Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SCARNA9L Gene

Subcategory (RNA class) for SCARNA9L Gene

lncRNA

Aliases for SCARNA9L Gene

  • Small Cajal Body-Specific RNA 9-Like 2 3
  • Small Cajal Body-Specific RNA 9-Like (Retrotransposed) 2

External Ids for SCARNA9L Gene

ORGUL Members for SCARNA9L Gene

Previous GeneCards Identifiers for SCARNA9L Gene

  • GC0XU900980
  • GC0XM020066
  • GC0XM020155
  • GC0XM020157
  • GC0XM020161
  • GC0XM020166

Summaries for SCARNA9L Gene

GeneCards Summary for SCARNA9L Gene

SCARNA9L (Small Cajal Body-Specific RNA 9-Like) is a Pseudogene, and is affiliated with the lncRNA class.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SCARNA9L Gene

Genomics for SCARNA9L Gene

Regulatory Elements for SCARNA9L Gene

Genomic Location for SCARNA9L Gene

Start:
20,136,066 bp from pter
End:
20,136,413 bp from pter
Size:
348 bases
Orientation:
Minus strand

Genomic View for SCARNA9L Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for SCARNA9L Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SCARNA9L Gene

Proteins for SCARNA9L Gene

Post-translational modifications for SCARNA9L Gene

No Post-translational modifications

No data available for DME Specific Peptides for SCARNA9L Gene

Domains for SCARNA9L Gene

Gene Families for SCARNA9L Gene

HGNC:
  • SCARNA :ncRNAs / Small nucleolar RNAs : Small cajal body-specific

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with SCARNA9L: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for SCARNA9L Gene

Function for SCARNA9L Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targeting and HOMER Transcription for SCARNA9L Gene

Localization for SCARNA9L Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for SCARNA9L Gene

Pathways for SCARNA9L Gene

SuperPathways for SCARNA9L Gene

No Data Available

Interacting Proteins for SCARNA9L Gene

Gene Ontology (GO) - Biological Process for SCARNA9L Gene

None

No data available for Pathways by source for SCARNA9L Gene

Transcripts for SCARNA9L Gene

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for SCARNA9L

Primer Products

  • QuantiTect SYBR Green Assays in human,mouse,rat
  • Pre-validated RT² qPCR Primer Assay in human,mouse,rat
  • QuantiFast Probe-based Assays in human,mouse,rat

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for SCARNA9L Gene

No ASD Table

Relevant External Links for SCARNA9L Gene

GeneLoc Exon Structure for
SCARNA9L
ECgene alternative splicing isoforms for
SCARNA9L

No data available for mRNA/cDNA for SCARNA9L Gene

Expression for SCARNA9L Gene

No Expression Related Data Available

In Situ Assay Products

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Expression partners for SCARNA9L Gene

Orthologs for SCARNA9L Gene

No data available for Orthologs and Evolution for SCARNA9L Gene

Paralogs for SCARNA9L Gene

No data available for Paralogs for SCARNA9L Gene

Variants for SCARNA9L Gene

Sequence variations from dbSNP and Humsavar for SCARNA9L Gene

SNP ID Clin Chr 0X pos Sequence Context AA Info Type MAF
rs377360045 -- 20,137,185(+) CACGC(-/CTGTAATCCCAGCACTTTCGGAGGCCGAGACGGGTGGATCACGA)GGTTA upstream-variant-2KB

Relevant External Links for SCARNA9L Gene

HapMap Linkage Disequilibrium report
SCARNA9L

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for SCARNA9L Gene

Disorders for SCARNA9L Gene

No disorders were found for SCARNA9L Gene.

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Novoseek inferred disease relationships , Genatlas and External Links for SCARNA9L Gene

Publications for SCARNA9L Gene

  1. snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome. (PMID: 16990247) Yang J.H. … Qu L.H. (Nucleic Acids Res. 2006) 3

Products for SCARNA9L Gene

Sources for SCARNA9L Gene

Back to Top

Content