Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SERPINE3 Gene

Aliases for SERPINE3 Gene

  • Serpin Peptidase Inhibitor, Clade E (Nexin, Plasminogen Activator Inhibitor Type 1), Member 3 2 3

External Ids for SERPINE3 Gene

Previous GeneCards Identifiers for SERPINE3 Gene

  • GC13P050814
  • GC13P051909
  • GC13P032704
  • GC13P051917

Summaries for SERPINE3 Gene

GeneCards Summary for SERPINE3 Gene

SERPINE3 (Serpin Peptidase Inhibitor, Clade E (Nexin, Plasminogen Activator Inhibitor Type 1), Member 3) is a Protein Coding gene. GO annotations related to this gene include serine-type endopeptidase inhibitor activity. An important paralog of this gene is SERPINB12.

UniProtKB/Swiss-Prot for SERPINE3 Gene

  • Probable serine protease inhibitor.

No data available for Entrez Gene Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SERPINE3 Gene

Genomics for SERPINE3 Gene

Regulatory Elements for SERPINE3 Gene

Genomic Location for SERPINE3 Gene

Start:
51,335,773 bp from pter
End:
51,364,735 bp from pter
Size:
28,963 bases
Orientation:
Plus strand

Genomic View for SERPINE3 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for SERPINE3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SERPINE3 Gene

Proteins for SERPINE3 Gene

  • Protein details for SERPINE3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    A8MV23-SERP3_HUMAN
    Recommended name:
    Serpin E3
    Protein Accession:
    A8MV23
    Secondary Accessions:
    • B1V8P3

    Protein attributes for SERPINE3 Gene

    Size:
    424 amino acids
    Molecular mass:
    46963 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for SERPINE3 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for SERPINE3 Gene

Proteomics data for SERPINE3 Gene at MOPED

Post-translational modifications for SERPINE3 Gene

  • Glycosylation at Asn46
  • Modification sites at PhosphoSitePlus

Other Protein References for SERPINE3 Gene

No data available for DME Specific Peptides for SERPINE3 Gene

Domains for SERPINE3 Gene

Gene Families for SERPINE3 Gene

HGNC:
  • SERPIN :Serine (or cysteine) peptidase inhibitors

Protein Domains for SERPINE3 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for SERPINE3 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

A8MV23

UniProtKB/Swiss-Prot:

SERP3_HUMAN :
  • A8MV23
Family:
  • Belongs to the serpin family.
genes like me logo Genes that share domains with SERPINE3: view

Function for SERPINE3 Gene

Molecular function for SERPINE3 Gene

UniProtKB/Swiss-Prot Function: Probable serine protease inhibitor.

Gene Ontology (GO) - Molecular Function for SERPINE3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004867 serine-type endopeptidase inhibitor activity IBA --
genes like me logo Genes that share ontologies with SERPINE3: view

No data available for Enzyme Numbers (IUBMB) , Phenotypes , Animal Models , miRNA , Transcription Factor Targeting and HOMER Transcription for SERPINE3 Gene

Localization for SERPINE3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SERPINE3 Gene

Secreted.

Gene Ontology (GO) - Cellular Components for SERPINE3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005615 extracellular space IBA --
genes like me logo Genes that share ontologies with SERPINE3: view

No data available for Subcellular locations from COMPARTMENTS for SERPINE3 Gene

Pathways for SERPINE3 Gene

SuperPathways for SERPINE3 Gene

No Data Available

Interacting Proteins for SERPINE3 Gene

STRING Interaction Network Preview (showing 2 interactants - click image to see details)
http://string-db.org/version_10/api/image/networkList?limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000428316%0d%0a9606.ENSP00000053867%0d%0a9606.ENSP00000342070%0d%0a
Selected Interacting proteins: ENSP00000428316 for SERPINE3 Gene via STRING

Gene Ontology (GO) - Biological Process for SERPINE3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0010951 negative regulation of endopeptidase activity IBA --
GO:0030162 regulation of proteolysis --
genes like me logo Genes that share ontologies with SERPINE3: view

No data available for Pathways by source for SERPINE3 Gene

Transcripts for SERPINE3 Gene

mRNA/cDNA for SERPINE3 Gene

(2) REFSEQ mRNAs :
(1) Additional mRNA sequences :
(4) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SERPINE3 Gene

Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 3:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for SERPINE3 Gene

No ASD Table

Relevant External Links for SERPINE3 Gene

GeneLoc Exon Structure for
SERPINE3
ECgene alternative splicing isoforms for
SERPINE3

Expression for SERPINE3 Gene

mRNA expression in normal human tissues for SERPINE3 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, and MOPED for SERPINE3 Gene

SOURCE GeneReport for Unigene cluster for SERPINE3 Gene Hs.685891

genes like me logo Genes that share expressions with SERPINE3: view

No data available for mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for SERPINE3 Gene

Orthologs for SERPINE3 Gene

This gene was present in the common ancestor of chordates.

Orthologs for SERPINE3 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SERPINE3 35
  • 99.29 (n)
  • 98.58 (a)
SERPINE3 36
  • 99 (a)
OneToOne
cow
(Bos Taurus)
Mammalia SERPINE3 35
  • 79.62 (n)
  • 70.08 (a)
SERPINE3 36
  • 68 (a)
OneToOne
dog
(Canis familiaris)
Mammalia SERPINE3 35
  • 72.76 (n)
  • 65.27 (a)
SERPINE3 36
  • 64 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Serpine3 35
  • 74.28 (n)
  • 67.26 (a)
Serpine3 16
Serpine3 36
  • 67 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia SERPINE3 36
  • 62 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Serpine3 35
  • 76.66 (n)
  • 69.51 (a)
chicken
(Gallus gallus)
Aves SERPINE3 35
  • 61.37 (n)
  • 53.59 (a)
SERPINE3 36
  • 52 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia SERPINE3 36
  • 46 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia serpine3 35
  • 61.04 (n)
  • 49.36 (a)
zebrafish
(Danio rerio)
Actinopterygii serpine3 35
  • 54.35 (n)
  • 44.56 (a)
serpine3 36
  • 41 (a)
OneToOne
Species with no ortholog for SERPINE3:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for SERPINE3 Gene

ENSEMBL:
Gene Tree for SERPINE3 (if available)
TreeFam:
Gene Tree for SERPINE3 (if available)

Paralogs for SERPINE3 Gene

Selected SIMAP similar genes for SERPINE3 Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with SERPINE3: view

Variants for SERPINE3 Gene

Sequence variations from dbSNP and Humsavar for SERPINE3 Gene

SNP ID Clin Chr 13 pos Sequence Context AA Info Type MAF
rs2897913 -- 51,352,223(+) attaa(A/G)tgttc intron-variant
rs4942995 -- 51,355,168(+) CAAAC(G/T)TTCTA intron-variant
rs6145055 -- 51,355,223(+) TCATT(-/TCCACAGAGCCTTCAGTGGTAAACAA)TCAGA intron-variant
rs7983548 -- 51,361,002(+) CAGTG(C/T)TCTGA intron-variant
rs7996243 -- 51,355,916(+) CTTGA(C/T)ATTTC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for SERPINE3 Gene

Variant ID Type Subtype PubMed ID
nsv832611 CNV Loss 17160897
nsv1041 CNV Insertion 18451855
esv259575 OTHER Complex 20981092
esv259735 OTHER Complex 20981092

Relevant External Links for SERPINE3 Gene

HapMap Linkage Disequilibrium report
SERPINE3

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SERPINE3 Gene

Disorders for SERPINE3 Gene

Relevant External Links for SERPINE3

Genetic Association Database (GAD)
SERPINE3
genes like me logo Genes that share disorders with SERPINE3: view

No data available for UniProtKB/Swiss-Prot for SERPINE3 Gene

Publications for SERPINE3 Gene

  1. The DNA sequence and analysis of human chromosome 13. (PMID: 15057823) Dunham A. … Ross M.T. (Nature 2004) 3 4
  2. Update of the human and mouse SERPIN gene superfamily. (PMID: 24172014) Heit C. … Vasiliou V. (Hum. Genomics 2013) 2 3

Products for SERPINE3 Gene

Sources for SERPINE3 Gene

Back to Top

Content