Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SEPT5-GP1BB Gene

Subcategory (RNA class) for SEPT5-GP1BB Gene


Quality Score for this RNA gene is


Aliases for SEPT5-GP1BB Gene

  • SEPT5-GP1BB Readthrough 3

External Ids for SEPT5-GP1BB Gene

Previous GeneCards Identifiers for SEPT5-GP1BB Gene

  • GC22U900737

Summaries for SEPT5-GP1BB Gene

Entrez Gene Summary for SEPT5-GP1BB Gene

  • This locus represents naturally occurring read-through transcription between the neighboring SEPT5 (septin 5) and GP1BB (glycoprotein Ib (platelet), beta polypeptide) genes on chromosome 22. This read-through transcription arises from inefficient use of an imperfect polyA signal in the upstream SEPT5 gene, whereby transcription continues into the GP1BB gene. Alternative splicing results in multiple read-through variants. The read-through transcripts are candidates for nonsense-mediated mRNA decay (NMD), and are therefore unlikely to produce protein products. [provided by RefSeq, Dec 2010]

GeneCards Summary for SEPT5-GP1BB Gene

SEPT5-GP1BB (SEPT5-GP1BB Readthrough) is an RNA Gene, and is affiliated with the ncRNA class.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SEPT5-GP1BB Gene

Genomics for SEPT5-GP1BB Gene

Regulatory Elements for SEPT5-GP1BB Gene

Enhancers for SEPT5-GP1BB Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around SEPT5-GP1BB on UCSC Golden Path with GeneCards custom track

Promoters for SEPT5-GP1BB Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around SEPT5-GP1BB on UCSC Golden Path with GeneCards custom track

Genomic Location for SEPT5-GP1BB Gene

19,717,220 bp from pter
19,724,774 bp from pter
7,555 bases
Plus strand

Genomic View for SEPT5-GP1BB Gene

Genes around SEPT5-GP1BB on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SEPT5-GP1BB Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SEPT5-GP1BB Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SEPT5-GP1BB Gene

Proteins for SEPT5-GP1BB Gene

Post-translational modifications for SEPT5-GP1BB Gene

No Post-translational modifications

No data available for DME Specific Peptides for SEPT5-GP1BB Gene

Domains & Families for SEPT5-GP1BB Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for SEPT5-GP1BB Gene

Function for SEPT5-GP1BB Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SEPT5-GP1BB Gene

Localization for SEPT5-GP1BB Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for SEPT5-GP1BB Gene

Pathways & Interactions for SEPT5-GP1BB Gene

SuperPathways for SEPT5-GP1BB Gene

No Data Available

Interacting Proteins for SEPT5-GP1BB Gene

Gene Ontology (GO) - Biological Process for SEPT5-GP1BB Gene


No data available for Pathways by source and SIGNOR curated interactions for SEPT5-GP1BB Gene

Drugs & Compounds for SEPT5-GP1BB Gene

No Compound Related Data Available

Transcripts for SEPT5-GP1BB Gene

Alternative Splicing Database (ASD) splice patterns (SP) for SEPT5-GP1BB Gene

No ASD Table

Relevant External Links for SEPT5-GP1BB Gene

GeneLoc Exon Structure for

No data available for mRNA/cDNA for SEPT5-GP1BB Gene

Expression for SEPT5-GP1BB Gene

mRNA expression in normal human tissues for SEPT5-GP1BB Gene

genes like me logo Genes that share expression patterns with SEPT5-GP1BB: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for SEPT5-GP1BB Gene

Orthologs for SEPT5-GP1BB Gene

No data available for Orthologs and Evolution for SEPT5-GP1BB Gene

Paralogs for SEPT5-GP1BB Gene

No data available for Paralogs for SEPT5-GP1BB Gene

Variants for SEPT5-GP1BB Gene

Sequence variations from dbSNP and Humsavar for SEPT5-GP1BB Gene

SNP ID Clin Chr 22 pos Sequence Context AA Info Type
rs754661200 -- 19,724,458(+) GACGA(-/GTCCTGAGGAGAGAACCGGTGC)GTCCT nc-transcript-variant

Structural Variations from Database of Genomic Variants (DGV) for SEPT5-GP1BB Gene

Variant ID Type Subtype PubMed ID
dgv725n67 CNV gain 20364138
esv22571 CNV loss 19812545
esv2751940 CNV gain 17911159
esv3575418 CNV gain 25503493
esv3647279 CNV gain 21293372
esv3893434 CNV gain 25118596
nsv517478 CNV loss 19592680
nsv588216 CNV gain 21841781
nsv828938 CNV gain 20364138
nsv828939 CNV loss 20364138
nsv828943 CNV loss 20364138
nsv834128 CNV loss 17160897
nsv834129 CNV loss 17160897
nsv953023 CNV deletion 24416366

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Variation tolerance and Relevant External Links for SEPT5-GP1BB Gene

Disorders for SEPT5-GP1BB Gene

No disorders were found for SEPT5-GP1BB Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for SEPT5-GP1BB Gene

Publications for SEPT5-GP1BB Gene

  1. Expression of conjoined genes: another mechanism for gene regulation in eukaryotes. (PMID: 20967262) Prakash T. … Taylor T.D. (PLoS ONE 2010) 3 65
  2. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 3 65
  3. Structure and expression of the human septin gene HCDCREL-1. (PMID: 9611266) Yagi M. … Ware J. (Gene 1998) 3 65
  4. Alternative expression of platelet glycoprotein Ib(beta) mRNA from an adjacent 5' gene with an imperfect polyadenylation signal sequence. (PMID: 9022087) Zieger B. … Ware J. (J. Clin. Invest. 1997) 3 65
  5. Complementary DNA cloning of the alternatively expressed endothelial cell glycoprotein Ib beta (GPIb beta) and localization of the GPIb beta gene to chromosome 22. (PMID: 8200976) Kelly M.D. … Konkle B.A. (J. Clin. Invest. 1994) 3 65

Products for SEPT5-GP1BB Gene

Sources for SEPT5-GP1BB Gene
