Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SHISA5 Gene

Aliases for SHISA5 Gene

  • Shisa Family Member 5 2 3 5
  • Putative NF-Kappa-B-Activating Protein 120 3 4
  • SCOTIN 3 4
  • Shisa Homolog 5 (Xenopus Laevis) 2
  • Protein Shisa-5 3
  • Shisa Homolog 5 3

External Ids for SHISA5 Gene

Summaries for SHISA5 Gene

Entrez Gene Summary for SHISA5 Gene

  • This gene encodes a member of the shisa family. The encoded protein is localized to the endoplasmic reticulum, and together with p53 induces apoptosis in a caspase-dependent manner. Alternative splicing results in multiple transcript variants. Related pseudogenes of this gene are found on chromosome X. [provided by RefSeq, Apr 2016]

GeneCards Summary for SHISA5 Gene

SHISA5 (Shisa Family Member 5) is a Protein Coding gene. Among its related pathways are DNA damage response. GO annotations related to this gene include signal transducer activity and WW domain binding.

UniProtKB/Swiss-Prot for SHISA5 Gene

  • Can induce apoptosis in a caspase-dependent manner and plays a role in p53/TP53-dependent apoptosis.

No data available for Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SHISA5 Gene

Genomics for SHISA5 Gene

Regulatory Elements for SHISA5 Gene

Enhancers for SHISA5 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH03F048506 1.2 Ensembl ENCODE 26.9 -2.5 -2475 2.2 PKNOX1 ARID4B ZNF48 ZNF121 GLIS2 ZNF143 FOS NFYC MXD4 REST SHISA5 CCDC36 GC03P048507 GC03P048510
GH03F048424 1.4 Ensembl ENCODE 17.3 +74.1 74140 12.2 HDGF PKNOX1 ARNT MLX CREB3L1 WRNIP1 ZFP64 ARID4B SIN3A DMAP1 TMA7 SHISA5 FBXW12 NME6 SPINK8 RNU7-128P NDUFB1P1 CDC25A TREX1 LAMB2
GH03F048439 1.1 ENCODE 16 +64.1 64077 3.2 HDGF PKNOX1 CREB3L1 MLX WRNIP1 ARID4B SIN3A DMAP1 YY1 ZNF143 TMA7 NME6 SHISA5 QRICH1 ENSG00000225399 IMPDH2 CDC25A ZNF589 CCDC51
GH03F048477 0.9 Ensembl ENCODE 17 +26.0 26040 3.2 KLF1 MAX ZIC2 ZFHX2 IKZF1 MLLT1 MYC EGR2 ZXDB TMA7 SHISA5 ATRIP ENSG00000244380 CCDC51 PFKFB4 UCN2 MIR711 COL7A1 FBXW12
GH03F048464 1.2 ENCODE 12.4 +34.7 34738 11.4 HDGF PKNOX1 CREB3L1 WRNIP1 ZFP64 ARID4B SIN3A DMAP1 ZNF2 YY1 TMA7 ATRIP SHISA5 ENSG00000223343 ENSG00000244380 CCDC51 PLXNB1 MIR711 COL7A1 PFKFB4
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around SHISA5 on UCSC Golden Path with GeneCards custom track

Promoters for SHISA5 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00001363435 826 1201 SMARCA5 ZNF263 MAZ STAT1 L3MBTL2 ZFP64 NFXL1 ZIC2 ARID1B GLIS2

Genomic Location for SHISA5 Gene

Chromosome:
3
Start:
48,467,798 bp from pter
End:
48,504,826 bp from pter
Size:
37,029 bases
Orientation:
Minus strand

Genomic View for SHISA5 Gene

Genes around SHISA5 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SHISA5 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SHISA5 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SHISA5 Gene

Proteins for SHISA5 Gene

  • Protein details for SHISA5 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q8N114-SHSA5_HUMAN
    Recommended name:
    Protein shisa-5
    Protein Accession:
    Q8N114
    Secondary Accessions:
    • B3KW99
    • F8W9N8
    • Q69YY9
    • Q7Z433
    • Q8NHL9
    • Q96MW8
    • Q9BV58

    Protein attributes for SHISA5 Gene

    Size:
    240 amino acids
    Molecular mass:
    25582 Da
    Quaternary structure:
    • Interacts with PDCD6; PDCD6 can stabilze SHISA5.

    Alternative splice isoforms for SHISA5 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for SHISA5 Gene

Post-translational modifications for SHISA5 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for SHISA5 Gene

Domains & Families for SHISA5 Gene

Gene Families for SHISA5 Gene

Protein Domains for SHISA5 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for SHISA5 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q8N114

UniProtKB/Swiss-Prot:

SHSA5_HUMAN :
  • The proline-rich region is required for endoplasmic reticulum localization.
  • Belongs to the shisa family.
Domain:
  • The proline-rich region is required for endoplasmic reticulum localization.
Family:
  • Belongs to the shisa family.
genes like me logo Genes that share domains with SHISA5: view

Function for SHISA5 Gene

Molecular function for SHISA5 Gene

UniProtKB/Swiss-Prot Function:
Can induce apoptosis in a caspase-dependent manner and plays a role in p53/TP53-dependent apoptosis.
UniProtKB/Swiss-Prot Induction:
Induced in a p53/TP53-dependent manner in response to cellular stress.

Gene Ontology (GO) - Molecular Function for SHISA5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004871 signal transducer activity IMP 12761501
GO:0005515 protein binding IPI 15064722
genes like me logo Genes that share ontologies with SHISA5: view
genes like me logo Genes that share phenotypes with SHISA5: view

Animal Models for SHISA5 Gene

MGI Knock Outs for SHISA5:

Animal Model Products

miRNA for SHISA5 Gene

Inhibitory RNA Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for SHISA5 Gene

Localization for SHISA5 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SHISA5 Gene

Endoplasmic reticulum membrane; Single-pass type I membrane protein. Nucleus membrane.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SHISA5 gene
Compartment Confidence
extracellular 5
endoplasmic reticulum 4
nucleus 3
plasma membrane 2

Gene Ontology (GO) - Cellular Components for SHISA5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
GO:0005635 nuclear envelope IEA --
GO:0005783 endoplasmic reticulum IEA --
GO:0005789 endoplasmic reticulum membrane IEA --
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with SHISA5: view

Pathways & Interactions for SHISA5 Gene

SuperPathways for SHISA5 Gene

SuperPathway Contained pathways
1 DNA damage response
genes like me logo Genes that share pathways with SHISA5: view

Pathways by source for SHISA5 Gene

1 KEGG pathway for SHISA5 Gene

Gene Ontology (GO) - Biological Process for SHISA5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006915 apoptotic process IEA --
GO:0042771 intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator IEA --
GO:0043123 positive regulation of I-kappaB kinase/NF-kappaB signaling IMP 12761501
GO:0072332 intrinsic apoptotic signaling pathway by p53 class mediator IEA --
genes like me logo Genes that share ontologies with SHISA5: view

No data available for SIGNOR curated interactions for SHISA5 Gene

Transcripts for SHISA5 Gene

Unigene Clusters for SHISA5 Gene

Shisa homolog 5 (Xenopus laevis):
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for SHISA5 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2a · 2b · 2c · 2d ^ 3 ^ 4a · 4b · 4c ^ 5a · 5b · 5c ^ 6 ^ 7a · 7b ^ 8 ^ 9a · 9b · 9c · 9d · 9e · 9f · 9g ^
SP1: - - - - - - - - - - - - -
SP2: - - - - - - - - - - - - - - -
SP3: - - - - - - - - - - - - - - - -
SP4: - - - - - - - - - - - - - - - - - - -
SP5: - - - - - - - - - - - - - -
SP6:
SP7: - - - - - - - - - - - - - - - - - -
SP8:
SP9:
SP10:
SP11: - - - - - - - - - - - - - - - - - -
SP12: -
SP13:
SP14: - - - - - - - -
SP15: - - - - - - - -
SP16: - - - - -
SP17: - - - - - - -
SP18:
SP19:
SP20:
SP21:
SP22:
SP23:

ExUns: 10a · 10b ^ 11 ^ 12a · 12b · 12c ^ 13a · 13b · 13c · 13d · 13e · 13f · 13g · 13h ^ 14a · 14b · 14c
SP1: - -
SP2: - -
SP3: - -
SP4: -
SP5:
SP6: - - -
SP7:
SP8: - -
SP9: - -
SP10: -
SP11: -
SP12:
SP13: - - -
SP14: -
SP15:
SP16:
SP17:
SP18: -
SP19:
SP20: - - - - - - - - - - -
SP21: -
SP22: - - - - - - - - - -
SP23:

Relevant External Links for SHISA5 Gene

GeneLoc Exon Structure for
SHISA5
ECgene alternative splicing isoforms for
SHISA5

Expression for SHISA5 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for SHISA5 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for SHISA5 Gene

This gene is overexpressed in Whole Blood (x7.2).

Protein differential expression in normal tissues from HIPED for SHISA5 Gene

This gene is overexpressed in Urine (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for SHISA5 Gene



Protein tissue co-expression partners for SHISA5 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of SHISA5 Gene:

SHISA5

SOURCE GeneReport for Unigene cluster for SHISA5 Gene:

Hs.414579
genes like me logo Genes that share expression patterns with SHISA5: view

No data available for mRNA Expression by UniProt/SwissProt for SHISA5 Gene

Orthologs for SHISA5 Gene

This gene was present in the common ancestor of chordates.

Orthologs for SHISA5 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SHISA5 34 35
  • 99.68 (n)
rat
(Rattus norvegicus)
Mammalia Shisa5 34
  • 80.84 (n)
mouse
(Mus musculus)
Mammalia Shisa5 34 16 35
  • 74.67 (n)
cow
(Bos Taurus)
Mammalia SHISA5 34 35
  • 73.83 (n)
oppossum
(Monodelphis domestica)
Mammalia SHISA5 35
  • 57 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia SHISA5 35
  • 56 (a)
OneToOne
chicken
(Gallus gallus)
Aves SHISA5 35
  • 69 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia SHISA5 35
  • 50 (a)
OneToOne
Species where no ortholog for SHISA5 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for SHISA5 Gene

ENSEMBL:
Gene Tree for SHISA5 (if available)
TreeFam:
Gene Tree for SHISA5 (if available)

Paralogs for SHISA5 Gene

Pseudogenes.org Pseudogenes for SHISA5 Gene

genes like me logo Genes that share paralogs with SHISA5: view

No data available for Paralogs for SHISA5 Gene

Variants for SHISA5 Gene

Sequence variations from dbSNP and Humsavar for SHISA5 Gene

SNP ID Clin Chr 03 pos Sequence Context AA Info Type
rs76224909 Pathogenic 48,467,562(+) TAGCC(A/C)CACTG downstream-variant-500B, reference, missense
rs78379807 Pathogenic 48,467,317(+) GATGC(-/CCTGCTCAGCATCTGTCAGTGGAGACCACAGGCCCTGCTGCGGTGGGTGGATGC)TCACG downstream-variant-500B, cds-indel
rs79318303 Pathogenic 48,467,523(+) TGGCC(-/CCACTGGGTCTGCTGGCC)ATCCT downstream-variant-500B, cds-indel
rs55999987 Uncertain significance 48,467,452(+) TGGAG(A/G)GAGCA downstream-variant-500B, reference, missense
rs3135945 Benign 48,467,567(+) ACACT(A/G)TATGG downstream-variant-500B, reference, synonymous-codon

Structural Variations from Database of Genomic Variants (DGV) for SHISA5 Gene

Variant ID Type Subtype PubMed ID
nsv508917 CNV insertion 20534489
nsv523981 CNV loss 19592680
nsv590242 CNV loss 21841781
nsv834684 CNV gain 17160897
nsv955596 CNV deletion 24416366
nsv3809 CNV insertion 18451855
esv996619 CNV insertion 20482838
esv992291 CNV insertion 20482838
esv2635148 CNV insertion 19546169
esv1621474 CNV insertion 17803354
dgv8315n54 CNV loss 21841781

Variation tolerance for SHISA5 Gene

Residual Variation Intolerance Score: 81.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.30; 25.86% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for SHISA5 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
SHISA5

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SHISA5 Gene

Disorders for SHISA5 Gene

Relevant External Links for SHISA5

Genetic Association Database (GAD)
SHISA5
Human Genome Epidemiology (HuGE) Navigator
SHISA5
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
SHISA5

No disorders were found for SHISA5 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SHISA5 Gene

Publications for SHISA5 Gene

  1. Scotin, a novel p53-inducible proapoptotic protein located in the ER and the nuclear membrane. (PMID: 12135983) Bourdon J.-C. … Lane D.P. (J. Cell Biol. 2002) 2 3 4 64
  2. Identification of neuroglycan C and interacting partners as potential susceptibility genes for schizophrenia in a Southern Chinese population. (PMID: 19367581) So H.C. … Sham P.C. (Am. J. Med. Genet. B Neuropsychiatr. Genet. 2010) 3 46 64
  3. The calcium binding protein ALG-2 binds and stabilizes Scotin, a p53-inducible gene product localized at the endoplasmic reticulum membrane. (PMID: 17889823) Draeby I. … Berchtold M.W. (Arch. Biochem. Biophys. 2007) 3 4 64
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 64
  5. Large-scale identification and characterization of human genes that activate NF-kappaB and MAPK signaling pathways. (PMID: 12761501) Matsuda A. … Sugano S. (Oncogene 2003) 3 4 64

Products for SHISA5 Gene

Sources for SHISA5 Gene

Content
Loading form....