLEC8 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004888 transmembrane signaling receptor activity TAS 10625619
GO:0005515 protein binding IPI 21982860
GO:0030246 carbohydrate binding TAS,IEA --
genes like me logo Genes that share ontologies with SIGLEC8: view
genes like me logo Genes that share phenotypes with SIGLEC8: view

Animal Models for SIGLEC8 Gene

MGI Knock Outs for SIGLEC8:

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for SIGLEC8 Gene

Localization for SIGLEC8 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SIGLEC8 Gene

Membrane; Single-pass type I membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SIGLEC8 gene
Compartment Confidence
plasma membrane 3
extracellular 3
cytosol 2
endoplasmic reticulum 1
lysosome 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for SIGLEC8 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA,TAS --
genes like me logo Genes that share ontologies with SIGLEC8: view

Pathways & Interactions for SIGLEC8 Gene

genes like me logo Genes that share pathways with SIGLEC8: view

Gene Ontology (GO) - Biological Process for SIGLEC8 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007155 cell adhesion IEA --
GO:0007165 signal transduction TAS 10625619
genes like me logo Genes that share ontologies with SIGLEC8: view

No data available for SIGNOR curated interactions for SIGLEC8 Gene

Drugs & Compounds for SIGLEC8 Gene

No Compound Related Data Available

Transcripts for SIGLEC8 Gene

mRNA/cDNA for SIGLEC8 Gene

(3) REFSEQ mRNAs :
(7) Additional mRNA sequences :
(11) Selected AceView cDNA sequences:
(4) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SIGLEC8 Gene

Sialic acid binding Ig-like lectin 8:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SIGLEC8 Gene

No ASD Table

Relevant External Links for SIGLEC8 Gene

GeneLoc Exon Structure for
SIGLEC8
ECgene alternative splicing isoforms for
SIGLEC8

Expression for SIGLEC8 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SIGLEC8 Gene

mRNA differential expression in normal tissues according to GTEx for SIGLEC8 Gene

This gene is overexpressed in Brain - Spinal cord (cervical c-1) (x7.9), Spleen (x5.5), and Brain - Substantia nigra (x5.1).

Protein differential expression in normal tissues from HIPED for SIGLEC8 Gene

This gene is overexpressed in Heart (52.0) and Adipocyte (17.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for SIGLEC8 Gene



Protein tissue co-expression partners for SIGLEC8 Gene

NURSA nuclear receptor signaling pathways regulating expression of SIGLEC8 Gene:

SIGLEC8

SOURCE GeneReport for Unigene cluster for SIGLEC8 Gene:

Hs.447899

mRNA Expression by UniProt/SwissProt for SIGLEC8 Gene:

Q9NYZ4-SIGL8_HUMAN
Tissue specificity: Expressed specifically on red blood cells namely basophil, mast cells and eosinophils.

Evidence on tissue expression from TISSUES for SIGLEC8 Gene

  • Spleen(4.4)
  • Blood(4.3)
genes like me logo Genes that share expression patterns with SIGLEC8: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and Phenotype-based relationships between genes and organs from Gene ORGANizer for SIGLEC8 Gene

Orthologs for SIGLEC8 Gene

This gene was present in the common ancestor of mammals.

Orthologs for SIGLEC8 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SIGLEC8 34
  • 98 (a)
OneToOne
dog
(Canis familiaris)
Mammalia SIGLEC12 33
  • 70.05 (n)
-- 34
  • 53 (a)
OneToMany
cow
(Bos Taurus)
Mammalia -- 34
  • 70 (a)
OneToMany
LOC618463 33
  • 67.33 (n)
rat
(Rattus norvegicus)
Mammalia Siglec5 33
  • 65.59 (n)
mouse
(Mus musculus)
Mammalia Siglec5 33
  • 65.05 (n)
Siglece 34
  • 54 (a)
OneToMany
Siglecf 16
Species where no ortholog for SIGLEC8 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for SIGLEC8 Gene

ENSEMBL:
Gene Tree for SIGLEC8 (if available)
TreeFam:
Gene Tree for SIGLEC8 (if available)

Paralogs for SIGLEC8 Gene

(9) SIMAP similar genes for SIGLEC8 Gene using alignment to 2 proteins:

Pseudogenes.org Pseudogenes for SIGLEC8 Gene

genes like me logo Genes that share paralogs with SIGLEC8: view

Variants for SIGLEC8 Gene

Sequence variations from dbSNP and Humsavar for SIGLEC8 Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs1000008400 -- 51,460,065(-) T/G upstream_transcript_variant
rs1000195859 -- 51,452,521(-) T/C coding_sequence_variant, missense_variant
rs1000496456 -- 51,456,699(-) G/A/C intron_variant
rs1000607577 -- 51,459,521(-) ATGATGATGATGATGATTAT/AT upstream_transcript_variant
rs1001137131 -- 51,451,105(-) T/C 3_prime_UTR_variant

Structural Variations from Database of Genomic Variants (DGV) for SIGLEC8 Gene

Variant ID Type Subtype PubMed ID
nsv1140251 OTHER inversion 24896259
nsv458724 CNV gain 19166990
nsv579965 CNV gain 21841781

Variation tolerance for SIGLEC8 Gene

Residual Variation Intolerance Score: 92.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 9.51; 88.82% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SIGLEC8 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
SIGLEC8

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SIGLEC8 Gene

Disorders for SIGLEC8 Gene

Additional Disease Information for SIGLEC8

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for SIGLEC8 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SIGLEC8 Gene

Publications for SIGLEC8 Gene

  1. Polymorphisms in the sialic acid-binding immunoglobulin-like lectin-8 (Siglec-8) gene are associated with susceptibility to asthma. (PMID: 20087405) Gao PS … Bochner BS (European journal of human genetics : EJHG 2010) 3 22 44 58
  2. Siglec-8. A novel eosinophil-specific member of the immunoglobulin superfamily. (PMID: 10625619) Floyd H … Crocker PR (The Journal of biological chemistry 2000) 2 3 4 58
  3. Molecular characterization of a Siglec8 variant containing cytoplasmic tyrosine-based motifs, and mapping of the Siglec8 gene. (PMID: 11095983) Foussias G … Diamandis EP (Biochemical and biophysical research communications 2000) 3 4 22 58
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  5. Identification of SAF-2, a novel siglec expressed on eosinophils, mast cells, and basophils. (PMID: 10856141) Kikly KK … White JR (The Journal of allergy and clinical immunology 2000) 3 4 58

Products for SIGLEC8 Gene

Sources for SIGLEC8 Gene

Content
Loading form....