Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SCARNA13 Gene

Subcategory (RNA class) for SCARNA13 Gene

scaRNA

Quality Score for this RNA gene is

3

Aliases for SCARNA13 Gene

  • Small Cajal Body-Specific RNA 13 2 3 5
  • U93 3

External Ids for SCARNA13 Gene

ORGUL Members for SCARNA13 Gene

Previous GeneCards Identifiers for SCARNA13 Gene

  • GC14U900662
  • GC14M095071
  • GC14M095999
  • GC14M076185

Summaries for SCARNA13 Gene

GeneCards Summary for SCARNA13 Gene

SCARNA13 (Small Cajal Body-Specific RNA 13) is an RNA Gene, and is affiliated with the scaRNA class.

Additional gene information for SCARNA13 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SCARNA13 Gene

Genomics for SCARNA13 Gene

GeneHancer (GH) Regulatory Elements for SCARNA13 Gene

Promoters and enhancers for SCARNA13 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH14I095530 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 561.3 -1.2 -1246 8.8 PKNOX1 CLOCK FOXA2 MLX ARNT ARID4B NEUROD1 SIN3A DMAP1 ZNF2 GLRX5 SCARNA13 SNHG10 GC14M095530 GC14M095534 PAPOLA LOC101929107 DICER1
GH14I095260 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 48.5 +269.5 269460 7.5 PKNOX1 FOXA2 SMAD1 ARID4B SIN3A IRF4 YY1 ZNF143 FOS DEK SNHG10 SCARNA13 CLMN DICER1 ENSG00000258615
GH14I095290 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 41.4 +242.0 241965 2.4 PKNOX1 SMAD1 ZFP64 NCOA2 ZNF121 ATF7 ZNF214 RXRA ZNF662 ZNF491 SNHG10 SCARNA13 DICER1 CLMN BDKRB1 ENSG00000258615
GH14I094597 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 22.9 +933.4 933425 6.1 FOXA2 MLX ZFP64 ARID4B SIN3A DMAP1 YY1 SLC30A9 FOS SP5 SERPINA10 SERPINA3 SERPINA1 SERPINA5 SCARNA13 SNHG10 DICER1 SERPINA6 SERPINA11 SERPINA4
GH14I095254 Enhancer 1.3 Ensembl ENCODE dbSUPER 27 +277.9 277903 2.2 INSM2 KLF17 FEZF1 GLIS2 ZNF366 ZSCAN5C SCRT2 ZNF143 ZNF548 ETV6 SNHG10 CLMN SCARNA13 DICER1 ENSG00000258615
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SCARNA13 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SCARNA13 gene promoter:

Genomic Locations for SCARNA13 Gene

Genomic Locations for SCARNA13 Gene
chr14:95,533,355-95,533,629
(GRCh38/hg38)
Size:
275 bases
Orientation:
Minus strand
chr14:95,999,692-95,999,966
(GRCh37/hg19)

Genomic View for SCARNA13 Gene

Genes around SCARNA13 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SCARNA13 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SCARNA13 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SCARNA13 Gene

Proteins for SCARNA13 Gene

Post-translational modifications for SCARNA13 Gene

No Post-translational modifications

No data available for DME Specific Peptides for SCARNA13 Gene

Domains & Families for SCARNA13 Gene

Gene Families for SCARNA13 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with SCARNA13: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for SCARNA13 Gene

Function for SCARNA13 Gene

Phenotypes From GWAS Catalog for SCARNA13 Gene

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SCARNA13 Gene

Localization for SCARNA13 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for SCARNA13 Gene

Pathways & Interactions for SCARNA13 Gene

SuperPathways for SCARNA13 Gene

No Data Available

Interacting Proteins for SCARNA13 Gene

Gene Ontology (GO) - Biological Process for SCARNA13 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for SCARNA13 Gene

Drugs & Compounds for SCARNA13 Gene

No Compound Related Data Available

Transcripts for SCARNA13 Gene

mRNA/cDNA for SCARNA13 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SCARNA13 Gene

No ASD Table

Relevant External Links for SCARNA13 Gene

GeneLoc Exon Structure for
SCARNA13
ECgene alternative splicing isoforms for
SCARNA13

Expression for SCARNA13 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SCARNA13 Gene

NURSA nuclear receptor signaling pathways regulating expression of SCARNA13 Gene:

SCARNA13
genes like me logo Genes that share expression patterns with SCARNA13: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for SCARNA13 Gene

Orthologs for SCARNA13 Gene

This gene was present in the common ancestor of chordates.

Orthologs for SCARNA13 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SCARNA13 34
  • 99 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Scarna13 34
  • 86 (a)
OneToMany
Gm25624 34
  • 79 (a)
OneToMany
Gm26489 34
  • 78 (a)
OneToMany
cow
(Bos Taurus)
Mammalia SCARNA13 34
  • 83 (a)
OneToOne
dog
(Canis familiaris)
Mammalia SCARNA13 34
  • 80 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia SCARNA13 34
  • 77 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia SCARNA13 34
  • 72 (a)
OneToOne
chicken
(Gallus gallus)
Aves SCARNA13 34
  • 74 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia SCARNA13 34
  • 68 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii SCARNA13 34
  • 56 (a)
OneToOne
Species where no ortholog for SCARNA13 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for SCARNA13 Gene

ENSEMBL:
Gene Tree for SCARNA13 (if available)
TreeFam:
Gene Tree for SCARNA13 (if available)

Paralogs for SCARNA13 Gene

No data available for Paralogs for SCARNA13 Gene

Variants for SCARNA13 Gene

Sequence variations from dbSNP and Humsavar for SCARNA13 Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs121908584 pathogenic, Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive 95,535,383(-) A/G upstream_transcript_variant
rs869320757 pathogenic, Spasticity, childhood-onset, with hyperglycinemia 95,535,236(-) GAAGAAG/GAAG upstream_transcript_variant
rs869320758 pathogenic, Spasticity, childhood-onset, with hyperglycinemia 95,535,169(-) CGGGCGTGCGGGCG/CGGGCGTGCGGGCGTGCGGGCG upstream_transcript_variant
rs1057524469 likely-benign, not specified 95,535,170(-) G/C upstream_transcript_variant
rs554961847 likely-benign, not specified 95,535,074(-) C/T upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for SCARNA13 Gene

Variant ID Type Subtype PubMed ID
dgv89e55 CNV gain 17911159
esv3635400 CNV gain 21293372
nsv1042858 CNV gain 25217958
nsv565631 CNV gain 21841781

Additional Variant Information for SCARNA13 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
SCARNA13

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for SCARNA13 Gene

Disorders for SCARNA13 Gene

Additional Disease Information for SCARNA13

No disorders were found for SCARNA13 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SCARNA13 Gene

Publications for SCARNA13 Gene

  1. A Cajal body-specific pseudouridylation guide RNA is composed of two box H/ACA snoRNA-like domains. (PMID: 12409454) Kiss AM … Kiss T (Nucleic acids research 2002) 2 3 58
  2. hNaf1 is required for accumulation of human box H/ACA snoRNPs, scaRNPs, and telomerase. (PMID: 16601202) Hoareau-Aveilla C … Henry Y (RNA (New York, N.Y.) 2006) 3 58

Products for SCARNA13 Gene

Sources for SCARNA13 Gene

Content
Loading form....